Introduction

Regulated mitochondrial function is responsible for energy-releasing metabolic reactions, cell signalling and apoptosis and is vital to the developing embryo. Mitochondrial dysfunction may lead to developmental arrest, embryo death or developmental failure in utero1,2,3, and has been implicated in the development of a range of diseases in childhood or adulthood, such as autism4,5 and Alzheimer’s6,7,8. Furthermore, studies suggest that mitochondrial DNA content may predict embryo viability in assisted reproduction therapies9. More detailed understanding of mitochondrial function in oocytes and developing embryos is however needed to improve our understanding of how early development affects health and disease throughout life.

Oxidative phsophorylation

The primary function of mitochondria is to provide energy in the form of Adenosine Triphosphate (ATP) which is coupled to the consumption of oxygen by oxidative phosphorylation (OXPHOS)10. Therefore, ATP synthesis and oxygen consumption are tightly linked and regulated. Whilst glycolytic activity also produces ATP in oocytes and early embryos, dramatically more ATP is produced by OXPHOS11,12,13. Oxygen consumption therefore directly correlates to levels of aerobic respiration and is used as a marker of overall metabolism in mammalian oocytes and embryos12,14 which may reflect embryo viability15. OXPHOS reportedly increases during preimplantation embryo development to provide an increasing proportion of total ATP in order to meet the increasing energy demand of protein synthesis and blastocoel formation15,16. Additionally, by the blastocyst stage, cells have differentiated into trophectoderm (TE), from which placenta tissue is derived, and inner cell mass (ICM), which gives rise to the fetus. These cell types are believed to have different metabolic phenotypes17, with TE notably more metabolically active than ICM. However, there is currently no established method to measure TE vs ICM metabolism without biopsy.

Measuring oxygen metabolism

Due to the vital role of oxygen in mitochondrial metabolism, several methods of measuring oxygen consumption in the oocyte and embryo have been reported. Contemporary and emerging methods include the Unisense Nanorespirometer15,18, the self-referencing electrode19 and bespoke electrochemical devices20,21. Recent developments include combining electrochemistry with microfluidic technologies22,23 for embryo-compatible devices. Obeidat and colleagues24 report detecting oxygen consumption alongside glucose consumption, lactate production and pH in individual equine blastocysts using multiple electrochemical sensors. Extracellular flux analysis using the Seahorse Bioanalyzer (Agilent) has recently been published as a more user-friendly, rapid method of profiling the components of respiration in small groups of oocytes or preimplantation embryos25. However there has to date been no report of changes in intracellular oxygen concentration (icO2) within the oocyte or embryo itself.

Probing mitochondrial function

As noted previously, coupling of mitochondrial oxygen consumption to ATP production is tightly regulated within tissues. However, it is notable that tissues can modulate mitochondrial oxygen consumption and ATP production to fulfil other roles, such as heat generation by brown adipose tissue27,28. And that the contributions of different mitochondrial complexes and processes can be elucidated using metabolic poisons, as recently reported by the Sturmey group25,29. Exogenous uncouplers, such as carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP), disrupt the regulation of the proton gradient and increase mitochondrial oxygen consumption to its maximum, whilst preventing production of ATP by OXPHOS14,25,28,29,30. FCCP also leads to reduced ATP content in human oocytes31, as well as increased glucose consumption and a shift in redox state in equine embryos31. The difference between basal and maximal oxygen consumption reveals the spare respiratory capacity; a phenomenon which can enable tissues to adapt to changing ATP demand30. Inhibitors of mitochondrial protein complex III, such as antimycin, block mitochondrial oxygen consumption and mitochondrial ATP production completely14,25,28,29,30. These are used to quantify the contributions of mitochondrial and non-mitochondrial oxygen consumption in vitro.

Embryo mitochondria

It is an essential requirement that the number, localisation and function of mitochondria are sufficient to support oocyte developmental competence through OXPHOS3,26,32. Indeed, oocyte maturation reportedly involves a burst of mitochondrial DNA replication, as indicated by mitochondrial DNA copy number33,34.

However, the number of mitochondria per embryo remain fixed from the 1 cell zygote to the 100–200 cell blastocyst, as the cellular machinery necessary to replicate the organelles are not present until postimplantation26,36,37. Mitochondria mature from a globular, condensed form into the elongated classical structure with an increased number of cristae during preimplantation development26. This occurs in parallel with an increase in OXPHOS activity from the zygote to the blastocyst52,66,67. It is tempting to speculate that the resulting increase in surface area:volume ratio could increase mitochondrial function without changing the number of mitochondria. This study therefore aims to investigate whether sensitivity of icO2 to maximal and ablated mitochondrial oxygen consumption, indicated by FCCP and antimycin respectively, change during in vitro oocyte maturation and preimplantation embryo development in line with mitochondrial maturation.

The MM2 icO2 probe

One reported method to measure icO2 in mammalian cell culture is the multimodal MM2 probe, developed by Papkovsky and colleagues38 Several studies report that this and similar nanoparticle probes are suitable for highly sensitive ratiometric measurements in a variety of tissue types including monolayer and spheroid cultures38,39,40,41,42. MM2 is an intracellular label consisting of an oxygen-sensitive phosphorescent reporter dye Pt(II)-5,10,15,20-tetrakis-(2,3,4,5,6-pentafluorophenyl)-porphyrin (PtTFPP; emission at 650 nm) and a poly(9,9-dioctylfluorene) reference fluorophore (PFO, emission at 410–450 nm), within 70 nm nanoparticles38. The probe is ratiometric; the PtTFPP emission peak at 650 nm is quenched by oxygen, while the PFO emission peak at 440 nm is oxygen insensitive and hence used as a loading control. Quantification is possible using a simple 2-point calibration curve comprised of an aqueous solution in atmospheric conditions (21%, normoxic), and a second fixed sample with a chemical oxygen scavenger to remove all oxygen from the surrounding solution (0%, anoxic)40. Samples must be fixed to eliminate any effect of oxygen consuming activity. This 2-point calibration approach is widely used in the literature, including by the Papkovsky group, who developed the suite of probes including MM2 and corresponding protocols40, but also across a wide variety of fluorescence-43,44,45,46 and electrode-based18,45,46,47,48 methods to profile oxygen metabolism. To the authors’ knowledge this is the first example of the use of the MM2 probe in mammalian oocyte and embryo tissue.

The aim of this work was to develop a new method to visualise icO2 in abattoir-derived individual oocytes and embryos in vitro, allowing resolution of different regions within the oocyte or embryo and identification of zones of high and low metabolic activity. We first optimised incubation conditions (Fig. 1) and verified whether cumulus cell layers were necessary for oocyte labelling (Fig. 2). We then used FCCP and antimycin to profile icO2 within the limits of mitochondrial control in oocytes and preimplantation embryos (Fig. 3). We then report use of the MM2 probe to quantify icO2 in ICM and TE regions of blastocysts (Fig. 4), correlation of icO2 to blastocyst cell count and cell allocation to ICM and TE lineages (Fig. 5) and finally correlation to mtDNA copy number (Fig. 6).

Figure 1
figure 1

Optimisation and calibration of MM2 incubation conditions. Examples images (A) PFO oxygen-insensitive fluorophore labelling; (B) PtTFPP oxygen-sensitive labelling; (C) Excitation/Emission spectra reproduced from manufacturer guidance, (D) Signal ratio comparison following blastocyst incubation with MM2 probe for 3 (n = 6), 6 (n = 6), 18 (n = 6) and 24 h (n = 6), with no statistical differences; (E) Blastocysts imaged after 24 h incubation with 1 μg/ml (n = 6), 5 μg/ml (n = 6), or 10 μg/ml (n = 6) MM2 probe with no significant differences; (F) Example calibration based on blastocysts imaged at 0% and 21% O2 (p < 0.0001) with curve y = − 0.0035x + 0.84. Values plotted as mean ± SD for the number of analyses shown.

Full size image
Figure 2
figure 2

The effect of cumulus complex presence on oocyte oxygen concentration. Change in denuded oocyte icO2 (n = 29): Basal (129.50 ± 18.07 µmol/l), FCCP treated (99.13 ± 20.14 µmol/l, p = 0.0002) and antimycin treated (119.7 ± 13.20 µmol/l, p > 0.05). Change in cumulus-enclosed oocyte icO2 (n = 28): Basal (121.60 ± 13.15 µmol/l), FCCP treated (98.60 ± 10.20 µmol/l, p < 0.0001) and antimycin treated (126.00 ± 4.40 µmol/l, p < 0.005). Values plotted as mean ± SD for the number of analyses shown. Values with the same letter indicate significant differences by ANOVA with post-hoc Tukey test.

Full size image
Figure 3
figure 3

icO2 throughout preimplantation development. Effect of FCCP and antimycin treatment on icO2 of (A) immature oocytes (n = 21) Basal (94.76 ± 27.28 µmol/l), FCCP treated (93.39 ± 24.06 µmol/l) and antimycin treated (116.6 ± 43.59 µmol/l); (B) mature oocytes (n = 16) Basal (90.56 ± 18.73 µmol/l), FCCP treated (92.97 ± 14.46 µmol/l) and antimycin treated (122.1 ± 29.73 µmol/l); (C) EC embryos (n = 23) Basal (84.84 ± 34.37 µmol/l), FCCP treated (80.78 ± 34.66 µmol/l) and antimycin treated (122.90 ± 28.60 µmol/l); (D) LC embryos (n = 26) Basal (110.1 ± 30.03 µmol/l), FCCP treated (93.73 ± 36.91 µmol/l) and antimycin treated (135.70 ± 34.14 µmol/l); (E) Blastocysts (n = 18) Basal (121.4 ± 16.51 µmol/l), FCCP treated (110.0 ± 20.03 µmol/l) and antimycin treated (151.40 ± 15.16 µmol/l); (F) Basal icO2 comparison between immature oocyte, mature oocyte, EC embryo, LC embryo and blastocyst stages. Values plotted as mean ± SD for the number of analyses shown *p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001.

Full size image
Figure 4
figure 4

Blastocyst ICM and TE icO2. (A–F) Example of using ImageJ region of interest selection to measure relative signal intensity of (A, D) Whole blastocyst, (B, E) Inner Cell Mass (ICM) and (C, F) Trophectoderm (TE) regions. Merged images are shown; channels were measured individually. (G) Quantitative comparison of change in icO2 between whole blastocyst(129.23 ± 30.54 µmol/l), TE (134.10 ± 32.18 µmol/l) and ICM (118.33 ± 29.57 µmol/l, n = 82). Values plotted as mean ± SD for the number of analyses shown ****p < 0.0001.

Full size image
Figure 5
figure 5

Blastocyst cell allocation and basal oxygen concentration. Examples shown of Hoechst total cell staining (A, D), Propidium Iodide (PI) Trophectoderm staining (B, E), combined channels (C, F). (G) Basal icO2 versus total cell count with line equation y = 0.1086x + 62.62, R2 = 0.015, p = 0.52. (H) Basal oxygen concentration versus % Trophectoderm with line equation y = 0.1974x + 79.68, R2 = 0.11, p = 0.07.

Full size image
Figure 6
figure 6

Mitochondrial DNA copy number. (A) Correlation of mtDNA copy number with basal oxygen level across all samples tested (n = 42) with line equation y = 759.7x + 88,713 (R2 = 0.05, p = 0.14); (B) mtDNA copy number for immature oocytes (1.75 × 105 ± 1.6 × 104 copies; n = 10), mature oocytes (1.77 × 105 ± 2.6 × 104 copies; n = 6), cleavage stage embryos (1.5 × 105 ± 1.8 × 104 copies; n = 19) and blastocysts (2.3 × 105 ± 5.3 × 104 copies), with no significant differences. Data shown as mean ± SD.

Full size image

Results

Validation and optimisation of the MM2 probe in oocytes and embryos

Incubation times of between 3 and 24 h have been reported for loading the MM2 probe38,49,50. Groups of in vitro derived day 7 bovine blastocysts were incubated for 3, 6, 18 or 24 h with 10 µg/ml MM2 probe in SOFaaBSA before multiphoton imaging (n = 6 per group, total n = 24). The mean signal ratio did not differ statistically dependent on incubation time and ranged from 0.10 ± 0.01 IU to 0.25 ± 0.1 IU (p = 0.84, Fig. 1A). However, variation was lowest at the 24 h time point. Therefore, 24 h incubation time was selected for reproducibility and ease of use.

Next, blastocysts were labelled and imaged with 1 μg/ml, 5 μg/ml or 10 μg/ml MM2 probe in SOFaaBSA over 24 h (n = 6 per group, 3 independent groups). The mean signal ratio ranged from 0.24 ± 0.04 IU to 0.4 ± 0.02 IU (Fig. 1B). No significant difference in signal was found between the 3 different concentrations used (p = 0.8). An incubation concentration of 5 μg/ml MM2 was selected for all remaining experiments in line with loading concentrations previously reported by the Papkovsky group42,50.

2-Point calibration of MM2 signal with the corresponding sample of interest was performed in order to calculate icO2. An example blastocyst calibration curve is shown in (Fig. 1C). The mean signal ratio of fixed MM2-stained blastocysts under anoxia (0% O2) was 0.84 ± 0.002 (n = 3). This was significantly higher (p < 0.0001) than the mean signal ratio of fixed blastocysts labelled and imaged under normoxia (21% O2) (0.10 ± 0.04, n = 3), producing a calibration curve with the equation y = − 0.0035x + 0.84.

The effect of cumulus cells on MM2 labelling efficacy and oxygen concentration

Oocytes were randomly assigned into denuded or intact cumulus-enclosed groups and labelled with 5 μg/ml MM2 for 3 h (Fig. 2). Denuded oocyte icO2 (129.50 ± 18.07 µmol/l, n = 29) reduced significantly following FCCP treatment (99.13 ± 20.14 µmol/l, p < 0.0001) and returned to an intermediate level following antimycin exposure (119.7 ± 13.20 µmol/l, p > 0.05, Fig. 2). Cumulus-enclosed oocyte icO2 (121.60 ± 13.15 µmol/l, n = 28) reduced significantly following FCCP treatment (98.60 ± 10.21 µmol/l, p < 0.0001) and significantly increased following antimycin exposure (126.00 ± 4.40 µmol/l, p < 0.005, Fig. 2). The presence or absence of cumulus cells did not have any significant effect on the MM2 signal or icO2 (p > 0.05).

icO2 throughout in vitro oocyte maturation and embryo development

Oocytes

Immature oocyte icO2 (94.76 ± 27.28 µmol/l, n = 21) reduced significantly following FCCP treatment (93.39 ± 24.06 µmol/l, p < 0.005) and significantly increased following antimycin exposure (116.6 ± 43.59 µmol/l, p < 0.005, Fig. 3A). Mature oocyte icO2 (90.56 ± 18.73 µmol/l, n = 16) was significantly reduced following FCCP treatment (92.97 ± 14.46 µmol/l, p < 0.0005) and increased significantly following antimycin exposure (122.1 ± 29.73 µmol/l, p < 0.005, Fig. 3B).

Embryos

Early cleavage stages were grouped into early cleavage (EC) stages (2–7 cell) and late cleavage (LC) stages (8–32 cell) for quantitative analysis. EC basal icO2 (84.84 ± 34.37 µmol/l, n = 23) was significantly reduced following FCCP treatment (80.78 ± 34.66 µmol/l, p < 0.0005). icO2 increased following antimycin treatment (122.90 ± 28.60 µmol/l, p < 0.0005, Fig. 3C). LC basal icO2 (110.1 ± 30.03 µmol/l, n = 26) was similar to FCCP-treated icO2 (93.73 ± 36.91 µmol/l, p > 0.05). However, following antimycin treatment (135.70 ± 34.14 µmol/l, Fig. 3D), icO2 was significantly higher than basal (p < 0.05) and FCCP treatment (p < 0.0005). EC basal icO2 was significantly lower than that of LC embryos (p < 0.05) and blastocysts (p < 0.005).

Blastocyst icO2 decreased from basal levels (121.4 ± 16.51 µmol/l, n = 18, Fig. 3E) following FCCP treatment (110.0 ± 20.03 µmol/l, p < 0.0005) and increased with antimycin treatment (151.40 ± 15.16 µmol/l, p < 0.0001).

Differences in basal oxygen concentration during oocyte maturation and embryo development

Basal icO2 was similar between immature oocytes, mature oocytes, and EC embryos (Fig. 3F). icO2 was increased in later stages, with LC embryo icO2 significantly higher than that of mature oocytes (p < 0.05) and blastocyst icO2 signficiantly higher than that of both mature oocytes (p < 0.005) and LC embryos (p < 0.05).

Blastocyst ICM and TE visual analysis

Blastocyst images were examined in ImageJ to compare MM2 signal intensity between whole blastocysts, ICM and TE regions (Fig. 4A–C). Mean overall blastocyst basal icO2 was 129.23 ± 30.54 µmol/l (n = 82, Fig. 4D). Trophectoderm (TE) oxygen concentration (134.10 ± 32.18 µmol/l) was significantly higher than ICM or overall (p < 0.0001). Inner Cell Mass (ICM) icO2 (118.33 ± 29.57 µmol/l) was significantly lower than either TE or overall (p < 0.0001).

Blastocyst cell allocation ratios

Blastocyst total cell counts (representative images: Fig. 5A–F) varied from 34 to 157 cells and were not normally distributed (n = 31; p = 0.01). Blastocyst cell allocation ratio (% TE) varied from 16 to 88% and were normally distributed (n = 31; p = 0.35). Neither total cell count (75 ± 4.8%; p = 0.07; Fig. 5G), nor cell allocation (57 ± 3.2%; p = 0.52; Fig. 5H) correlated with icO2.

Mitochondrial DNA

Mean MtDNA copy number was 1.75 × 105 ± 1.3 × 104 copies (n = 45). There was no detected correlation between icO2 and mtDNA copy number (Fig. 6A; n = 42; R2 = 0.05; p = 0.14). mtDNA copy number did not vary significantly between immature oocytes (1.8 × 105 ± 1.6 × 104 copies; n = 10), mature oocytes (1.77 × 105 ± 2.6 × 104 copies; n = 6), early cleavage stage embryos (1.5 × 105 ± 1.8 × 104 copies; n = 19) or blastocyst (2.3 × 105 ± 5.3 × 104 copies; n = 7; p = 0.23, Fig. 6B).

Discussion

We present a novel method to visualise and quantitatively assess icO2 during oocyte maturation and preimplantation embryo development. Labelling with the MM2 probe was user-friendly and reproducible, with quantitation achieved using a simple 2-point calibration curve (Fig. 1). MM2 signal was sensitive to changes in mitochondrial oxygen metabolism and was used to profile icO2 at basal, maximal (uncoupled) and non-mitochondrial levels of oxygen consumption using metabolic poisons (Figs. 2, 3). Furthermore, assessment of specific sample regions, namely blastocyst ICM and TE, has been achieved (Fig. 4). MM2 analysis has also been combined with blastocyst cell allocation ratio imaging and qPCR (Figs. 5, 6) and could be used in conjunction with other endpoint analyses.

Basal icO2 was similar between immature and mature oocytes (Fig. 3A). The localisation of high MM2 signal intensity, indicating areas of low oxygen concentration, tended to be throughout the ooplasm of the immature oocyte and around the periphery of mature oocytes, comparable to the mitochondrial localisation reported by Sturmey et al.32.

To ascertain the effect of cumulus cells on oocyte MM2 loading efficiency and oxygen metabolism, COCs were randomly assigned to overnight culture in IVM media + 5 µg/ml MM2 either with cumulus layers intact or following denudation. Cumulus presence did not affect icO2 , with basal, FCCP and antimycin treated values similar between denuded and cumulus enclosed groups (Fig. 2). In both groups, FCCP significantly reduced icO2 from basal levels, while antimycin returned oxygen concentration to basal levels. This suggests that (1) cumulus presence did not affect MM2 uptake or sensitivity to changes in oxygen level; and (2) MM2 was sensitive to changes in mitochondrially-regulated oxygen consumption in oocytes. Taken together, this suggests that MM2 is a suitable probe for use in oocytes with or without cumulus.

Oxygen concentration was profiled throughout oocyte maturation and preimplantation development. Basal icO2 was highest in blastocysts, at a level significantly higher than in mature oocytes or early cleavage embryos (Fig. 3F). At each stage tested, FCCP treatment did not cause a significant decrease in icO2, however antimycin did cause a significant increase in icO2 (Fig. 3A–E). Therefore, no significant changes in mitochondrial function during preimplantation development were detected. However, oocyte and embryo mitochondria were sufficiently active at basal level to reduce the icO2 by up to 29% in comparison to the minimum represented by antimycin treated icO2.

Oxygen consumption is often used as a representative proxy of overall metabolism, and is widely reported to increase progressively throughout preimplantation development18,51. By the blastocyst stage, a significant increase in metabolic activity reportedly results in 2–4 times more oxygen being consumed than in cleavage-stage embryos as measured by pyrene fluorescence of small groups of 2–32 embryos51,52, extracellular flux analysis of small groups of 6 embryos25, or single-embryo nanorespirometry15. This increase is most likely due to the requirement for sufficient oxygen to power blastocoel formation. In the present study, blastocyst icO2 was higher than that of EC embryos and mature oocytes.

Additionally, further analysis of MM2-labelled blastocysts suggested that the majority of the oxygen was present in the TE, with significantly lower icO2 in the ICM (Fig. 4). If icO2 was taken purely as an index of oxygen consumption, then this would suggest that (1) blastocysts were less metabolically active than other stages and (2) the ICM was more metabolically active than the TE. However, previous reports have established that this is not the case17. In fact, ICM mitochondria tend to be fewer and less active, retaining their globular, immature physiology until post-implantation, while TE mitochondria tend to begin maturation during blastocyst development17,26. The present data therefore paints a more complex picture than can be easily explained by reports of oxygen consumption. It is tempting to speculate that oxygen may diffuse rapidly into the TE cells lining the outermost layer of the blastocyst, leading to a higher icO2. However rapid oxygen consumption by the highly metabolically active TE mitochondria could leave a reduced amount to diffuse to the ICM. Interestingly, Byatt-Smith et al. predicted that oxygen could diffuse to the centre of smaller embryos (e.g. murine), but cannot diffuse to the centre of the larger bovine embryos53. While this is speculative, future study may reveal the dynamics of oxygen diffusion and metabolism in blastocysts. Nevertheless, the present data suggests that the MM2 probe is sensitive to differences in oxygen concentration in different regions of the embryo.

Comparison of blastocyst icO2 and total cell count or cell allocation ratio did not reveal any significant correlations (Fig. 5A,B). This data suggests that blastocyst icO2 was not significantly dependent on the total number of cells or allocation to TE or ICM. Cell allocation ratios were assayed using the method of Thouas et al.54. This method is widely used due to its relative ease and accessibility, and care was taken to expose blastocysts to the PI stain in Triton X for the minimum time to lyse the zona and stain the outermost cells only. However future use of an immunofluorescence approach using antibody markers of the ICM-specific Sox2 and TE-specific Cdx2 could improve specificity and reduce subjectivity55,56,57. Kuno et al. recently reported a positive correlation between chimeric mouse blastocyst OCR measured using a chip-based electrochemical method and increasing total cell count measured by this immunocytochemical approach23.

In analyses of oocytes and embryos, the copy number of mitochondrial genomes is often used as an index of the number of individual mitochondria. This is due to reports that, on average, individual oocyte mitochondria each have around 1.3 copies of mtDNA35,58,59. In the present study, mtDNA copy number varied greatly within oocyte and embryo developmental stages in the range 0.9–4 × 106 copies (Fig. 6A). This range is comparable to published reports, for example Cotterill et al.33 reported 0.74 × 106 copies per ovine MII oocyte, and aligned with a putative 1 × 105 mtDNA copy number threshold for oocyte competence. In the current study no significant differences in mtDNA copy number were observed between oocyte and embryo stages (Fig. 6B). This contrasts to previous reports, in which mtDNA copy number increased significantly during oocyte maturation60 and preimplantation embryo development61. No correlation was observed between basal icO2 and mtDNA count between or within stages (p = 0.14, Fig. 6A,B). This agrees with a recent report from Kuno et al., in which chimeric mouse blastocyst OCR did not correlate with mtDNA copy number23. In this study, mtDNA copy number was not correlated to icO2 in the samples measured. However, changes in oxidative activity of mitochondria during preimplantation development may also be dependent on changes in mitochondrial maturation and embryo morphology.

This study reports that the commercially available MM2 probe is non-toxic and effective in measuring icO2 in mammalian oocytes and preimplantation embryos, including comparison of distinct regions. This method has many potential applications in investigating mitochondrial activity in reproductive tissues, particularly when used in combination with established techniques.

Materials and methods

All chemicals were obtained from Sigma-Aldrich (Dorset, UK) unless otherwise indicated.

Bovine tissue acquisition

Ethical approval for animal work was not required for this study as all bovine tissue was derived from non-pregnant animals slaughtered at a local abattoir (John Penny and sons, Leeds, UK) for commercial food production purposes only. The authors were not involved in this process. Bovine reproductive tracts were collected from the abattoir and transported to the laboratory within 2 h of slaughter. The ovaries were dissected from the tracts and live oocytes were aspirated as described below. Bovine embryos were produced in vitro from these oocytes using cryopreserved spermatozoa based on established protocols51,62,63. In vitro preimplantation embryo development was maintained to the blastocyst stage for a maximum of 8 days as described below and no animal or embryo transfer studies were conducted.

In vitro production of bovine embryos

Ovaries were dissected from tracts in the laboratory and washed in pH 7.45 Phosphate Buffer Saline (PBS) comprising 1.058 mM Potassium Phosphate Monobasic, 155.17 mM Sodium Chloride and 2.97 mM Sodium Phosphate Dibasic supplemented with Penicillin, Streptomycin and Amphotericin B (Fungizone) at 39 °C.

Follicular fluid containing live oocytes was aspirated from antral follicles of 2- < 10 mm diameter by aspiration with a pre-warmed syringe fitted with an 18-gauge needle containing a small amount of HEPES-buffered holding medium. Holding medium was Medium-199 supplemented with 4 mM NaHCO3, 21.1 mM HEPES, 0.02 mg/ml Heparin, 2 mg/ml Fatty Acid-Free Bovine Serum Albumin (BSA-FAF, A6003) and 100 IU/ml Penicillin/Streptomycin62. Cumulus-Oocyte Complexes (COCs) were matured in groups of 50 for 18-24 h in 500 µl In-Vitro Maturation (IVM) Medium at 39 °C under humidified 5% CO2 in air according to the protocols reported by Hemmings et al.62. Serum-free IVM medium consisted of bicarbonate-buffered α-Minimum Essential Medium supplemented with 2 mM glutamine, 0.47 mM pyruvate, 5 µg/ml Sodium Selenite, 10 ng/ml Insulin, 10 ng/ml Long-R3 IGF-1, 0.0006 IU/ml bovine FSH, 0.0003 IU/ml bovine LH, 1 mg/ml BSA-FAF and 100 IU/ml 100 IU/ml Penicillin/Streptomycin.

Oxygen metabolism was quantified in oocytes at 2 discrete stages of meiotic maturity. A subset of cumulus enclosed immature oocytes were analysed immediately following follicle aspiration. Oocytes were denuded of cumulus cells by repeat pipetting through 170 µm and 140 µm EZ-grip embryo handling pipette tips (RI Systems) in 80 IU/ml bovine hyaluronidase in HEPES-buffered MEM at 37 °C. Mature oocytes were collected following 24 h of IVM. Cumulus cells were removed as described above and meiotic progression to MII was confirmed by detection of first polar body extrusion using light microscopy.

In Vitro Fertilisation (IVF) was carried out using frozen-thawed spermatozoa from a bull of proven fertility (Genus, Cheshire, UK). Sperm were centrifuged on a discontinuous Percoll gradient (45:90%) for 30 min at 760 Relative Centrifugal Force (RCF) to select motile sperm. Sperm wash medium was HEPES-Tyrode’s Albumin Lactate Pyruvate (H-TALP) medium comprising 114 mM NaCl, 3.19 mM KCl, 0.45 mM NaH2PO4, 2 mM NaHCO3, 0.26 mM pyruvate, 7.5 mM HEPES, 2.06 mM CaCl2, 0.49 mM MgCl2, 9.96 mM lactate, 4 mg/ml BSA-FAF and 0.05 mg/ml gentamycin. Selected sperm were washed in H-TALP at 330 × g for a further 5 min before co-incubation with mature COCs in Fertilisation-TALP (F-TALP) at a concentration of 1 × 106 ml-1 for 18 h at 39 °C and 5% CO2 in humidified air. F-TALP was 114 mM NaCl, 3.19 mM KCl, 0.45 mM NaH2PO4, 25 mM NaHCO3, 0.26 mM pyruvate, 2.06 mM CaCl2, 0.49 mM MgCl2, 9.96 mM lactate, 10 µg/ml heparin, 2 µM penicillamine, 1 µM hypotaurine, 4 mg/ml BSA-FAF and 0.05 mg/ml gentamycin.

Putative zygotes were collected from IVF plates in 500 µl HEPES-buffered Synthetic Oviduct Fluid (H-SOF) then denuded of remaining cumulus cells by vortexing for 2 min. H-SOF comprised 111 mM NaCl, 7.16 mM KCl, 1.19 mM NaH2PO4, 5 mM NaHCO3, 0.33 mM pyruvate, 1.5 mM glucose, 33.2 mM lactate, 20 mM HEPES, 1.71 mM CaCl2, 4.9 mM MgCl2, 9.96 mM lactate, 4 mg/ml BSA-FAF and 100 IU/ml Penicillin/Streptomycin. Putative zygotes were then selected in H-SOF and transferred to SOF culture medium supplemented with amino acids and BSA-FAF (SOFaaBSA) in groups of 40 using a glass pipette. SOFaaBSA comprised 111 mM NaCl, 7.16 mM KCl, 1.19 mM NaH2PO4, 5 mM NaHCO3, 0.33 mM pyruvate, 1.5 mM glucose, 33.2 mM lactate, 0.1 mM glutamine, 1.71 mM CaCl2, 4.9 mM MgCl2, 9.96 mM lactate, 1 × BME Essential and Non-Essential Amino acids 8 mg/ml BSA-FAF and 100 IU/ml Penicillin/Streptomycin. The zygotes were washed twice in SOFaaBSA before moving to 20 µl pre-equilibrated microdrops under mineral oil for culture in groups of 20 in hydrophobic IVF culture dishes. Embryo culture dishes were incubated at 39 °C under 5% CO2, 5% O2, 90% N2 in humidified air in a Cook MINC mini-incubator for up to 8 days. Mean oocyte maturation rates were 76.2 ± 2.5% and blastocyst development rates were 25.35 ± 9.01%.

Labelling oocytes and embryos with the MM2 probe

MM2 probe labelling and imaging methods were adapted from those of Kondrashina et al.38 and Prill et al.42. Pilot experiments confirmed that 24 h incubation in bicarbonate-buffered media led to increased signal intensity in the blue and red channels as well as increased sensitivity in the red channel to changes in oxygen concentration due to mitochondrial inhibition (A). Subsequent experiments showed that extending the incubation time to 72 h had no effect on intensity or signal ratio. Samples were labelled with 5 µg/ml MM2 in 500 µl IVM for oocytes and 5 µg/ml MM2 in 20 µl SOFaaBSA for embryos. Fluorescence values were converted to oxygen concentration in µmol/l using a calibration curve (Fig. 1). Calibration was achieved by plotting signal intensity ratios of fixed oocytes or embryos in 21% oxygen and 0% oxygen environments as described by Prill et al.42. Samples were fixed overnight in 2% glutaraldehyde, 2% formaldehyde in PBS to ablate oxygen consuming activity but maintain 3D structure. These samples were imaged in 10mM sodium dithionite in PBS to remove all O2 but otherwise labelled as normal with 5 µg/ml MM2 and imaged as detailed above. Samples for normoxia were fixed to ablate oxygen-consuming activity before rehydration with probe solution to ensure maximal O2 content with zero consumption. Therefore, these were fixed and dehydrated with ethanol before rehydrating with fresh media containing 5 µg/ml MM2 (Fig. 1).

Multiphoton imaging was performed on a Zeiss LSM 710 microscope with Chameleon multiphoton laser. The parfocal distance of the upright multiphoton microscope was insufficient to support use of standard live-cell imaging chambers. Therefore, oocyte and embryo samples were mounted on glass slides, in 5 µl drops of appropriate HEPES-buffered media (e.g. HM for oocytes and HSOF for embryos). Media drops were flanked by 2 layers of labelling tape and overlaid with a glass coverslip. This allowed removal and replacement of the media drop with fresh media supplemented with the required inhibitor for each stage of the experiment.

Profiling of mitochondrial activity throughout oocyte and embryo development

icO2 under basal, maximal and non-mitochondrial conditions were measured sequentially in the same samples as follows. Respiratory chain inhibitors were dissolved in molecular biology grade ethanol, a vehicle which does not significantly change preimplantation embryo oxygen consumption64, to investigate how aspects of the bioenergetic profile change throughout preimplantation development. Following measurement of basal oxygen levels, media on the imaging slide was replaced with 5 µl pre-warmed HEPES-buffered media supplemented with 5 µg/ml MM2 and 10 µM Carbonyl Cyanide-P-Trifluoromethoxyphenylhydrazone (FCCP). Samples were incubated for 30 min to allow equilibration of oxygen concentration. This increased OCR to the maximum possible (the maximal respiratory rate). The difference between maximal and basal OCR is the spare respiratory capacity and indicative of how close the tissue is to its bioenergetic limit14,30. This was followed by treatment with antimycin, an inhibitor of complex III. This effect was immediate, as, once mitochondrial OCR is blocked, oxygen diffuses back into the tissue instantly. Samples were incubated for 5 min to ensure oxygen diffusion had re-equilibrated and for parity between experiments.

Image analysis

Multiphoton images were examined in ImageJ™. A circular region of interest was selected around each oocyte or embryo sample and mean signal intensity was measured in the blue (reference) and red (oxygen-sensitive) channels. An MM2 probe signal ratio was calculated by dividing red (oxygen-sensitive) signal by total (blue + red) MM2 signal. This was converted to units of oxygen concentration (µmol/l) by referencing to a 2-point calibration curve (Fig. 1C). All subsequent analyses were completed in GraphPad Prism™ 8. Data was analysed for normality by the D’Agostino-Pearson test. Parametric data was analysed by ANOVA with post-hoc Bonferroni test for significant differences between groups, while non-parametric data was tested by Friedman’s test (for paired data) or Kruskal–Wallis test (for unpaired data) with post-hoc Dunn’s test for significant differences between groups. Data comparisons with p < 0.05 were regarded as significantly different.

Mitochondrial DNA copy number

A subset of samples was flash frozen in liquid nitrogen in 10 µl PBS for mitochondrial DNA (mtDNA) copy number analysis by quantitative real-time Polymerase Chain Reaction (qPCR). A synthesised plasmid was used as a DNA control spike. The method was adapted from those of Cotterill et al.33 and Hashimoto et al.65. Primers were designed for the mitochondrially-encoded gene COI (cytochrome c oxidase subunit 1) with a PCR product measuring 129 bases. The primer sequences were: 5′ CGTTGTCGCACATTTCCACTA 3′(forward), 5′ GCGAAGTGGATTTTGGCTCAT 3′ (reverse). A spike plasmid (pGEM T-easy vector, Promega, Madison USA) was used as an internal control with forward primer 5′CTAGTGATTGTGCGGGAGAGA3′ and reverse 5′CTTTGAAATTGGCTGGATTGTG3′ and a 152 bp product. The spike was used at a 1/1000 dilution to achieve a similar number of copies in the same order of magnitude as the COI samples through a series of preliminary validation experiments. mtDNA was extracted from a pool of 10 oocytes to identify expected concentrations in these initial validations. Briefly, 10 µl of 2X lysis buffer (2X PCR buffer, 1% Triton X-100 and 200 ng/ml proteinase K) was added to the 10 µl sample for a total sample volume of 20 µl. Cell lysis was performed in a PCR thermal cycler by heating to 55 °C for 30 min then 95 °C 5 min. 2 µl of lysate was used as template in a 25 µl reaction with real-time qPCR master mix comprising: 9.25 µl DNase/RNase free water, (1.25 µl primers (of 10 µM working stocks) and 2.5 µl SYBR Green Master Mix (Applied Biosystems, CA, USA). The qPCR conditions were: Denaturing at 95 °C for 10 min (1 cycle), Amplification at 95 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min (35 cycles), Melt curve at 95 °C, Cooling at 37 °C for 5 min and then maintained at 4 °C until sample collection. qPCR was carried out and data were analysed using a Roche LightCycler 480 and software. The standard curve used to quantify each experimental sample included serial dilutions in the range 10 × 103 to 10 × 108 copies or 0.1–0.000001 ng/ml of the purified PCR product . Mean extraction efficiency calculated as an index of expected vs extracted spike copy number was 82%.

Cell allocation ratios

Total cell counts and cell allocation ratios were calculated by the method of Thouas et al.54. Briefly, blastocysts were first transferred to propidium iodide (100 μg/ml) and 0.001% Triton X-100 in PBS for 30 s to stain TE cells. To prevent labelling of the ICM, blastocysts were immediately washed 3 × in PBS, before transferring to 25 μg/ml Hoechst 3342 in ethanol to label all cell nuclei. Total cell number was counted at 460 nm 3 times and TE cell count was recorded 3 times at 560 nm using a Zeiss Axioscope A1 epifluorescence microscope (Cambridge, UK). The mean of 3 counts were used to calculate the percentage TE out of total cells. The number of ICM cells was calculated by subtracting TE cells from the total Hoechst-stained cells.

Statistical analyses

Data were tested for normality using the D’Agostino-Pearson test. Parametric data were compared using Student’s t-test or ANOVA with post-hoc Tukey test dependant on the number of groups for comparison. Non-parametric data were compared using Mann–Whitney U test or Kruskal Wallis with post-hoc Dunn’s test. All analyses were performed in GraphPad Prism 6.

The data underlying this article will be shared on reasonable request to the corresponding author.