Abstract
Brief refeeding times (~60 min) enhanced hepatic Angptl8 expression in fasted mice. We cloned the mouse Angptl8 promoter region to characterise this rapid refeeding-induced increase in hepatic Angptl8 expression. Deletion of the −309/−60 promoter region significantly attenuated basal promoter activity in hepatocytes. A computational motif search revealed a potential binding motif for hepatocyte nuclear factor 1α/1β (HNF-1α/β) at −84/−68 bp of the promoter. Mutation of the HNF-1 binding site significantly decreased the promoter activity in hepatocytes, and the promoter carrying the mutated HNF-1 site was not transactivated by co-transfection of HNF-1 in a non-hepatic cell line. Silencing Hnf-1 in hepatoma cells and mouse primary hepatocytes reduced Angptl8 protein levels. Electrophoretic mobility-shift assays confirmed direct binding of Hnf-1 to its Angptl8 promoter binding motif. Hnf-1α expression levels increased after short-term refeeding, paralleling the enhanced in vivo expression of the Angptl8 protein. Chromatin immunoprecipitation (ChIP) confirmed the recruitment of endogenous Hnf-1 to the Angptl8 promoter region. Insulin-treated primary hepatocytes showed increased expression of Angptl8 protein, but knockdown of Hnf-1 completely abolished this enhancement. HNF-1 appears to play essential roles in the rapid refeeding-induced increases in Angptl8 expression. HNF-1α may therefore represent a primary medical target for ANGPTL8-related metabolic abnormalities. The study revealed the transcriptional regulation of the mouse hepatic Angptl8 gene by HNF-1.
Similar content being viewed by others
Introduction
Angiopoietin-like proteins (Angptls) are a family of proteins structurally similar to angiopoietins. Previous reports on Angptls have identified them as key regulators of circulating triglyceride(TG) levels, implicating them as potential new drug targets for treatment of metabolic syndrome1,2 ANGPTL8, alternatively called the TD26, lipasin, C19orf80, or RIFL (refeeding induced fat and liver) gene, was originally identified as a novel adipocyte-enriched insulin target gene with a role in lipid metabolism3,4,5. (A previously reported identification of Angptl8 as ‘Betatrophin,’ a factor controlling the differentiation and proliferation of pancreatic β cells6, retracted article), was later determined to be incorrect7,8,9,10. Ren et al. found that the RIFL gene encodes a predicted protein of 22kD with homology to Angptl33, Furthemore, the murine white and brown adipose tissue (WAT and BAT) and liver were highly enriched in the RIFL transcript, and the level increased ~80-fold in WAT and 12-fold in liver, following 8 h refeedings of fasting mice3. Several studies with Angptl8-deficient or Angptl8-overxpressing rodents have demonstrated that Angptl8, which is homologous to the N-terminal domain of Angptl3, modulates circulating TG clearance by inhibiting lipoprotein lipase (LPL) activity in the presence of Angptl33,4,5,7,8,11. Recent human studies have shown that serum ANGPTL8 levels are increased in subjects with Type 1 diabetes (T1D)12, obesity13, Type 2 diabetes (T2D)13,14,15, and non-alcoholic fatty liver disease (NAFLD)16. Most recently, high levels of circulating ANGPTL8 were determined in patients with infections, where ANGPTL8 played a role in selective autophagy in the inflammatory responses by controlling the activation of nuclear factor-κB17.
In humans, ANGPTL8 is mainly expressed in the liver5; therefore, elucidating the mechanism that regulates the hepatic expression of ANGPTL8 is important for establishing the protein as a novel biomarker for metabolic diseases in human subjects. Several in vitro or in vivo studies have been conducted3,4,5,7,8,18,19, but the regulatory mechanisms controlling Angptl8 gene expression remain unclear. Previous reports have demonstrated that Angptl8 expression in mice is suppressed by fasting and dramatically induced by refeeding4,5,11,19. However, no reports to date have analysed the expression of Angptl8 after a short period of refeeding in fasted mice. Here, we show that the hepatic Angptl8 expression is significantly and rapidly increased (within 60 min) after the start of refeeding. We also show that HNF-1 is essential for Angptl8 expression in the liver.
Results
Refeeding increased Angptl8 expression at both the mRNA and protein levels in mouse liver
After a 12 h fast, 20-week-old male mice were re-fed ad libitum and euthanised after 60 and 240 min. All livers were harvested and Angptl8 mRNA levels were measured by qPCR (Fig. 1a). When compared with expression in the fasted state, hepatic Angptl8 mRNA expression was significantly increased by 13.6 ± 2.27 fold (p < 0.001) after 60 min and by 14.4 ± 1.63 (p < 0.001) fold after 240 min after refeeding. The expression levels of Angptl8 protein were also increased in the livers from three different mice after 60 and 240 min of refeeding (Fig. 1b). These findings suggested that the levels of Angptl8 mRNA and protein in the murine liver were both rapidly increased after refeeding through rapid transcriptional activation of the Angptl8 gene.
The hepatocyte-specific transcription factor HNF-1 was required for hepatocyte-specific activation of the mouse Angptl8 promoter
We investigated the transcriptional regulation of Angptl8 gene in the liver by first cloning various lengths of the promoter fragment of the Angptl8 gene. As shown in Supplementary Fig. 1, we indicated the T residue, the first nucleotide of exon1, as +1 in this study. We first cloned the −2291/+101 promoter fragment of the gene by genomic PCR. This allowed construction of serially deleted promoter fragments (Fig. 2a) to identify the promoter regions that were critical for activation of Angptl8 gene expression in the liver. These promoter fragments were then inserted into a luciferase reporter vector and transiently transfected into mouse hepatoma-derived Hepa1–6 cells, human hepatoma-derived HepG2 cells, mouse primary hepatocytes and HeLa cells originating from human uterine cervical cancer. As shown in Figs. 2b–d, the −2291/+101 fragment showed strong activity in hepatic cancer cell lines and in mouse primary hepatocytes. In both these cell types, similar promoter activities were detected for the −1508/+101, −966/+101 and −309/+101 constructs. Further deletion of the −309/−60 region completely abrogated the promoter activities. In contrast to hepatocytes, HeLa cells showed very weak promoter activities (Fig. 2e). These findings indicated that the promoter region between −309 and −60 contains an element critical for Angptl8 gene expression in the liver.
We then performed a computer search using the TRANSFAC program (GeneXplain GmbH, Wolfenbuttel, Germany) to identify potential binding sites for transcription factors in the −309/−60 region. This search identified the presence of a consensus-binding motif for HNF-1 at −84/−68 (Fig. 3a and Supplementary Fig. 1). HNF-1 (HNF-1α and β) is a hepatocyte-specific transcription factor that binds to a sequence required for the hepatocyte-specific transcription of several genes. We further validated the importance of the Hnf-1 binding site at −84/−68 for Angptl8 promoter activation in the liver by introducing two distinct series of mutations (mutation 1 and 2) or a 12-bp deletion (mutation 3) to the Hnf-1 binding site in the −2291/+101fragment (Fig. 3a). The use of these mutations was based on a previous report20 showing that these mutations had no ability to bind to HNF-1. The reporter genes harbouring these mutations were transfected in parallel with the wildtype promoter into Hepa1–6 and HepG2 cells and mouse primary hepatocytes. As shown in Figs. 3b–d, three mutations in the Hnf-1 binding site significantly reduced promoter activity in all three cell types.
We then determined whether overexpression of HNF-1 could activate the Angptl8 gene promoter in HeLa cells. The −309/+101 reporter was cotransfected with or without human HNF-1α and/or HNF-1β expression vectors and Angptl8 promoter activity was assessed with luciferase assays. As shown in Fig. 3e, cotransfection of HNF-1α and HNF-1β significantly and synergistically activated the promoter activity in non-hepatocytes. Moreover, this activation by cotransfected HNF-1α and HNF-1β was completely abolished in HeLa cells transfected with the −2291/+101 reporter carrying the mutations in the HNF-1 binding site at −84/−68 (mut1, mut2 and mut3) (Fig. 3f). These findings clearly indicated that the HNF-1 binding site at −84/−68 is essential for specific activation of Angptl8 gene expression in the liver.
HNF-1 was an essential factor required for the mouse Angptl8 protein expression in hepatocytes
We examined whether HNF-1 is critical to the hepatic expression of endogenous Angptl8 by transfection of Hepa 1–6 cells and mouse primary hepatocytes with siRNA targeting endogenous Hnf-1α and Hnf-1β or control siRNA. We then measured the Angptl8 protein levels by immunoblotting. As shown in Fig. 4a, siHnf-1α/β expression significantly and dose-dependently reduced Hnf-1 protein levels 24 h after siRNA transfection. Endogenous Angptl8 protein levels were also dose-dependently reduced by knockdown of Hnf-1α/β in Hepa 1–6 cells. Furthermore, the knockdown of Hnf-1α/β in the primary hepatocyte with 10 nM siRNA also clearly reduced the expression of endogenous Angptl8 (Fig. 4b). These findings suggest that Hnf-1 plays an important role in the basal expression of endogenous Angptl8 in hepatocytes. Exogenous expression of HNF-1 in non-hepatic cells (HeLa cells) that do not express endogenous HNF-1 did not induce the expression of the Angptl8 protein (Supplementary Fig. 2). This could because HeLa cells lack endogenous Angptl8 expression (Supplementary Fig. 2, left panel).
Direct binding of Hnf-1 to the region −84 and −68 bp in the Angptl8 gene
We investigated whether Hnf-1 directly binds to the −84 and −68 bp region responsible for the promoter activity of the Angptl8 gene by performing electrophoretic mobility-shift assays (EMSA). We used radiolabelled fragments containing region 5′-AACCATGGCCGGTTAACCATTGACCAGGGGGGTCA-3′ as a wild type (WT) probe, and mutant probes that included nucleotide changes (M1: 5′- AACCATGGCCGGCCGGCCGCCGACCCAGGGGGGGTCA -3′ and M2: 5′-AACCATGGCCGGTGTCCCGAGGACCAGGGGGGGGTCA -3′). As shown in Fig. 5a, the components from whole cell extracts of Hepa1–6 cells were bound to the WT probe but not to the M1 or M2 probes. The addition of an antibody against Hnf-1 induced a clear super-shift the band, confirming that the binding was a complex containing Hnf-1. The addition of unlabelled oligonucleotides containing the wildtype Hnf-1 binding motif interfered with the binding of the complex containing Hnf-1 to the WT probe (Fig. 5b). By contrast, the addition of unlabelled oligonucleotides containing the mutant binding motif did not interfere with the binding of the complex to the WT probe. These findings indicated that the endogenous Hnf-1 in Hepa1–6 cells was bound directly to the promoter −84/−68 region of the mouse Angptl8 gene.
Refeeding increased the expression of the Hnf-1α gene at both the mRNA and protein levels in the mouse liver but did not affect Hnf-1β gene expression
We also examined the potential involvement of Hnf-1 in the rapid in vivo upregulation of Angptl8 induced by refeeding. We measured the Hnf-1 mRNA and protein levels in mouse livers after 60 and 240 min of refeeding and after a 12 h fast. The expression of Hnf-1α mRNA, determined by qPCR, was increased after 60 min (1.6 ± 0.12 fold; p < 0.001) and 240 min (1.6 ± 0.14 fold; p < 0.001) of refeeding (Fig. 6a). By contrast, the expression of Hnf-1β mRNA was not affected by refeeding (Fig. 6b, no significant differences were noted for any comparison of the three groups). In parallel with the rapid increase of Angptl8 protein levels after refeeding (Fig. 1b), we observed a similar increase in the levels of hepatic Hnf-1 protein after 60 and 240 min of refeeding (Fig. 6c). This result suggested that the protein recognised by the anti-Hnf-1 antibody in the immunoblots reflected increases in the levels of Hnf-1α mRNA but not Hnf-1β mRNA. These findings suggested that the levels of Hnf-1α, but not Hnf-1β was increased in the mouse liver by refeeding.
Insulin increased the expression of both mRNA and protein of Hnf-1α in mouse hepatocytes
Several previous studies have investigated Angptl8 as an insulin target gene3,4,5. Our findings indicated that even a relatively short refeeding increased the in vivo expression of Hnf-1α; therefore, we tested whether insulin might stimulate the in vitro expression of Hnf-1α. As shown in Fig. 7a, a 30 min stimulation with 10 nM insulin caused a rapid increase in the expression of Hnf-1α mRNA in hepatocyte cells. The protein level of Hnf-1 was also increased 60 min after the increase in mRNA (Fig. 7b).
Hnf-1 is required for enhancement of Angptl8 expression by insulin
We also investigated whether insulin treatment in Hepa 1–6 cells and mouse primary hepatocytes could activate the Angptl8 gene promoter. After transfection with the −2291/+101 WT reporter, −2291/+101 mut1 reporter or the −59/+101 reporter, the cells were treated with 10 nM insulin. Luciferase assays (Fig. 7c,d) confirmed that stimulation of hepatocytes with 10 nM insulin significantly activated the promoter activity of the −2291/+101 WT reporter when compared with unstimulated control cells (p < 0.001). This activation by insulin was completely absent in the cells transfected with the −2291/+101 reporter carrying the mutations in the Hnf-1 binding site and in cells with the −59/+101 reporter lacking the Hnf-1 binding motif. These findings indicated an involvement of the HNF-1 binding site at −84/−68 in the insulin-dependent activation of Angptl8 gene expression in hepatocytes. These data also further confirmed demonstrated that promoter activity required the HNF-1 binding site even in the presence of insulin.
To confirm our findings and establish a pathophysiologic significance, we determined whether insulin stimulation could increase the protein expression of Angptl8 in mouse hepatocytes and whether the process requires HNF-1. Stimulation of primary hepatocytes with 10 nM insulin for 30 min increased the expression of both Hnf-1 and Angptl8 protein (Fig. 8a). However, Hnf-1α/β knockdown cells showed no increase in Angptl8 protein expression in response to insulin (Fig. 8b). Attenuation of Hnf-1 expression by 40 nM siRNA decreased the expression of endogenous Angptl8 and expression was not restored by addition of insulin. These data indicated a requirement for Hnf-1 for the enhancement of Angptl8 expression by insulin.
We also investigated the possible recruitment of endogenous Hnf-1 protein to the consensus binding motif in the −84/−68 bp legion of the mouse Angptl8 gene promoter. We did this by conducting chromatin immunoprecipitate (ChIP) assays in Hepa1–6 cells and in mouse liver tissue from fasted or re-fed mice using a set of primers that amplified the −170 to +102 bp region. As shown in Supplementary Fig. 3, in the absence of insulin stimulation, no significant recruitment of endogenous Hnf-1 was observed into the fragment containing the Hnf-1 binding site at −84/−68 (IgG Insulin(−) vs Hnf-1 Insulin(−)). However, stimulation with insulin significantly increased the recruitment of Hnf-1 into this region (IgG Insulin(+) vs Hnf-1 Insulin(+); p < 0.001). In the re-fed mice, Hnf-1 in liver tissues was recruited more significantly into the Angptl8 promoter fragment containing the Hnf-1 binding site at −84/−68 (Fig. 8c). These ChIP assay data suggested that the endogenous Hnf-1 protein could be recruited to the consensus binding motif in the −84/−68 bp region of the mouse Angptl8 gene promoter.
Discussion
Angptl8 mRNA is highly expressed in mouse liver and brown fat, and moderately in subcutaneous fat, perigonadal fat, the kidneys, small intestine and heart4,5. In humans, ANGPTL8 mRNA is almost exclusively expressed in the liver, with limited expression in fat, brain, rectum and heart tissues3,4,5. Previous reports have shown an induction of Angptl8 mRNA in the liver, BAT, and WAT tissue in mice fed a high-fat diet, whereas Angptl8 expression was suppressed in fasting mice4,5,11. Refeeding following a period of food deprivation also enhanced the mRNA expression of Angptl8 within 8–12 h3,4. Dang et al. showed a relationship between the expression of Angptl8 and fasting/feeding signals over 4 h periods19. They found that the liver X receptor α (LXRα) upregulates hepatic Angptl8 expression through four LXR response element (LXREs) within the promoter region of the gene and that glucocorticoids negatively regulate Angptl8 expression during fasting19. The LXRs (α/β) play critical roles in the transcriptional regulation of lipid metabolism, and activation of LXRs increases the synthesis of hepatic fatty acids and the secretion of very-low-density lipoprotein (VLDL), thereby resulting in hypertriglyceridaemia21. Both Angptl3 and Angptl8 are primary targets of LXRs22.
Tseng et al. revealed that expression of human ANGPTL8 mRNA in HepG2 cells is induced by thyroid hormone18. This finding indicates that transcriptional regulation of the gene depends on the thyroid hormone receptor (TR), which directly binds to the upstream region of the human ANGPTL8 gene promoter. Previous reports have demonstrated that thyroid hormone directly regulates or crosstalks with nutrient-activated nuclear receptors to regulate lipid-associated gene transcription associated with hepatic lipid homeostasis23,24,25,26. In the present study, we demonstrated that even relatively short-term refeeding of fasted mice increases the hepatic expression of Angptl8 at both the mRNA and protein levels, suggesting that refeeding induces a rapid transcriptional activation of the Angptl8 gene (Fig. 1a,b). Subsequent experiments confirmed a strict dependence of transcriptional regulation of the mouse hepatic Angptl8 gene on the binding of HNF-1α and/or HNF-1β to the HNF-1 consensus-binding motif located in −84/−68 in the promoter region (Fig. 2a and Supplementary Fig. 1).
HNF-1 consists of two isoforms, HNF-1α27 and HNF-1β28. These two isoforms form homodimers or heterodimers that then activate the transcription of target genes by directly binding to the gene promoters29,30. These role of these transcription factors was originally identified as maintenance of expression of hepatic genes, such as albumin, a1-antitrypsin and α- and β-fibrinogen, and they were considered to be essential regulators of bile acid and plasma cholesterol metabolism31. Knockdown of the TCF1 gene that encodes the three HNF-1α polypeptides confirmed an important role of this gene in the control of glucose homeostasis in mice32,33,34. Inactivation of the gene encoding HNF-1β has confirmed its essential role in the differentiation of visceral endoderm and in the genetic network th at directs the expression of HNF-435,36. Mutations in the genes encoding HNF-4, HNF-1α and HNF-1β induce hyperglycaemia and are responsible for the type 1, type 3 and type 5 forms, respectively, of maturity-onset diabetes of the young (MODY)37,38,39,40. In the present study, non-liver derived HeLa cells showed no promoter activity, in all likelihood because of the lack of endogenous expression of HNF-1 (Fig. 2e). Co-transfection with HNF-1α and/or HNF-1β led to strong promoter activity of the Angptl8 gene in non-liver derived cells (Fig. 3e). However, exogenous expression of HNF-1 failed to promote the expression of the Angptl8 protein in non-hepatic cells. This may because HeLa cells lack endogenous Angptl8 expression (Supplementary Fig. 2).
Dan et al. elegantly showed the mechanism of transcriptional regulation of the Angptl8 gene by LXRα and glucocorticoids through a possible binding motif in the promoter legion (−1980/−1971, −1943/−1934)19; however, our series of promoter deletions (−2291/+101 ~ −309/+101) showed a high promoter activity in liver-derived cell lines and mouse primary hepatocytes (Fig. 2b–d). These data revealed that the HNF-1 level could determine the basal promoter activity and the expression of the mouse Angptl8 gene through the binding motif in the 5′ UTR of the murine liver gene. Our subsequent series of experiments also demonstrated that Hnf-1 was recruited to the binding motif (Figs. 5 and 8c and Supplementary Fig. 3), and that mutations inside the binding motif dramatically decreased the transcriptional activity of the gene (Figs. 3a–d,f). By binding to the HNF-1 binding motif in the Angptl8 gene promoter region, both HNF-1α and HNF-1β could activate the promoter activity in these cell lines (Fig. 3e,f). In fact, the knockdown of both Hnf-1α and Hnf-1β decreased the expression of Angptl8 protein in both mouse hepatoma cells and mouse primary hepatocytes (Fig. 4a,b). A more interesting finding, however, is that the expression of the Angptl8 protein at various time points of fasting and refeeding almost paralleled the expression level of Hnf-1α, but not Hnf-1β (Fig. 1 and 6). These data demonstrate that HNF-1β has the potential to activate the Angptl8 gene, but HNF-1α is the key regulator for in vivo activation of this gene. We also found increased amounts of Hnf-1α protein after relatively short refeeding periods (~60 min) (Fig. 6c).
The insulin response observed in cells is also interesting. Insulin regulates many cellular processes and the expression of more than 100 genes41. It controls gene transcription by modifying the binding of transcription factors on insulin-response elements or by regulating their transcriptional activities41. Several liver-specific genes are regulated by insulin, and many involve lipid synthesis molecules (e.g. fatty acid synthase, acetyl CoA carboxylase and stearoyl CoA desaturase), whereas others code for enzymes implicated in either glucose breakdown or transport (GLUT family members). Insulin control of HNF family members has been reported previously in a few studies; for example, Wolfrum et al. showed that Hnf-3β/Foxa-2-dependent transcriptional regulation is controlled by extracellular signals induced by insulin42. Similarly, two other reports showed that HNF-4 is a downstream target factor of the insulin signal43,44. Expression of Angptl8 is also responsive to insulin3,4,5, and we found that insulin stimulation increased the Hnf-1α expression at both the mRNA and protein levels in a relatively a short time (~60 min) (Fig. 7a,b). Insulin also stimulated the promoter activity of Angptl8, including the consensus binding motif for Hnf-1, in hepatoma cell lines and mouse primary hepatocytes (Fig. 7c,d), thereby confirming that the mechanism of insulin stimulation involves Hnf-1 binding.
The recruitment of Hnf-1 to the target region within the Angptl8 gene promoter was also verified by ChIP and in-vivo ChIP assays (Supplementary Fig. 3 and Fig. 8c). We also confirmed the involvement and pathologic importance of Hnf-1 in the insulin enhancement of Angptl8 expression in mouse primary hepatocytes (Fig. 8a,b). These results clearly demonstrated that basal and increased expression level of Angptl8 in liver requires Hnf-1, even in the presence of insulin, as the transcriptional activation of Angptl8 was suppressed in the absence of Hnf-1.
Taken together, the findings of the current study show that the hepatic expression of Angptl8 undergoes rapid transcriptional regulation during fasting/refeeding periods in mice. We have shown, for the first time, that the mouse Angptl8 gene promoter is positively regulated by HNF-1, and we have identified an HNF-1 binding site in the mouse Angptl8 promoter. These findings will shed new light on the role of HNF-1 in lipid metabolism and suggest clinical applications for dyslipidaemia treatment.
Materials and Methods
Animals
Twenty-week-old male C57/BL6 mice were used in this study. The Institutional Animal Care and Use Committee of Gunma University Graduate School of Medicine (Maebashi, Gunma, Japan) approved all aspects of animal care and the experiments in any relevant details. We confirmed that all experiments were performed in accordance with relevant guidelines and regulations. Animals were maintained on a 12-h light, 12-h dark schedule (lights on at 0700 h) and fed standard laboratory chow and given water ad libitum. For fasting and re-feeding experiments, mice were fasted for 12 h (7:00 PM to 7:00 AM) during the dark cycle and re-fed for 60 and 240 minutes during the light cycle. Mice were euthanised after each refeeding time course. All livers were harvested and snap frozen in liquid nitrogen and stored at −80 °C. We state that
RNA preparation and real-time quantitative PCR (qPCR)
Total RNA was extracted from mouse tissues and Hepa1–6 cells using ISOGEN (Nippon Gene, Tokyo, Japan). A 200 ng sample of total RNA was reverse transcribed with random hexamers using the Taqman reverse transcription reagent kit (Applied Biosystems Inc., Foster City, CA) according to the manufacturer’s protocol. Real-time qPCR assays were performed using an Applied Biosystems 7500 sequence detector (Applied Biosystems Inc., Foster City, CA) with the standard 40 cycles. Mouse Angptl8, Hnf-1α and Hnf-1β mRNA expressions were analysed using Taqman probes (Mm01175863_g1, Mm00493434_m1 and Mm00447459_m1, respectively; Applied Biosystems Inc., Foster City, CA). We confirmed that all PCR products were on the standard curve by parallel PCR conducted with serially diluted cDNA samples. The amplification was normalised using mouse glyceraldehyde-3-phosphate dehydrogenase (Gapdh) mRNA (Mm99999915_g1, Applied Biosystems Inc., Foster City, CA).
Immunoblotting
Whole cell lysates prepared from mouse liver, Hepa1–6 cells and mouse primary hepatocytes, and 20 µg of protein were subjected to SDS-PAGE. The separated proteins were then immunoblotted as described previously using an anti-betatrophin (Angptl8) rabbit polyclonal antibody (no. 7619, ProSci, Poway, CA), an anti-HNF-1 antibody (sc-8986 ×, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), an anti-Phospho-Akt (Ser473) (D9E) antibody (#4060, Cell Signaling Technology., Danvers, MA), an anti-GAPDH antibody (ab9485, abcam, Cambridge, UK), an anti-cyclophilin A antibody (Upstate., Lake Placid, NY) and an anti-β actin antibody (#4967, Cell Signaling Technology., Danvers, MA).
Plasmids
The mouse Angptl8 promoter (−2291/+101 bp) plasmid, which is housed in the region from −2291/+101 bp of Angptl8 gene, was generated by genomic PCR using sense primer: 5′-CCCAAGCTTTTACGGGATGACTCCCT-3′ and anti-sense primer: 5′-CCCAAGCTTGAGCTGGCTCTGG-3′. Each primer contained a Hind3 restriction enzyme site to facilitate subcloning into pGL4.10-Luciferase reporter vector (Promega, Madison, WI). −1508/+101 of fragment was digested from −2291/+101 construct by Bgl2 restriction enzyme and subcloned. Serially deleted promoter fragments (−966 / +101, −309 / +101 and −59 / +101) were generated by PCR using 5′-GATGGAGAGATCTGGCCTGCTAGC-3′, 5-GAAGATCTGAAGGGAGCCACG-3′ and 5′-GAAGATCTATGGCAGCCTATGG-3′ as sense primers containing a Bgl2 restriction enzyme site, respectively and 5′-CCCAAGCTTGAGCTGGCTCTGG-3′ as a common anti-sense primer. Three mutant promoter constructs (−2291/+101) harbouring two different series of mutations or a deletion of the HNF-1-binding site at −84/−68 were generated by GeneArt Site-Directed Mutagenesis System (Invitrogen, Carlsbad, CA). The mutated nucleotide sequences are shown in Fig. 3a. All PCR-generated promoter constructs were verified by sequencing the DNA.
Cell culture, transfection and luciferase assays
Hepa1–6, HepG2 and HeLa cells were cultured in 12-well plates as previously described. Reporter plasmid (0.3 μg) and 0.5 μg of human HNF-1α and/or HNF-1β expression vector (Addgene, Cambridge, MA) or empty pCMV10 vector (Sigma Aldrich Japan, Tokyo, Japan) were transfected into cells using the Lipofectamine 2000 Transfection Reagent (Invitrogen, Carlsbad, CA). Mouse primary hepatocytes were transfected using GenomeONE-Neo (FD) (Ishihara Sangyo Kaisha, LTD, Osaka, Japan).
Small interfering (si) RNA against Hnf-1
We purchased siRNA for mouse Hnf-1α and Hnf-1β (sc-35568 and sc-37929; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). ON-TARGET plus control non-targeting pool (D-001810-10-20, Thermo Fisher Scientific, Lafayette, CO) was purchased to serve as a negative control. The siRNA of each concentrations was transfected into Hepa1–6 cells using Lipofectamine RNAi Max reagent (Invitrogen, Carlsbad, CA). Twenty-four hours after transfection, cells were harvested and whole cell lysates were prepared followed by SDS-PAGE.
EMSA study
Electrophoretic mobility-shift assays (EMSA, gel-shift assay) were performed as described previously45,46. Double-stranded oligonucleotides WT probe, M1 probe and M2 probe were labelled with [α-32P] deoxy-CTP by a fill-in reaction using a Klenow fragment of DNA polymerase. For competition experiments, a 20- or 40-fold molar excess of cold oligonucleotides was incubated. For supershift experiments, 3 μl of rabbit anti-HNF-1 antibody (sc-8986 ×, Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was added and the mixture was incubated for an additional 30 min at room temperature. All EMSA assays were repeated at least twice with similar results and a representative result is shown.
Chromatin immunoprecipitation (ChIP) assay
Nuclear extract was prepared from Hepa1–6 cells after incubation with or without 100 nM insulin for 1 hr and subjected to immunoprecipitation. ChIP assays were performed using ChIP-IT Express kit (Active Motif, Carlsbad, CA) according to the manufacturer's protocol. Briefly, formaldehyde (37%) was directly added to the cell culture medium at a final concentration of 1% and incubated for 10 min. Cells were lysed and the nuclear lysate was sonicated three times with 15-sec pulses using a sonicator set at 25% of maximum power to yield the DNA fragments between 150 and 1000 base pairs in length. Sheared chromatin solution was immunoprecipitated with 3 μg of an anti-HNF-1 antibody (sc-8986 ×; Santa Cruz Biotechnology, Inc., Santa Cruz, CA) or preimmune mouse IgG (sc-2025; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). For Ct value-based evaluation, qPCR was performed with power SYBR Green (Applied Biosystems Inc., Foster City, CA) using Applied Biosystems 7500 sequence detector with 1 μl of immunoprecipitate and input samples, according to the manufacturer's specified parameters. The primers for qPCR to amplify the region between −170 and +102 were as follows; sense: 5′-TAGCAGCGTGATATCAGCATTGC-3′ and antisense: 5′-TTGAGCTGGCTCTGGACCACCCAG-3′. The data represent %input ± SEM of tripricate PCR samples. ChIP assays were repeated twice.
Primary hepatocyte cell culture and insulin stimulation
Hepatocytes were prepared from wild type mice using the collagenase-perfusion method with minor modifications and cultured in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% foetal bovine serum, 0.5 μg/ml insulin, 1 μM dexamethasone, 10 ng/ml epidermal growth factor, 200 μM ascorbic acid, 10 mM nicotine amide, 10 U/ml penicillin and 10μg/ml streptomycin. After a 12 h incubation, cells were cultured in serum- and insulin-free DMEM for 2 hours, and whole-cell lysates were prepared at the time points indicated after treatment with insulin47.
In-vivo ChIP assay
In-vivo ChIP assyas were performed as previously reported48. We employed mouse liver tissue excised from fasted 12 h or re-fed 60 minutes after 12 h fasting mice. Briefly, each sample pf liver tissue (60–80 mg) was weighed and incubated in 1% formaldehyde (1 ml/20 mg tissue) at 37 C for 20 min with agitation. The tissue was then washed twice with ice-cold PBS buffer (PBS/ 1 mM PMSF/ 1 μg/ml aprotinin) and resupended in 100 μl of lysis buffer (1% sodium dodecyl sulfate/ 50 μM Tris-HCl/ 10 mM EDTA/ 1 mM phenylmethylsulphonylfluoride/ 1μg/ml aprotinin) for 10 min at 4 C, The lysate was sonicated three times with 10-sec pulses using a sonicator set at 70% of maximum power to reduce the DNA length to between 200 and 1000 bp. Chromatin solution was used for ChIP assays.
Statistical analysis
The data were analysed using JMP version 11 (SAS Institute Inc., Cary, NC). The data were analysed using the Dunnett test or Steel method followed by ANOVA. All values are expressed as the mean ± SEM. Significant level was set at p < 0.05
Equipment and settings
All images of immunoblotting and EMSA study were exposed to photosensitive film (Kodak Japan Ltd, Tokyo) or captured using lumino image analyzer LAS4010 (GE Healthcare Japan, Tokyo). Those images were converted to jpg using Canon TS8000 scanner (Canon Inc, Japan). The images converted jpg was processed to figures using Microsoft PowerPoint (Microsoft corporation, Redmond, WA).
References
Oike, Y., Akao, M., Kubota, Y. & Suda, T. Angiopoietin-like-proteins: potential new targets for metabolic syndrome therapy. Trends Mol. Med. 11, 473–479 (2005).
Mattijssen, F. & Kersten, S. Regulation of tryglyceride metabolism by Angiopoietin-like proteins. Biochem. Biophys. Acta. 1821, 782–789 (2012).
Ren, G., Kim, J. Y. & Smas, C. M. Identification of RIFL, a novel adipocyte-enriched insulin target gene with a role in lipid metabolism. Am. J. Physiol Endocrinol Metab. 303, E334–51 (2012).
Quagliarini, F. et al. Atypical angiopoietin-like protein that regulates ANGPTL3. Proc. Natl. Acad. Sci. USA 109, 19751–19756 (2012).
Zhang, R. Lipasin, a novel nutritionally-regulated liver-enriched factor that regulates serum triglyceride levels. Biochem Biophys Res. Commun. 424, 786–792 (2012).
Gusarova, V. et al. ANGPTL8/betatrophin does not control pancreatic beta cell expansion. Cell. 159, 691–696 (2014).
Wang, Y. et al. Mice lacking ANGPTL8 (Betatrophin) manifest disrupted triglyceride metabolism without impaired glucose homeostasis. Proc. Natl. Acad. Sci. USA 110, 16109–16114 (2013).
Izumi, R. et al. CRISPR/Cas9-mediated Angptl8 knockout suppresses plasma triglyceride concentrations and adiposity in rats. J. Lipid Res. 59, 1575–1585 (2018).
Cox, A. R. et al. Angiopoietin-like protein 8 (ANGPTL8)/betatrophin overexpression does not increase beta cell proliferation in mice. Diabetologia. 58, 1523–1531 (2015).
Jiao, Y., Le Lay, J., Yu, M., Naji, A. & Kaestner, K. H. Elevated mouse hepatic betatrophin expression does not increase human β cell replication in the transplant setting. Diabetes. 63, 1283–1288 (2014).
Fu, Z., Yao, F., Abou-Samra, A. B. & Zhang, R. Lipasin, thermoregulated in brown fat, is a novel but atypical member of the angiopoietin-like protein family. Biochem Biophys Res Commun. 430, 1126–1131 (2013).
Espes, D., Lau, J. & Carlsson, P. O. Increased circulating levels of betatrophin in individuals with long-standing type 1 diabetes. Diabetologia. 57, 50–53 (2014).
Fu, Z. et al. Elevated circulating lipasin/betatrophin in human type 2 diabetes and obesity. Sci Rep. 4, 5013 (2014).
Espes, D., Martinell, M. & Carlsson, P. O. Increased circulating betatrophin concentrations in patients with type 2 diabetes. Int J Endocrinol. 2014, 323407 (2014).
Hu, H. et al. Increased circulating levels of betatrophin in newly diagnosed type 2 diabetic patients. Diabetes Care. 37, 2718–2722 (2014).
Lee, Y. H. et al. Association between betatrophin/ANGPTL8 and non-alcoholic fatty liver disease: animal and human studies. Sci. Rep. 6, 24013 (2016).
Zhang, Y. et al. ANGPTL8 negatively regulates NF-κB activation by facilitating selective autophagic degradation of IKKγ. Nat. Commun. 8, 2164 (2017).
Tseng, Y. H. et al. Chromosome 19 open reading frame 80 is upregulated by thyroid hormone and modulates autophagy and lipid metabolism. Autophagy. 10, 20–31 (2014).
Dang, F. et al. Fasting and Feeding Signals Control the Oscillatory Expression of Angptl8 to Modulate Lipid Metabolism. Sci. Rep. 6, 36926 (2016).
Wu, G. D., Chen, L., Forslund, K. & Traber, P. G. Hepatocyte nuclear factor-1 alpha (HNF-1 alpha) and HNF-1 beta regulate transcription via two elements in an intestine-specific promoter. J. Biol. Chem. 269, 17080–17085 (1994).
Cha, J. Y. & Repa, J. J. The liver X receptor (LXR) and hepatic lipogenesis. The carbohydrate-response element-binding protein is a target gene of LXR. J. Biol. Chem. 282, 743–751 (2007).
Kaplan, R. et al. Regulation of the angiopoietin-like protein 3 gene by LXR. J Lipid Res. 44, 136–143 (2003).
Duntas, L. H. Thyroid disease and lipids. Thyroid. 12, 287–293 (2002).
Hashimoto, K. et al. Cross-talk between thyroid hormone receptor and liver X receptor regulatory pathways is revealed in a thyroid hormone resistance mouse model. J. Biol. Chem. 281, 295–302 (2006).
Hashimoto, K. & Mori, M. Crosstalk of thyroid hormone receptor and liver X receptor in lipid metabolism and beyond. Endocr J. 58, 921–930 (2011).
Mullur, R., Liu, Y. Y. & Brent, G. A. Thyroid hormone regulation of metabolism. Physiol Rev. 94, 355–382 (2014).
Courtois, G., Morgan, J. G., Campbell, L. A., Fourel, G. & Crabtree, G. R. Interaction of a liver-specific nuclear factor with the fibrinogen and alpha 1-antitrypsin promoters. Science. 238, 688–692 (1987).
Baumhueter, S., Courtois, G. & Crabtree, G. R. A variant nuclear protein in dedifferentiated hepatoma cells binds to the same functional sequences in the beta fibrinogen gene promoter as HNF-1. EMBO J. 7, 2485–2493 (1988).
Mendel, D. B. & Crabtree, G. R. HNF-1, a member of a novel class of dimerizing homeodomain proteins. J Biol Chem. 266, 677–680 (1991).
Tronche, F. & Yaniv, M. HNF1, a homeoprotein member of the hepatic transcription regulatory network. Bioessays. 14, 579–587 (1992).
Shih, D. Q. et al. Hepatocyte nuclear factor-1alpha is an essential regulator of bile acid and plasma cholesterol metabolism. Nat Genet. 27, 375–382 (2001).
Pontoglio, M. et al. Defective insulin secretion in hepatocyte nuclear factor 1 alpha-deficient mice. J Clin Invest. 101, 2215–2222 (1998).
Pontoglio, M. et al. Hepatocyte nuclear factor 1 inactivation results in hepatic dysfunction, phenylketonuria, and renal Fanconi syndrome. Cell. 84, 575–585 (1996).
Lee, Y. H., Sauer, B. & Gonzalez, F. J. Laron dwarfism and non-insulin-dependent diabetes mellitus in the Hnf-1alpha knockout mouse. Mol. Cell Biol. 18, 3059–3068 (1998).
Barbacci, E. et al. Variant hepatocyte nuclear factor 1 is required for visceral endoderm specification. Development. 126, 4795–4805 (1999).
Coffinier, C., Thépot, D., Babinet, C., Yaniv, M. & Barra, J. Essential role for the homeoprotein vHNF1/HNF1beta in visceral endoderm differentiation. Development. 126, 4785–4794 (1999).
Froguel, P. & Velho, G. Molecular Genetics of Maturity-onset Diabetes of the Young. Trends Endocrinol Metab. 10, 142–146 (1999).
Horikawa, Y. et al. Mutation in hepatocyte nuclear factor-1 beta gene (TCF2) associated with MODY. Nat. Genet. 17, 384–385 (1997).
Yamagata, K. et al. Mutations in the hepatocyte nuclear factor-1alpha gene in maturity-onset diabetes of the young (MODY3). Nature. 384, 455–458 (1996).
Yamagata, K. et al. Mutations in the hepatocyte nuclear factor-4alpha gene in maturity-onset diabetes of the young (MODY1). Nature. 384, 458–460 (1996).
O’Brien, R. M. & Granner, D. K. Regulation of gene expression by insulin. Physiol Rev. 76, 1109–1161 (1996).
Wolfrum, C., Besser, D., Luca, E. & Stoffel, M. Insulin regulates the activity of forkhead transcription factor Hnf-3b/Foxa-2 by Akt-mediated phosphorylation and nuclear/cytosolic localization. Proc Natl Acad Sci USA 100, 11624–11629 (2003).
Oyadomari, S. et al. The gene for hepatocyte nuclear factor (HNF)−4α is activated by glucocorticoids and glucagon, and repressed by insulin in rat liver. FEBS Lett. 478, 141–146 (2000).
Hirota, K. et al. Hepatoxyte nuclear factor-4 is a novel downstream target of insulin via FKHR as a signal-regulated transcriptional inhibitor. J. Biol. Chem. 278, 13056–13060 (2003).
Yamada, M. et al. Isolation and characterization of the rat prolactn-releasing peptide gene: multiple TATA boxes in the promoter region. Biochem Biophys Res. Commun. 281, 53–56 (2001).
Ozawa, A. et al. Transcriptional regulation of the human PRL-releasing peptide (PrRP) receptor gene by a dopamine 2 receptor agonist: cloning and characterization of the human PrRP receptor gene and its promoter region. Mol Endocrinol. 16, 785–798 (2002).
Yoshino, S. et al. Protection against High-Fat Diet-induced obesity in Helz2-Deficient male mice due to enhanced expression of hepatic leptin receptor. Endocrinology. 155, 3459–3472 (2014).
Hashimoto, K. et al. Mouse sterol response element binding protein-1c gene expression is negatively regulated by thyroid hormone. Endocrinology. 147, 4292–4302 (2006).
Acknowledgements
This work was supported by Japan Society for the Promotion of Science (JSPS) KAKENHI (Grants-in-aid for Scientific Research) Grant Number 26461374 and 23591346 to A.O.
Author information
Authors and Affiliations
Contributions
T.W. conducted experiments and wrote the manuscript. A.O. conducted experiments and wrote the manuscript. S.M. supported the experiments especially the in-vivo ChIP assays and immunoblotting studies. S.Y. supported the experiments especially the primary hepatocyte culture. E.I. supported the experiments especially the in vivo ChIP assay. Y.K. supported the experiments. S.M. supported the experiments. A.K. supported the experiments. K.H. supported the experiments. Y.N. supported the experiments. E.Y. supported the experiments. T.T. supported the experiments. T.S. supported the experiments. SI supported the experiments. N.S. supported the experiment. S.O. was discussant. T.S. was discussant. M.Y. was discussant.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Watanabe, T., Ozawa, A., Masuda, S. et al. Transcriptional Regulation of the Angptl8 Gene by Hepatocyte Nuclear Factor-1 in the Murine Liver. Sci Rep 10, 9999 (2020). https://doi.org/10.1038/s41598-020-66570-0
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-020-66570-0
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.