Abstract
Viticulture is of high socio-economic importance; however, its prevalent practices severely impact the environment and human health, and criticisms from society are raising. Vine managements systems are further challenged by climatic changes. Of the 8 million hectares grown worldwide, conventional and organic practices cover 90% and 9% of acreage, respectively. Biodynamic cultivation accounts for 1%. Although economic success combined with low environmental impact is widely claimed by biodynamic winegrowers from California, to South Africa, and France, this practice is still controversial in viticulture and scientific communities. To rethink the situation, we encouraged stakeholders to confront conventional and biodynamic paradigms in a Participative-Action-Research. Co-designed questions were followed up by holistic comparison of conventional and biodynamic vineyard managements. Here we show that the amplitude of plant responses to climatic threats was higher in biodynamic than conventional management. The same stood true for seasonal trends and pathogens attacks. This was associated with higher expression of silencing and immunity genes, and higher anti-oxidative and anti-fungal secondary metabolite levels. This suggests that sustainability of biodynamic practices probably relies on fine molecular regulations. Such knowledge should contribute to resolving disagreements between stakeholders and help designing the awaited sustainable viticulture at large.
Similar content being viewed by others
Introduction
Of the 8 million hectares devoted to viticulture worldwide, conventional and organic practices cover 90% and 9% of acreage, respectively. Biodynamic cultivation accounts for only ca. 1% (http://www.demeter.net/contacts-di), and this practice is still controversial. Studies on biodynamic or/and organic cultivation focused on economy and soil composition1, on soil structure, soil biodiversity and microbiological activity2, and on fertilizer effects3. Studies of grape yield and quality4,5, microbial communities in grapes and leaves6,7, and wine biochemistry8 have also been reported. However, the results have not resolved the controversy9 about the ‘anthroposophical paradigm’10 at the heart of biodynamics practice. To date, the dissenting viticulture communities have not reached a collective plan to reduce the impact of viticulture practices on the environment and human health11,12. We have tentatively addressed this problem holistically, bringing together the different stakeholders in a Participative-Action-Research13. The workshops highlighted the dissensus among biodynamic and conventional winegrowers, as well as among the non-government organizations Alsace Nature/France Nature Environment, viticulture advisors, technicians, and research scientists. The dissensus stems from lack of distinct proof of the claims made, and from epistemic conflicts13,14. Relying on a collective epistemology13, the group arrived at the most sensitive and controversial issues. Biodynamic winegrowers lacked experimental evidence for their claim that their practices stimulate plant defense mechanisms. The conventional winegrowers have shown that synthetic pesticides deter pathogens (albeit with a high environmental impact) but there were no data on possible effects on plant defenses. Focusing on plant responses to pathogen and climatic threats, we chose a holistic approach to compare the consequences of the differing practices. We chose Pinot Noir as it is used worldwide for wines and champagne, its genome has been fully sequenced15, and its sensitivity to climatic disorders is well documented16,17. Our trial consisted of 14 plots of Pinot Noir vines grafted onto the SO4 rootstock that had been grown under conventional management (8 winegrowers, 8 plots of 21,413 m2) or biodynamic management (3 winegrowers, 6 plots of 9,756 m2) for more than 20 years in the same climatic conditions (Fig. S1). Over a 4-year period, we monitored vine management, plant physiology, and the levels of infection with virus, downy mildew, and powdery mildew. For plant defense responses, we analyzed secondary metabolite content as well as steady-state mRNA levels of 30 immunity and silencing genes.
Results and Discussion
Soils, climatic conditions and vine management
When comparing soils in conventional/biodynamic management, after chemical and physical analysis, values were higher for pH, Calcium and soil components above 2 mm in conventional, and higher for Manganese and penetrometer assays in Biodynamic, suggesting steeper horizons (Mann-Whitney at *P ≤ 0.05; Table S1). Still, there was no clear-cut picture between soils from biodynamic and conventional plots, in contrast to other studies1,2,4. The conclusions of the latter authors, however, were based on additional biochemical and biological parameters, and here, we cannot exclude that further analysis, such as in microbiology, may reveal differences as illustrated in organic and conventional management7.
We characterized pest management practices after interviews with winegrowers13. All winegrowers in the study relied on copper and Sulfur treatments. In addition, conventional viticulture employed synthetic fungicides, whereas biodynamic cultures were complemented with preparations such as cow manure (500, 500 P), minerals such as finely ground silica (501), decoctions of nettle (504), willow, horsetail, valerian, and lemon oil. Conventional growers followed the guidelines of suppliers, and biodynamic growers followed the Demeter principles (4, www.demeter.net). To better compare the two managements, we modified TFI18 by subtracting Copper and Sulfur from conventional products and built up a modified index (mTFI) (Fig. 1). The mTFI values and application timing changed significantly in response to high pathogen pressure, as in summer 2016 (Fig. 1). As synthetic fungicides are often systemic, they persist within plants for about 2 weeks. In contrast, all biodynamic preparations sprayed on plants were washed off by rains and were repeated. This may explain (though not completely) the higher mTFI for biodynamic cultures (7, 10, and 13.3) in 2014, 2015, and 2016, respectively (Fig. 1). In addition, biodynamic applications began earlier in the spring and stopped earlier in the summer (Fig. S2), with more Sulfur than conventional cultures (with the exception of 2014). When summed up for all years, mTFI and Sulfur applications were higher in biodynamic management. For copper, beside 2016, the mean quantities applied did not differ in conventional and biodynamic, remaining lower than the norm of 4 kg/hectare/year (Demeter).
Pathogens loads in vines
To evaluate the consequences of different management systems on vines, we examined the forth/fifth leaves from the vine apex, which are the most sensitive to pathogen attack. This developmental stage is associated with a physiological change from sink to source19, when the green arms reach the developmental stages H in May and K in July20. Molecular analysis by qRT-PCR allowed detection of downy mildew, powdery mildew, as well as viruses such as grapevine fanleaf virus, grapevine leafroll virus and grapevine vitivirus A (GFLV, GLRaV 1–3 and GVA, respectively). Interestingly, 94 to 100% plants were pathogen-free in spring 2014–2016 (Fig. 2). In July 2014–2015, the proportions of pathogen-free plants decreased, notably in biodynamic management. In 2016, facing high pathogen pressure due to humid and warm conditions (Fig. 3), 78% of plants grown conventionally remained pathogen-free and 49% in biodynamic cultures (Fig. 2). In the pooled data (2014–2016), 305 samples were positive for downy mildew and powdery mildew (36 samples with mixed viral and fungus infection not included in calculations). Fungi were more abundant on plants from biodynamic than conventional cultures (18.28% and 7.09%, respectively; independence test χ 2 P ≤ 0.001). The titers for downy mildew were higher for biodynamic than conventional plants (medians of Δ.ΔCT = 11.60 vs 8.29, Mann-Whitney, P ≤ 0.001). For powdery mildew, the Δ.ΔCT medians did not differ between practices (6.46 vs. 6.94, Mann-Whitney P = 0.21). However, for both managements, none of the harvested leaves showed the visible symptoms described in viticulture, such as a powdery leaf surface due to conidiophores of powdery mildew, an oil-spot leaf response, or associated sporangiophores typical of downy mildew21. Thus, both pest managements appeared to hinder the progression of fungal infection in planta. The low organic matter and nitrogen contents of the soils (Table S1) may also have reduced pathogen distribution within plots and the multiplication of pathogens on leaves19,22,23. With respect to viruses, we observed characteristic symptoms only in autumn24. However, molecular analyses of 263 samples collected across 2014–2016 detected infections by one or more of the most frequent grapevine viruses (such as GFLV, GLRaV 1–3 and GVA) already in the spring, suggesting that the viruses were present before the project started. In the case of pathogen threats, whilst both cultivation practices hindered the progress of infections, the wide application of conventional fungicides clearly reduced the frequency of mildews infection of leaves, and the pathogen contents, more than biodynamic management. However, this again is offset by the environmental impact of synthetic pesticides, whereas copper is the only questionable input in biodynamic practice.
Vines responses to abiotic stress
To characterize vine responses to abiotic stress, we analyzed defense gene mRNA levels in 2044 pathogen-free samples. Variations in mRNA levels of housekeeping genes actin, actin7, GAPDH and UBQ were 15.95%, 13.17%, 8.97% and 6.32%, respectively, and boxplot analyses of normalized Ct values showed the lowest variability of data for GAPDH and UBQ. Therefore, these two genes were chosen as controls for the study. Firstly, mRNA levels of apoplastic amine oxidases (AOS), endochitinase 4 C (CHIT4C), lipase enhanced disease susceptibility (EDS1), ETR1, flavonone 3 hydroxylase (F3H), glutathion S transferase (GST1), HSR, lipoxygenase (LOX), transcriptional activators of the salicylic acid pathway (NPR1-1, NPR1-2), phenyl alanine ammonia lyase (PAL), pathogenesis related proteins (PR1, PR6, PR10-1), superoxyde dismutase (SOD), and stilbene synthase (STS1) were analyzed. These contribute to MAMP-triggered immunity, effector-triggered susceptibility, or effector-triggered immunity21,25. Comparing all values from 2014–2016, CHIT4C, ETR1, F3H, STS1, LOX, AOS, NPR1-1, NPR1-2, HSR, SOD transcript levels were higher in pathogen-free samples from biodynamically grown vines (Fig. 4A, H samples). In addition, we analyzed transcript levels of RNA-dependent RNA polymerases (RdR-1, RdR-2, RdR-6), microRNA-generating (Dicer like DCL1), small-interfering-RNA-generating (Dicer like DCL2, DCL3, and DCL4), argonautes (AGO-1, AGO-2, AGO-7), silencing deficient 5 (SDE-5), suppressor of gene silencing 3 (SGS-3), NPRD-1, and HUA enhancer 1 (HEN-1). These contribute to different RNAi pathways involved in the regulation of endogenous and exogenous transcripts levels, defense responses, DNA repair, repair of abiotic and biotic-associated damage, as well as the transgenerational memory of stress26,27,28,29,30. Comparing all values from 2014 to 2016, the transcript levels of all RNAi genes except AGO7 and SDE5 were higher in pathogen-free samples from biodynamic vines (Fig. 4B, H samples). These results suggested overall higher levels of gene activation following biodynamic rather than conventional practices.
We then compared mRNA levels of all RNAi genes for each season with a Principal Component Analysis (PCA on the ranks of Δ.ΔCT). Plants grown biodynamically showed repeatedly distinct levels of expression of RNAi genes between 2014 and 2016 (Fig. 5B). In 2016, the hydric balance (difference between rainfalls and evaporation potential ETP-Penman) was positive (Fig. 3) and thus favorable to vine development. However, by the end of June 2016, dry and warm conditions characteristic of semi-continental/semi-arid climate set in. Thus, we hypothesized that, in conditions of low or very low abiotic stress, and in pathogen-free samples, the activity of the silencing machinery was at a low level (May 2016, Fig. 5B) but increased in response to warmer and drier summer conditions (Fig. 5B). Winegrowers confirmed abiotic stress of vines in summer 2016. Moreover, they pointed out that vines suffered from abiotic stress already in spring 2014, associated with an unfavorable hydric balance and high temperatures (Fig. 3). At the molecular level, the transcript levels of silencing genes were higher in spring 2014 than spring 2016 (Fig. 5B) and a summer-shift was observed, mainly in biodynamic plants. In 2015, when the annual rainfall reached only half of ETP-P and very dry/warm weather persisted from mid-May until the end of July, vines faced severe abiotic threats to the extent that numerous winegrowers across the Alsace region (not participants in the Participative-Action-Research) removed grass with herbicides or by ploughing in order to save their vines. Interestingly, vines in that year exhibited the highest silencing gene transcript levels observed in this study, especially in biodynamic management. Taken together, our data suggest a molecular signature specific to vines grown biodynamically and experiencing a more intense response to abiotic stress, with high expression of silencing and immunity genes (Fig. 5A-B) in pathogen-free leaves. If this reflects enhanced expression of plant defenses then, conversely, the data imply lower plant defense responses in vines subjected to conventional practices. A possible critical difference in plant managements lies in the use of manures and tisanes versus synthetic fungicides. Yet, differences between biodynamic and conventional managements were lower in summer, but also in May and July 2016 (Fig. 5A,B). Importantly, mTFI values as well as amounts of copper and sulfur sprayed were significantly higher in both practices during these seasons (Fig. 1 and Fig. S2). Therefore, smaller differences between management practices in pathogen-free samples, notably in 2016, may be a response to more favorable climatic conditions or/and to excessive spraying impairing plant molecular responses.
Vines responses to pathogens threats
To compare the outcome of managements in the presence of biotic stress (2014–2016), we analyzed defense gene mRNA levels in pathogen-containing vines grown conventionally or biodynamically. The earlier observations in pathogen-free plants resembled, with higher transcript levels in biodynamic in virus-containing leaves in all RNAi genes but RDR6, AGO7, HEN1. In fungus-containing samples, only AGO7 differed with higher levels in conventional management (Fig. 4B; H, V, F samples). From 2014 to 2016, the comparison between biodynamic and conventional leaves was less clear-cut for immunity genes. Transcript levels of EDS1 and PR1 were higher in biodynamic leaves and ETR1, AOS, NPR1-1 in conventional, in fungus-containing leaf-samples (n = 305). Transcript levels of ETR1, F3H, LOX, NPR1-1, NPR1-2, SOD, were higher in biodynamic practices and PR1, PR6, PR10-1, GST1, in conventional practices for virus containing samples (n = 263) (Fig. 4A; H, V, F samples). Altogether, the data suggest that silencing genes in vines grown in biodynamic management are more prone to activation by biotic stresses, probably because they are already expressed at higher levels in biodynamic than conventional management in the absence of infection, a phenomenon that resembles priming31,32.
During meetings and interviews, conventional growers criticized the yellowish, unhealthy appearance of vines grown biodynamic. In reaction to this observation, we evaluated chlorophyll content as an indicator of plant fitness. In addition, we evaluated flavonols and anthocyans in 3988 leaf samples from all 14-vineyard plots from 2015 to 2017. Both contribute to the capture of and protection from light, as well as to defense reactions33. Chlorophyll contents were higher in conventional vines in all samples except May 2016 (Fig. 6). In contrast, flavonols were higher in vines grown biodynamic in all seasons and years. This was also true for anthocyans in July 2016–2017. The results are compatible with the appearance of leaves from biodynamic vines and it is possible that the increase in flavonoids also influenced the chlorophyll-associated green color of the leaves. Interestingly, increase in flavonols and anthocyans may indicate a more effective response to abiotic and biotic stress in biodynamic vines34.
Previous research indicates that silicon (“501 preparation”) influence the Arabidopsis transcriptome after fungus infection, and creating a physical barrier on plant leaves35. In rice, silicon was reported to alleviate pathogen effects on plant carbon metabolism and cytokinins through priming36,37,38. However, the 501 preparation is applied only once or twice a year, thus other manures from Equisetum arvense, Salix alba, Achillea millefolium, or Valeriana officinalis may also contribute to elevated defense responses by providing salicylic acid, iron, minerals, and other metabolites. Unfortunately, the constituents and activities of such preparations are poorly documented and they remain a controversy among the vine community. Anyway, causality with plant responses cannot be established firmly here.
Vines responses to pathogens at the biochemical level
Pathogen-free leaf samples collected in July of 2014 to 2016, from two plots per practice, were analyzed further by UHPLC-MS. Of the 880-chromatogram peaks, only twenty-seven molecules were already described in vines (Fig. 7 and Fig. S3). The levels of 18 of them increased in response to abiotic stress in a manner resembling the expression of the immunity and silencing genes (Fig. 4), notably with the highest levels in 2015. Of these metabolites, the levels of two were higher in biodynamic than conventional vines in 2014, and 7 in 2016 (Fig. 7). The contents of nine metabolites did not change significantly (Fig. S3). In 2015, the levels of 2-[4-(3-hydroxypropyl)-2-methoxyphenoxy]-1.3-propanediol; (−)-epicatechin; astragalin I; quercetin 3-O-rutinoside; astragalin II; (−)-epigallocatechin; procyanidin trimer EEC; eriodictyol; (+)-gallocatechin; procyanidin dimer (B1/B2/B3 or B4); isoquercitrin/quercetin 3-O-glucoside; delphinidin 3-O-glucoside were higher in biodynamic than in conventional vines (Fig. 7). Interestingly, these flavonols and pro-anthocyanidins have both anti-oxidative and anti-fungal properties39,40,41,42 and may have enhanced the response to biotic threats, especially in biodynamic vines. In addition, our data confirmed the plasticity of Pinot Noir17, particularly when cultivated in biodynamic management.
Given the enhanced responses of vines grown biodynamic, the question arose of their energetic cost. As yield is primarily determined by management decisions regarding thinning, pruning weights may better reflect overall energy storage of vines. The 1120 data points from 14 plots of mean pruning weights showed no difference between biodynamic and conventional vines in 2016, a favorable year for plant growth (Fig. 8). In 2017, when vines faced intense drought, as in 2015 (Fig. 3), pruning weights of vines grown conventional decreased dramatically, whereas the values remained stable in biodynamic management (Fig. 8; Mann Whitney, P ≤ 0.0001). Thus, the enhanced responses to threats in vines grown under biodynamic management were not detrimental to biomass accumulation. On the contrary, it seems that increased resistance to intense climatic stress is associated with maintenance of plant reserves, which contribute significantly to flowering and the grape yield of the following millesimal43.
Holistic studies are hampered by the complexity of the interactions between plants, the environment and human practices and reasoning. Biodynamic cultivation still relies on many unvalidated and unrecognized assertions9, which hinder acceptance of this form of vineyard management by winegrowers. As a consequence, dialogue between the biodynamic and conventional worlds is still limited. Here we show that involving all of the actors in Participative-Action-Research may contribute resolving the disagreements, firstly by co-constructing questions. Subsequently, all participants were involved in collective reasoning13,14,44,45 in a workshop where a consensus was build up from raw data. This led to the main conclusion of this paper. Beyond, the group prioritized its further questioning. Namely, instead of looking for causality of ‘biodynamic management-specific’ plant response to stress at first, the question of ‘when’ such properties are acquired by plants upon change from conventional to biodynamic management was chosen.
Conclusion
The Participative-Action-Research conducted on this territory lacked winegrowers in organic management. Therefore, we cannot exclude that conclusions raised for biodynamic management would not apply to organic, neither did we resolve fully the controversy about biodynamic practices. However, overall, his project unlocked disagreements between stakeholders by shedding light on unexpected diversity within conventional and biodynamic management, and by characterizing a “biodynamic management-specific” elevated response to climatic and pathogen threats. This suggests that sharing expertise, within a scientific frame, may diminish management intensities, and ultimately, lower environmental and human health impacts of viticulture.
Material and Methods
Climatic characteristics
Climate data were recorded for 10-day-periods throughout 2014–2016 and pooled from the ‘climatic database’ (https://intranet.inra.fr/climatik_v2/ClimatikGwt.html?ticket=ST-940746-pH1Dmj3mkgYNnUzacumC-cas). Differences between rainfall and evaporation potential ETP-Penman are shown in mm water (https://en.wikipedia.org/wiki/Penman%E2%80%93Monteith_equation).
Vineyards plots
Plots were selected so that they all had the same rootstock, planting density and pruning method, upon proposal of winegrowers. The complete trial consisted of 8 vine plots cultivated conventionally and 6 following biodynamic practices, all for more than 20 years. The plots were planted with Pinot Noir vines grafted on the SO4 rootstock at a density of 4,500 plants/hectare. Winter pruning followed the ‘double-Guyot’ guidelines with 1-2 arms (depending on the vigor of the plant) bearing 8–10 latent buds per arm. Summer ‘green pruning’ was conducted to limit vegetative development to c.a. 1 m2 foliage/kg bunches, i.e. within the wired-frame characteristic of ‘Alsace’ and according to AOC viticulture guidelines. In each plot, after exclusion of plants from the two first border rows and the first and last five plants of each row, 4 blocks of 10 plants were defined. These blocks were positioned as far from each other, with at least 10 plants between 2 blocks, when situated within the same row, and with at least one row distance between two blocks-containing rows.
Characterization of soils
All data were collected once, in spring 2015. Penetrometer assays were conducted in the 4 blocks of each vine plot (2 measurements/block) with penetrometer (Penetrometre compactometre sol à cone statique: 6120, SPECTRUM Technologies). The first horizon ended when the pressure gauge for penetration reached 200 psi, the second horizon when it reached 300 psi, and the third horizon when a lower pressure was found beyond the second-horizon endpoint. Analysis of structure and physical and chemical composition was carried out on soil samples (c.a. 250 ml) collected in the 0–30 cm horizon in two places in each block. Then all samples were mixed to reach a single sample per vine plot. The following were measured: pH (NF ISO 10390; extraction with 1/5 distilled water); organic matter (sulfochromic method followed by colorimetric assay, NF ISO 14235); nitrogen dosage (extraction with 1 M KCl followed by colorimetric assay; NF ISO 14256-2); phosphorus, potassium, magnesium, calcium, iron, zinc, manganese (10 g soil + 50 ml distilled water, followed by paper filtration and estimation by atomic spectrophotometry (except phosphorus by colorimetric assay) according to BIPEA (https://www.bipea.org/fr/).
Management and treatments
For biodynamic management, soil and plants were sprayed with the preparations 500 (cow manure), 501 (finely ground silica), 504 (stinging nettle shoots, Urtica dioica. L); and on plants only horsetail (Equisetum arvense L.); 507 (valerian flowers extract, Valeriana officinalis L.); willow (Salix alba L.), fresh barrel compost fermented with yarrow blossoms, valerian flower extracts, and lemon oil. Solids were sprayed at ca. 4–20 g/hectare and liquids ca. 2–10 ml, according to the DEMETER guide. The fungicides sprayed on plants in conventional practices were: CABRIO TOP, CANTUS, CYFLODIUM, DIAZOLE TL, ELECTIS, ELECTIS BLEU, EMENDO V, HOGGAR, KENKIO, KESIS, MILDICUT, NATIVO, PANTHEOS, PERGADO MZ PEPITE, PROFILER, SWITCH, TALIUS, VIVANDO, and YSAYO. As many of these compounds are mixtures, we recalculated the dose for each, after subtracting its content in Copper and Sulfur, when appropriate. The final dosage is expressed as a modified treatment frequency index mTFI = product dose used x field surface sprayed/recommended dose x full field surface for either conventional fungicides or biodynamic preparations. This led to specific indicators for Copper and Sulfur and thus allowed a better comparison of conventional and biodynamic managements. The doses are as recommended by the supplier and/or the government for synthetic fungicides on conventional plots or the Biodynamic Guide (www.demeter, 4) for biodynamic composts and preparations. (Neither herbicides nor insecticides were taken under consideration in mTFI calculations).
Fluorescence measures
Fluorescence was measured on the fourth/fifth leaf from the apex of all 10 plants of each plot (1 measure/plant; 4 blocks/plot) with a ‘DUALEX’ (DX 17748, Force A) device and data transformed into µg/cm2 leaf surface according to46.
Leaf sampling
Fourth/fifth-leaves from the apex were collected in May and July (2014–2016), the stage most sensitive to pathogen attack19, when the green arms reached the developmental stages H and K20 for all 40 plants of each vine plot. Leaves were deep-frozen in liquid nitrogen. Total RNA extraction was performed according to Romon et al.47.
Growth conditions of control plants used for molecular analysis
PN162 and PN40024 lines free of all pathogens evaluated in this study were grown in vitro under controlled conditions as described in Romon et al.47, for RNA extraction and qPCR analysis (see below).
Primers
Primers were designed according to Trouvelot el al48 and Chong et al.49 for immunity genes, for powdery mildew, and for viruses GVA and GLRaV1-350,51,52. All other primers were designed, optimized for Tm, and adapted to Fluidigm technology, in the course of this study. Amplified products were cloned and sequenced for alignment according to the corresponding genomes of pathogens48,49 and Pinot Noir Genome sequence (https://urgi.versailles.inra.fr/Species/Vitis
Genes | FW primer (5′3′) | RV primer (5′3′) |
---|---|---|
Vv GST1 | CAAGGCTATATCCCCATTTTCTTC | TGCATGGAGGAGGAGTTCGT |
Vv SOD | TGCCAGTGGTAAGGCTAAGTTCA | GTGGACCTAATGCAGTGATTGA |
Vv HSR | GGACTACCGACATGCACCTG | CCTGGACAATTCTGCCATCT |
Vv AOS | GCCTGGCTTAATCACGACAT | CACCTTCGTCCAGAACATGA |
Vv LOX | CCCTTCTTGGCATCTCCCTTA | TGTTGTGTCCAGGGTCCATTC |
Vv PAL | TCCTCCCGGAAAACAGCTG | TCCTCCAAATGCCTCAAATCA |
Vv PR6 | AGGGAACAATCGTTACCCAAG | CCGATGGTAGGGACACTGAT |
Vv CHIT4c | TCGAATGCGATGGTGGAAA | TCCCCTGTCGAAACACCAAG |
Vv PR10.1 | CTGTGGTTGACGGAGATGTT | CCCTTAACGTGCTCTTCAGAG |
Vv PR1 | GGAGTCCATTAGCACTCCTTTG | CATAATTCTGGGCGTAGGCAG |
Vv NPR1.1 | GACCACAACCGAGCTTCTTGATC | ATAATCTTGGGCTCTTTCCGCATT |
Vv NPR1.2 | GCAGGAAACAAACAAGGACAGGAT | CAGCCATTGTTGGTGAAGAGATTG |
Vv EDS1 | CCCTGAATCATCTAGAATTGCGAAT | GTGATTGCTGTAATTGGTTTAGCAG |
Vv ETR1 | GTTAGGTAGAACTTTGTCTCTGG | TAACAGGATGCTGAATGGGTATGG |
Vv STS1 | TACGCCAAGAGATTATCACT | CTAAAGAGTCCAAAGCATCT |
Vv F3H | ATCGTGGAGGAGCACAAGAT | TGGATGAGGTGTCAGTTCCA |
Vv DCL-1 | GTACATCCACTTCCTGGATCAC | CAGAATGTCTCTTGACATGAAGC |
Vv DCL-2 | GCAGGCGACTTATTATCCACCAG | CATGCTCACAGTCATAGTACCCC |
Vv DCl-3 | CAAGCTGTGAAGGCTGATGGCC | TCAAGGCATCTAATAGGATCTGGGG |
Vv DCl-4 | GCAAGAATTGGAAAGATTTGTGGC | GACTTTTGTGATCTTCGACGTTCC |
Vv RdR-1 | CGCCAACTAAGGTCTTGGATC | CACACCAGTTTTGGGGAACTCTAG |
Vv RdR-2 | GTTGTTTGGGAGGTGGGAAAG | GCATCTTCCTTAGAGATATGGTAC |
Vv RdR-6 | CATGCTTACTCCTCCCTGAAG | ATCACCCTCTCCCCGAAGACC |
Vv HEN-1 | GGCCATACCACAGAAGGGTCC | TTCCCGCACGATGGAATTACTG |
Vv SDE-5 | CTCGTGAAGCAGATGAAGAATC | CCTTTTGAAATGTTTTCCTCGC |
Vv AGO-1 | CAATTCAGCCTGTCGCTCCCTC | TCCATCACAGCACGGTTCACC |
Vv AGO-2 | AACGTGAGCAACTTCCTACACC | CTTGTTCACCTTGCCCTCGG |
Vv AGO-7 | CTAACCAGAACCAGTACCAGAGC | GTTGTTCTGCTTCCATGAAGG |
Vv NRPD-1 | GCAAGTGCCATCTGGCCTCCTA | CACACGTAGAGCACTGACAAGAAGG |
Vv SGS-3 | GGATGAGGAGTTGTACAGGAGGG | GGAATGTCGAGCCTTCACTGC |
VvActin-1 | TGCTATCCTTCGTCTTGACCTTG | GCACTTCTGGACAACGGAATCTC |
VvUBQ | GTGGTATTATTGAGCCATCCTT | AACCTCCAATCCAGTCATCTAC |
VvActin-7 | GACTACCTACAACTCCATCAT | TCATTCTGTCAGCAATACCA |
VvGAPDH | TTCCGTGTTCCTACTGTTG | CCTCTGACTCCTCCTTGAT |
Viruses | ||
GFLV | CGGGACCACTATGGATTGGAATGA | CGTTCGGTGATATGGAGAGCG |
GLRaV1 | CTGACCCTATCGCTGCTACTGA | CTTACTCCCATCAACCCAGGTATC |
GLRaV2 | TATTCTTCATGCCTCTCAGGATCTG | GCTGCGAGTTCTTGTTGACCC |
GLRaV3 | AAGTGCTCTAGTTAAGGTCAGGAGTGA | CCACCAGTCTCAGTCCGCTATTACC |
GVA | CGACCGAACAATGTACCTGAATACTC | CTAGCATTAGGTCCTACTATATCTACC |
(Grapevine Fanleaf-virus, Grapevine leaf roll virus 1–3, grapevine Vitivirus A) | ||
Fungi | ||
Plasmapora viticola | TTCGATATATACATGCGAATGGTG | TCCCCAAGGCAAAACATAAC |
Erysiphe necator | CTTCGGATTTTTGGATCAGA | GGCACGATCATTGGATTCTT |
(Downy mildew and powdery mildew) |
) with Vector NTI.
Total RNA extraction and quantification
Total RNA was extracted with a Nucleospin RNA plant kit (MACHEREY NAGEL) supplemented with 20 mg/ml polyvinylpyrrrolidone 40 and 1% beta-mercaptoethanol in lysis buffer RA147. RNA was quantified with a Nanodrop NP-1000.
cDNA synthesis and specific target pre-amplification
cDNA was produced from total RNA (100 ng) in a 5-µl reaction mixture using the FLUIDIGM Reverse Transcription Master Mix Kit (FLUIDIGM Corporation, CA, USA) according to the manufacturer’s instructions. An aliquot of 1.25 µl cDNA was pre-amplified in a 5-µl reaction mixture using the FLUIDIGM PreAmp Master Mix Kit (FLUIDIGM Corporation, CA, USA) with a pool of all 41 pairs of gene-specific primers at a final concentration of 50 nM per primer. The PCR conditions were 95 °C for 2 min, followed by 14 cycles at 95 °C (15 s) and 54 °C (4 min). The pre-amplified products were then treated for 30 min at 37 °C in the presence of 4 U/µl exonuclease I (NEW ENGLAND BIOLABS) followed by 15 min at 80 °C for enzyme inactivation. After a fivefold dilution in DNA suspension buffer (TEKNOVA), pre-amplified products were stored at −20 °C until use in quantitative real-time PCR.
Massive parallel quantitative real-time PCR
Real-time PCR was carried out with the FLUIDIGM BIOMARK HD System using 48.48 Dynamic Array IFCs for Gene Expression according to the manufacturer’s instructions. Briefly, sample mixtures were prepared by mixing 2.7 µl of each diluted pre-amplified product with 3 µl of 2X SsoFast EvaGreen Supermix with Low ROX (BIORAD) and 0.3 µl of 20X DNA Binding Dye Sample Loading Reagent (FLUIDIGM). In parallel, assay mixtures were prepared by mixing 0.6 µl from each 50 µM of mixed forward and reverse primers with 3 µl of 2X Assay Loading Reagent (FLUIDIGM) and 2.4 µl DNA suspension buffer (TEKNOVA). The dynamic array was first primed with control line fluid and then loaded together with sample and assay mixtures using the BIOMARK IFC Controller MX according to the manufacturer’s instructions. The array was then transferred to the BIOMARK HD for PCR at 95 °C for 60 s, followed by 30 cycles at 95 °C for 5 s and 54 °C for 20 s according to the protocol GE Fast 48*48 PCR + Melt v2.pcl. The data were analyzed with real-time PCR analysis software in the BIOMARK HD system using the parameter settings Quality Threshold 0.65, Linear Baseline Correction Method, and Auto (Global) Ct Threshold Method.
Internal controls and inter-array calibrators for quantitative real-time PCR
Each 48.48 Dynamic Array integrates a total of 36 test samples and 12 control samples. The latter include a no DNA template (NTC), one positive control sample for fungi contamination (mixed strains contaminated by downy and powdery mildews), and four positive control samples for viral contamination (strain P70 contaminated by GLRa-V1 and GVA, strain Y206 contaminated by GLRa-V2, strain PN40024-31 contaminated by GFLV, and strain Y285 contaminated by GLRa-V3). Six additional controls were used as inter-array calibrators for the compensation of signal variation between BIOMARK HD runs. A stock of control cDNA samples was prepared from strains PN162 CIV (i.e. the accession grown in the vineyards) and PN 40024, both grown in vitro under controlled conditions47, divided into 3-µl aliquots, and stored at −80 °C until further use. Each aliquot was freeze/thawed only once. Before each BIOMARK HD run, both control cDNA samples were pre-amplified with the pool of all 41 pairs of gene specific primers, treated with exonuclease I, and diluted fivefold as for the test samples. The control products were further subjected to serial ½ dilutions in TE buffer pH 8.0 with low EDTA (INVITROGEN) plus 0.25% Tween 20 (THERMO SCIENTIFIC PIERCE). Three distinct dilutions of both inter-array calibrators were loaded on to each 48.48 Dynamic Array at the same position: dilution 1 corresponding to test sample dilutions, dilution 3 corresponding to ¼ of dilution 1, and dilution 5 corresponding to 1/16 of dilution 1 (civ.dil.1, civ.dil.3, civ.dil.5, 40024.dil.1, 40024.dil.3, and 40024.dil.5).
Data normalization and calculation of delta-delta Ct
For Q-PCR analyses, CT (threshold cycle) values, representing the target transcript abundance in samples, were calculated by the FLUIDIGM Real-time PCR analysis software using default settings. To compensate for technical variations between qPCR runs, the inter-array calibrators (civ.dil.1, civ.dil.3, civ.dil.5, 40024.dil.1, 40024.dil.3 and 40024.dil.5) were used to calculate a calibration factor (CF, geometric mean of inter-array calibrators CT values) for each plate. All CT values on each plate were then multiplied by CF to obtain inter-plate normalized Ct values. Four control genes (actin, actin7, GAPDH and UBQ) were integrated on all plates. For each plate and for each control gene, we calculated a median value from the inter-plate normalized Ct values. These median values were used to associate a coefficient of variation (cv% = 100*standard deviation / mean) with the control genes. The cv% values were 15.95%, 13.17%, 8.97% and 6.32% for actin, actin7, GAPDH and UBQ, respectively. Using boxplot analyses of the normalized Ct values, we showed that data variability was lowest for GAPDH and UBQ. Hence, we used the data of the GAPDH and UBQ control genes to calculate the delta Ct value in all further experiments. For each plate, a geometric mean of the normalized Ct values from the two control genes (CT reference) was calculated. Delta CT values were then calculated for each gene as: ΔCT = CT reference – CT gene. The normalized target amount in the sample was then equal to 2ΔΔCt. ΔΔCT = (Ct reference-Ct target) sample – (Ct reference-Ct target) calibrator.
Cut-Off
Δ.ΔCT values ranged (in semi-log) from 9–15 for samples experimentally infected with virus, 12.91–16.88 for downy mildew, and 4.50–11.39 for powdery mildew. In samples from the vineyards, the values were 0–11.15, after qRT-PCR for virus, 0–16.88 for downy mildew, and 0–10.48 for powdery mildew. All samples analyzed in this study showing a value below the cut-off of 4.5 were considered ‘pathogen-free’. In control samples from plants grown in vitro Δ.ΔCTs were 0–2.5 for mildews and 0–2.39 for viruses.
Sample preparation
Leaves were ground in liquid nitrogen with pestle and mortar and cooled during further preparation. 100-mg portions of ground leaves were accurately weighted and extracted with 800 µl of 80% aqueous acetone (v/v) during ultra-sonication for 45 min. The sample suspension was centrifuged at 12,000 g for 5 min and the supernatants collected. The extracts were diluted 1 + 19 (v/v) with H2O and Trolox was used as internal standard at 20 µg/ml in each sample. Aliquots of the dilutions (5 μl) were injected into the LC-MS system.
UPLC/Q-TOFMS analysis
The UPLC analysis was performed on a Waters Acquity UPLC system using an ACQUITY UPLC column BEH Shield RP18 (1.7 µm, 100 × 2.1 mm i.d., WATERS, Saint-Quentin-en-Yvelines, France). The mobile phase, delivered at 0.3 ml/min, consisted of a gradient mixture of water containing 0.1% formic acid (eluent A) and acetonitrile containing 0.1% formic acid (eluent B). The following gradient was used: 0–4 min, 5% B; 4–7 min, 5–15% B; 7–15 min, 15–25% B; 15–16 min, 25–100% B; 16–19 min, 100% B; 19–19.5 min, 100–5% B; 19.5–22 min, 5% B. Detection was at 280 nm for all studied compounds. The LC system was coupled to a micrOTOF-Q II mass spectrometer (BRUKERDALTONIK, Germany). Eluted components were ionized by electrospray ion source (ESI) operating in negative mode, using N2 as the instrument gas, with a drying gas temperature of 200 °C at 9 l/min and a nebulizer pressure of 40.6 psi. Set capillary voltage was 4000 V, end plate offset −500 V, collision cell RF 200 Vpp, energy transfer time 120 µs, and pre pulse storage 1 µs. Data were acquired in MS (m/z range of 100–2000). The system was controlled by Hystar chromatography software (BRUKERDALTONIK) and data analysis carried out with Bruker Compass DataAnalysis 4.0 software (BRUKERDALTONIK, Germany). The results are expressed as mg/g Trolox equivalent, a water-soluble synthetic vitamin E derivative 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid used as standard.
Statistical treatment of data
All statistics used « R » (R Core Team, 2017. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL https://www.R-project.org/) and FACTOMINER package:52 An R Package for Multivariate Analysis. Journal of Statistical Software. 25, pp. 1–18. http://www.jstatsoft.org/v25/i01/). As most of the data did not follow a Gaussian distribution, statistical analysis was performed with non-parametric approaches like Mann - Whitney tests or Spearman coefficients for PCA analysis. Final presentations for box-plots used ≪Statgraphics, Centurion XVII≫ (STATPOINT TECHNOLOGIES INC) and FACTOMINER for PCA53.
References
Reganold, J. P., Palmer, A. S., Lockhart, J. C. & Macgregor, A. N. Soil quality and financial performance of biodynamic and conventional farms in New Zealand. Science 260, 344–349. PMID:17838252, https://doi.org/10.1126/science.260.5106.344 (1993).
Mäder, P. et al. Soil fertility and biodiversity in organic farming. Science 296, 1694–1697, https://doi.org/10.1126/science.1071148 (2002).
Giannattasio, M. et al. Microbiological features and bioactivity of a fermented manure product (preparation 500) used in biodynamic agriculture. J. Microbiol. Biotechnol. 5, 644–651 pmid:23648853 (2013).
Reeve Jennifer, J. R. et al. Soil and winegrape quality in biodynamically and organically managed vineyards. Am. J. Enol. Vitic. 56, 367–376 (2005).
Döring, J., Frisch, M., Tittmann, S., Stoll, M. & Kauer, R. Growth, Yield and fruit quality of grapevines under organic and biodynamic management. Plos One, October 8, https://doi.org/10.1371/journal.poe.0138445 (2015).
Kecskeméti, E., Berkelmann-Löhnertz, V., & Reineke, A. Are Epiphytic Microbial Communities in the Carposphere of Ripening Grape Clusters (Vitis vinifera L.) Different between Conventional, Organic, and Biodynamic Grapes? PLoS One 11. https://doi.org/10.1371/journal.pone.0160852. eCollection 2016; pmid: 27500633 (2016).
Campisano, A. et al. Bacterial endophytic communities in the grapevine depend on pest management, PLoS One 9, https://doi.org/10.1371/journal.pone.0112763. eCollection 2014 (2014).
Tassoni, A., Tango, N. & Ferri, M. Comparison of biogenic amine and polyphenol profiles of grape berries and wines obtained following conventional, organic and biodynamic agricultural and oenological practices. Food Chemistry 139, 405–413, https://doi.org/10.1016/j.foodchem.2013.01.041 (2013).
Chalker-Scott, L. The science behind biodynamic preparations: a literature review. Horttechnology 23, 815–819 (2013).
Steiner, R. Agriculture: a course of eight lectures. Biodynamic association, London http://wn.rsarchive.org/Biodynamics/GA327/English/BDA1958/Ag1958_index.html (1974).
Foley, J. A. et al. Solutions for a cultivated planet. Nature 478, 337–342, https://doi.org/10.1038/nature10452 (2011).
Hossard, L., Guichard, L. & Pelosi, C. Lack of evidence for a decrease in synthetic pesticide use on the main arable crops in France. Science of the Total Environment. 575, 152–161 pmid:27736698. https://doi.org/10.1016/j.scitotenv.2016.10.008 (2017).
Moneyron, A. et al. Linking the knowledge and reasoning of dissenting actors fosters a bottom-up design of agroecological viticulture. Agron. Sustain. Dev. 37–41. https://doi.org/10.1007/s13593-017-0449-3 (2017).
Pestre, D. À contre-science, Paris, Le Seuil (2013).
Jaillon, O. et al. The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla. Nature 27, 463-467 Epub 2007 Aug 26; pmid:17721507 (2007).
Chuine, I. et al. Historical phenology: grape ripening as a past climate indicator. Nature 432, 289–90, https://doi.org/10.1038/432289a (2004).
Castagna, A. et al. Environmental plasticity of Pinot noir grapevine leaves: A trans-European study of morphological and biochemical changes along a 1,500-km latitudinal climatic gradient, Plant Cell Environ. 40, 2790–2805 https://doi.org/10.1111/pce.13054. Epub 2017 Sep 27. PMID:28792065 (2017).
Pingault, N., Pleyber, E., Champeaux, C., Guichard, L. & Omon, B. Prospective S.D.E.L.A., Evaluation, E.T.D.E.L, Produits phytosanitaires et protection intégrée des cultures: l’indicateur de fréquence de traitement (IFT). Notes et études socioéconomiques 32, 61–94 (2009).
Calonnec, A., Cartolaro, P. & Chadoeuf, J. Highlighting features of spatiotemporal spread of powdery mildew epidemics in the vineyard using statistical modeling on field experimental data. Phytopathology 99, 411–422, https://doi.org/10.1094/PHYTO-99-4-0411 (2009).
Baggiolini, A. Les stades repérés dans le développement annuel de la vigne et leur utilisation pratique. Rev. Romande Agric. Vitic. 8, 4–6 (1957).
Armijo, G. et al. Grapevine Pathogenic Microorganisms: Understanding Infection Strategies and Host Response Scenarios, Front. Plant Sci. 7, 382, PMCID: PMC4811896. https://doi.org/10.3389/fpls.2016.00382 (2016).
Burie, J. B., Langlais, M. & Calonnec, A. Switching from a mechanistic model to a continuous model to study at different scales the effect of vine growth on the dynamic of a powdery mildew epidemic. Ann. Bot. 107, 885–895, https://doi.org/10.1093/aob/mcq233. (2011). Epub 2010 Dec 1.
Valdes-Gomez, H., Gary, C., Cartolaro, P., Lolas-Caneo, M. & Calonnec, A. Powdery mildew development is positively influenced by grapevine vegetative growth induced by different soil management strategies. Crop Protection 30, 1168–1177. Pub20-ACL-Valdes-11_CP (2011).
Baozhong, M., Martelli, G. P., Golino, D. A. & Fuchs, M. Grapevine viruses: molecular biology, diagnostics and management. Springer https://doi.org/10.1007/978-3-319-57706-7 (2017).
Jones, J. D. G. & Dangl, J. L. The plant immune system. Nature 444, 323–329, https://doi.org/10.1038/nature05286 (2006).
Bologna, N. G. & Voinnet, O. The diversity, biogenesis, and activities of endogenous silencing small RNAs in Arabidopsis, Annu. Rev. Plant. Biol. 65, 473–503. https://doi.org/10.1146/annurev-arplant-050213-035728. Epub 2014 Feb 26 (2014).
Weiberg, A. & Jin, H. Small RNAs the secret agents in the plant-pathogen interactions. Curr. Opin. Plant Biol. 87–94. https://doi.org/10.1016/j.pbi.2015.05.033. Epub 2015 Jun 26. Review. PMID: 26123395 (2015).
Boyko, A. et al. Transgenerational adaptation of Arabidopsis to stress requires DNA methylation and the function of Dicer-like proteins. PloS One. https://doi.org/10.1371/journal.pone.0009514 (2010). PMID:20209086;.
Wei, W. et al. A role for small RNAs in DNA double-strand break repair, Cell 149, 101–112. pmid:22445173; https://doi.org/10.1016/j.cell.2012.03.002 (2012).
Gao, M. et al. Ago2 facilitates Rad51 recruitment and DNA double-strand break repair by homologous recombination, Cell Res. 24, 532–541. PMID:24662483; https://doi.org/10.1038/cr.2014.36 (2014).
Martinez-Medina, A. et al. Recognizing Plant Defense Priming, Trends Plant Sci. 21, 818–822 https://doi.org/10.1016/j.tplants.2016.07.009. Epub 2016 Aug 6 (2016).
Mauch-Mani B. I., Baccelli, I. & Flors, V. Defense Priming: An Adaptive Part of Induced Resistance, Annu. Rev. Plant Biol. 68, 485–512. https://doi.org/10.1146/annurev-arplant-042916-041132. Epub 2017 Feb 2 (2017).
Braidot, E. et al. Transport and accumulation of flavonoids in grapevine (Vitis vinifera L.). Plant Signal. Behav. 3, 626-32. pmid:19513253; PMCID: PMC2634543 (2008).
Latouche, G., Bellow, S., Poutaraud, A., Meyer, S. & Cerovic, Z. G. Influence of constitutive phenolic compounds on the response of grapevine (Vitis vinifera L.) leaves to infection by Plasmopara viticola. Planta 237, 351–361. https://doi.org/10.1007/s00425-012-1776-x; Epub 2012 Oct 19; pmid:23213137 (2013).
Fauteux, F., Chain, F., Belzile, F., Menzies, J. G. & Bélanger, R. R. The protective role of silicon in the Arabidopsis-powdery mildew pathosystem, Proc. Natl. Acad. Sci. USA 103, 17554–17559. Epub 2006 Nov 2. PMID:17082308 (2006).
Van Bockhaven, J. De Vleesschauwer, D. & Höfte, M. Towards establishing broad-spectrum disease resistance in plants: silicon leads the way, J. Exp. Bot. 64, 1281–93 https://doi.org/10.1093/jxb/ers329. Epub 2012 Dec 18. PMID:23255278 (2013).
Markovich, O. et al. Silicon promotes cytokinin biosynthesis and delays senescence in Arabidopsis and Sorghum, Plant Cell Environ. 40, 1189–1196. https://doi.org/10.1111/pce.12913. Epub 2017 Apr 12. PMID:28102542 (2017.
Debona D., Rodrigues, F. A. & Datnoff, L. E. Silicon’s Role in Abiotic and Biotic Plant Stresses, Annu. Rev. Phytopathol. 55, 85–107. https://doi.org/10.1146/annurev-phyto-080516-035312. PMID:28504920.
Harsh, P. B., Walker, T. S., Kennan, A. J., Stermitz, F. R. & Vivanco, J. M. Structure-Dependent Phytotoxicity of Catechins and Other Flavonoids: Flavonoid Conversions by Cell-free Protein Extracts of Centaurea maculosa (Spotted Knapweed) Roots. J. Agric. Food Chem. 51, 897–901, https://doi.org/10.1021/jf020978a (2003).
Hirasawa, M. & Takada, K. Multiple effects of green tea catechin on the antifungal activity of antimycotics against Candida albicans. Journal of Antimicrobial Chemotherapy 53, 225–229, https://doi.org/10.1093/jac/dkh046 (2004).
Cai, Y. Z., Sun, M., Xing, J., Lu, Q. & Corke, H. Structure-radical scavenging activity relationships of phenolic compounds from traditional Chinese medicinal plants. Life Sciences 78, 2872–2888, https://doi.org/10.1016/j.lfs.2005.11.004 (2005).
Tabart, J., Kevers, C., Pincemail, J., Defraigne, J. O. & Dommes, J. Comparative antioxidant capacities of phenolic compounds measured by various tests. Food Chemistry 113, 1226–1233, https://doi.org/10.1016/j.foodchem.2008.08.013 (2009).
Huglin, P. Biologie et écologie de la vigne Payot Lausanne (1986).
Callon, M., Lascoumes, P. & Barthe, Y. Agir dans un monde incertain. Essai sur la démocratie technique, Paris, Le Seuil (2001).
Ancey, V., Avelange, I. & Dedieu, B. Agir en situation d’incertitude en Agriculture. Regards pluridisciplinaires au Nord et au Sud, Paris, P.I.E. Peter Lang Ecopolis 17, 13–17 (2013).
Cerovic, Z. G. et al. Nondestructive diagnostic test for nitrogen nutrition of grapevine (Vitis vinifera L.) based on dualex leaf-clip measurements in the field. J. Agric. Food Chem. 63, 3669–3380. pmid:25801210; https://doi.org/10.1021/acs.jafc.5b00304 (2015).
Romon, M. et al. RNA silencing is resistant to low-temperature in grapevine. PLoS One. 8 https://doi.org/10.1371/journal.pone.0082652 (2013).
Trouvelot, S. et al. A beta-1,3 glucan sulfate induces resistance in grapevine against Plasmopara viticola through priming of defense responses, including HR-like cell death. Mol. Plant Microbe Interact. 2, 232–43 https://doi.org/10.1094/MPMI-21-2-0232. PMID:18184067 (2008).
Chong, J., Le Henanff, G., Bertsch, C. & Walter, B. Identification, expression analysis and characterization of defense and signaling genes in Vitis Vinifera. Plant Phys. and Biochemistry 46, 469–481 (2008).
Dufour, M. C., Fontaine, S., Montarry, J. & Corio-Costet, M. F. Assessment of fungicide resistance and pathogen diversity in Erysiphe necator using quantitative real-time PCR assays. Pest Manag. Sci. 67, 60–69. https://doi.org/10.1002/ps.2032. Epub 2010 Oct 14.
Pacifico, D., Caciagli, P., Palmano, S., Mannini, F. & Marzachì, C. Quantitation of Grapevine leafroll associated virus-1 and -3, Grapevine virus A, Grapevine fanleaf virus and Grapevine fleck virus in field-collected Vitis vinifera L. ‘Nebbiolo’ by real-time reverse transcription-PCR. J. Virol. Methods 172, 1–7. https://doi.org/10.1016/j.jviromet.2010.12.002. Epub 2010 Dec 15 (2011).
Osman, F., Olineka, T., Hodzic, E. & Golino, A. Rowhani, Comparative procedures for sample processing and quantitative PCR detection of grapevine viruses. J. Virol. Methods 179, 303–310, https://doi.org/10.1016/j.jviromet.2011.11.008 (2012).
Lê, S., Josse, J. & Husson, F. An R Package for Multivariate Analysis. Journal of Statistical Software. 25, 1–18. http://www.jstatsoft.org/v25/i01/ (2008).
Acknowledgements
Many thanks to all the participants of the LMC and particularly those of the Westhalten group (GIEE): Boesch M, Breuzard M, Burgenath M, Bursin A, Dauer E, Diringer S, Hetsch R, Huntzinger B, Isner P, Kaepfer B, Koehler C, Lallemand JF, Lallemand H., Lassablière R, Miclo Y, Montavon P, Ribeiro S, Rominger C, Rué P, Schäfer P, Schatz G, Schatz V, Schermesser F, Schlegel J.L., Schmitt D, Wisselmann F, Muré T., Cousin F. Thanks to F. Hammel for advice on climatic data. Thanks to Y Chupeau, to H. Vaucheret and to S. Malembic-Maher for help with manuscript editing. We thank the three successive Presidents and directors of AVA for their support of this long-term project. Funding’s: This project was funded by the SmaCH INRA metaprogramm, by France Agrimer, the Conseil Interprofessionnel des Vins d’Alsace (CIVA), by the Agence Eau Rhin Meuse (AERM), and by Inter-Reg Agroform.
Author information
Authors and Affiliations
Contributions
All authors contributed to study conceiving, oversaw the data, contributed to their analysis. D.S. and C.C. conducted metabolites analysis. C.T.C. and D.D. run fluidigm experiments. All other authors took samples, measurements in the vineyards, and performed molecular analysis. I.S.G., M.L. C.T.C., D.D. were particularly responsible for statistics. I.S.G. and J.E.M. contributed to all experimental steps and wrote paper. All authors reviewed the manuscript.
Corresponding author
Ethics declarations
Competing Interests
The authors declare no competing interests.
Additional information
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Electronic supplementary material
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Soustre-Gacougnolle, I., Lollier, M., Schmitt, C. et al. Responses to climatic and pathogen threats differ in biodynamic and conventional vines. Sci Rep 8, 16857 (2018). https://doi.org/10.1038/s41598-018-35305-7
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-018-35305-7
Keywords
This article is cited by
-
Biodynamic compost effects on soil parameters in a 27-year long-term field experiment
Chemical and Biological Technologies in Agriculture (2022)
-
Wine quality under integrated, organic and biodynamic management using image-forming methods and sensory analysis
Chemical and Biological Technologies in Agriculture (2021)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.