Abstract
Norovirus (NoV) is the leading global cause of viral gastroenteritis. Young children bear the highest burden of disease and play a key role in viral transmission throughout the population. However, which host factors contribute to age-associated variability in NoV severity and shedding are not well-defined. The murine NoV (MNoV) strain CR6 causes persistent infection in adult mice and targets intestinal tuft cells. Here we find that natural transmission of CR6 from infected dams occurred only in juvenile mice. Direct oral CR6 inoculation of wild-type neonatal mice led to accumulation of viral RNA in the ileum and prolonged shedding in the stool that was replication-independent. This viral exposure induced both innate and adaptive immune responses including interferon-stimulated gene expression and MNoV-specific antibody responses. Interestingly, viral uptake depended on passive ileal absorption of luminal virus, a process blocked by cortisone acetate administration, which prevented ileal viral RNA accumulation. Neonates lacking interferon signalling in haematopoietic cells were susceptible to productive infection, viral dissemination and lethality, which depended on the canonical MNoV receptor CD300LF. Together, our findings reveal developmentally associated aspects of persistent MNoV infection, including distinct tissue and cellular tropism, mechanisms of interferon regulation and severity of infection in the absence of interferon signalling. These emphasize the importance of defining viral pathogenesis phenotypes across the developmental spectrum and highlight passive viral uptake as an important contributor to enteric infections in early life.
Similar content being viewed by others
Main
Norovirus (NoV) is the leading cause of acute gastroenteritis worldwide, affecting individuals of all ages but causing particularly high morbidity and mortality in children younger than five. Young children bear the highest burden of disease1, with 66–90% experiencing at least one NoV infection before age three2. They often exhibit more prolonged and higher levels of faecal viral shedding than older children or adults3,4, contributing to their central role in viral transmission to all age groups5. Although no vaccines or treatments for NoV currently exist, development of therapies targeting persistent NoV shedding in children could reduce faecal-oral spread throughout the entire population.
Murine NoV (MNoV) is a natural mouse pathogen that shares features with human NoVs including faecal-oral transmission, mechanisms of genome replication and virion structure, serving as a powerful model for in vivo studies of pathogenesis6. Different MNoV strains model different aspects of human NoV infection. Acute strains infect gut-associated haematopoietic cells and are cleared by 7–14 d post-infection (dpi) in wild-type mice7,8. Conversely, persistent strains infect rare intestinal epithelial tuft cells and are shed in faeces of wild-type animals through at least 70 dpi (refs. 9,10), modelling human persistent asymptomatic shedding. All MNoV strains tested so far use the host protein CD300LF as a receptor11,12,13. Interferons (IFNs) are central for innate immune control of MNoV, with type III IFNs limiting intestinal viral replication and type I IFNs limiting viral dissemination to systemic tissues14,15,16,17 and pathogenesis of acute strains18. Importantly, most studies characterizing MNoV pathogenesis have used adult mice, although NoV is an important cause of paediatric gastroenteritis.
It was recently reported that wild-type neonatal mice develop diarrhoea after infection with an acute strain of MNoV, whereas persistent strains of MNoV cause substantially less diarrhoea19,20. Whether persistent MNoV contributes to ongoing shedding in neonates remains unknown. To develop a model of persistent paediatric infection, we examined the dynamics and host factors involved in neonatal infection with persistent MNoV strain CR6. We found that transmission from infected dams to naïve pups occurs after postnatal day (P)16. However, after direct inoculation at P6, viral genomes are detected in stool until 10 dpi. Intriguingly, in wild-type neonates, viral RNA is uniquely detected in ilea, and viral RNA presence is largely independent of tuft cells or CD300 viral receptors, both of which are required for CR6 infection of adults. Viral RNA ileal uptake and faecal shedding are unaffected by antiviral treatment but blocked by cortisone, which limits non-specific uptake in the neonatal ileum. In contrast, when types I and II IFN signalling are disrupted, specifically in haematopoietic cells, CD300-dependent viral dissemination and lethality follow neonatal CR6 inoculation. Our data demonstrate passive ileal absorption as an understudied mechanism for enteric viral uptake in neonates, which is counterbalanced by host IFN signalling in haematopoietic cells to limit dissemination.
Results
Natural transmission of CR6 occurs after postnatal day 16
We initially investigated transmission of MNoV strain CR6 from infected dams to their naïve litters before weaning at P21. Most pups did not shed viral RNA early in life, but almost all began shedding in the transition from P16 to P21 (Fig. 1a,b). CR6 was not detectable in ilea or colons of pups at P6 or P13, but was present at P21 (Fig. 1c,d). Transmission between P16 and P21 is consistent with the age at which pups become coprophagic21 and could be naturally infected from the dam’s stool.
CR6 inoculation is associated with age-dependent tissue tropism
To directly assess early-life infection, we orally inoculated mice with CR6 at P6 (neonates), P15 (juveniles) or between 6–9 weeks of age (adults). All inoculated mice shed viral RNA in their faeces between 3–10 dpi, with neonates shedding significantly more than juveniles or adults at early timepoints (Fig. 2a–c). At 7 dpi, ileal viral RNA was comparable among mice inoculated at different ages, although it trended lower in juvenile mice (P = 0.1187 vs adults, P = 0.0842 vs neonates) (Fig. 2d). Viral RNA was nearly undetectable in neonatal colons, in contrast to substantial colonic viral RNA in juveniles and adults, suggesting age-dependent differences in CR6 localization (Fig. 2e).
Intestinal microbiota composition varies between mice from different vendors22 or different genetic backgrounds23. Because commensal bacteria promote persistent MNoV infection of adult mice24, we compared CR6 faecal shedding from C57BL/6 neonates sourced from Charles River (CR), Jackson Laboratories (JAX) or bred at Washington University in St Louis (WUSTL). JAX neonates shed more viral RNA than WUSTL or CR neonates (Extended Data Fig. 1a). Among a variety of genetic backgrounds sourced from JAX, C57BL/6 shed at the highest levels (Extended Data Fig. 1b). BALB/c are more susceptible to rotavirus than C57BL/6 neonates25, and both are susceptible to diarrhoea after infection with acute MNoV strains19,20. While ileal and stool CR6 RNA were comparable between BALB/c and C57BL/6 pups at 7 dpi, BALB/c pups exhibited higher colonic viral RNA (Extended Data Fig. 1c,d). Interestingly, adult BALB/c mice exhibited decreased stool viral RNA and trended towards decreased intestinal viral RNA (Extended Data Fig. 1e,f). Genetic background and microbiota may thus differentially influence CR6 localization throughout life.
Tuft cells are dispensable for neonatal CR6 RNA shedding
Intestinal tuft cells are the target of persistent CR6 infection in adult mice10. We inoculated neonatal and juvenile Pou2f3−/− mice, which lack tuft cells26, and found that faecal shedding of CR6 RNA was independent of tuft cells in neonates (Fig. 3a), but dependent on tuft cells in juveniles (Fig. 3b). The dynamics of tuft cell development remain unclear, as some studies suggest that tuft cells develop prenatally27, while others report that they do not accumulate until weaning28. In our mice, tuft cells (quantified by staining for marker DCLK1) were rare at P6 and P13 (Fig. 3c,d and Extended Data Fig. 2a). By P21, tuft cells remained rare in ileum but reached adult-like levels in colon. Co-staining for MNoV non-structural protein NS6/7 showed no CR6-positive tuft cells at 7 dpi in neonates, compared with detectable co-localization in adults (Fig. 3e). We similarly failed to observe non-tuft NS6/7-positive cells in the neonatal ileum. Altogether, our findings suggest that intestinal tuft cells are rare during early life and neonatal CR6 RNA shedding is independent of tuft cells.
CD300LF is largely dispensable for neonatal CR6 RNA shedding
In adult mice, CD300LF expression on tuft cells is required for CR6 infection8,12,13. Among intestinal epithelial cells (IECs), CD300LF is expressed exclusively on tuft cells10,29, but cells including macrophages and dendritic cells express CD300LF and are permissive to other MNoV strains8. Cd300lf expression in the colon was low early in life, but reached adult-like levels by P21, mirroring colonic tuft cell development (Extended Data Fig. 2b). In contrast, ileal Cd300lf expression was age-independent, suggesting that non-tuft cells expressing CD300LF could support CR6 RNA shedding. Cd300lf−/− mice shed viral RNA after neonatal but not after juvenile inoculation (Figs. 3a,b), although Cd300lf−/− neonates shed less viral RNA than wild-type neonates (Fig. 3a) and exhibited decreased viral RNA in mesenteric lymph nodes (MLNs) and spleen but not in ilea (Fig. 3f), suggesting a partial role for CD300LF in neonatal viral RNA uptake. To confirm this, we pre-incubated CR6 with Fc-fusion proteins with either the mouse CD300LF ectodomain (Fc-msCD300LF), which neutralizes MNoV30, or a human CD300LF ectodomain control (Fc-huCD300LF)13. Fc-msCD300LF, but not Fc-huCD300LF, blocked CR6 infection of BV2 microglia cells in vitro (Extended Data Fig. 3). Neonates inoculated with CR6 pre-incubated with Fc-msCD300LF exhibited reduced CR6 RNA shedding (Fig. 3g) and intestinal viral RNA (Fig. 3h), although substantial viral RNA remained detectable in stool and ilea. These data support the idea that CD300LF is partially involved in, but not necessary for, neonatal CR6 RNA uptake and shedding.
We hypothesized that another CD300 family member, CD300LD, may be involved in neonatal viral RNA shedding as CD300LD expression permits MNoV infection in vitro11,12. We found that Cd300lf−/−Cd300ld−/− neonates shed viral RNA comparable to Cd300lf−/− neonates (Fig. 3a), whereas juvenile mice shed no virus (Fig. 3b). Thus, CD300LD is not responsible for CD300LF-independent early life viral RNA release.
STAT1 controls CR6 lethality and dissemination in neonates
In adult mice, CR6 replication is controlled by innate immune responses, particularly IFN pathways15. In contrast, neonatal Rag1−/− mice lacking B and T cells have higher viral titres after infection with acute MNoV strains, indicating adaptive immune control19. Neonatal CR6 inoculation induced IFN-stimulated genes Ifit1 and Mx2 in the ileum at 1 and 7 dpi (Fig. 4a,b and Extended Data Fig. 4a,b), an induction not observed in colon (Extended Data Fig. 4c). Additionally, CR6-inoculated neonates generated serum anti-MNoV immunoglobulin (Ig)M and IgG responses at 14 dpi (Fig. 4c,d), demonstrating that both innate and adaptive immune systems respond to neonatal inoculation. To test the contribution of innate and adaptive immunity in CR6 control, we infected Stat1−/− (lacking a key transcription factor in IFN signalling) and Rag1−/− neonates. Faecal shedding in both was equivalent to wild-type neonates at 7 dpi (Fig. 4e). Unexpectedly, Stat1−/− neonates succumbed to infection with CR6, exhibiting ~75% lethality by 14 dpi (Fig. 4f). This contrasts with adult Stat1−/− mice, which rarely die after CR6 infection31,32. No lethality was observed in Rag1−/− neonates, suggesting that regulation of viral pathogenesis is specific to IFN responses rather than altered priming of adaptive responses.
We next asked which type(s) of IFN limit CR6-associated neonatal lethality. Neonates lacking Ifnar1, Ifngr1 or Ifnlr1, necessary for type I, II and III IFN signalling, respectively, did not succumb to infection (Fig. 4g). In adult mice, type I and II IFNs combinatorially limit lethality after acute MNoV infection33, and indeed Ifnar1−/−Ifngr1−/− neonates succumbed to CR6 infection (Fig. 4g). We also sought to define the cell type(s) in which Stat1 expression prevents CR6 lethality. Villin-Cre+;Stat1f/f and Lysm-Cre+;Stat1f/f neonates, which lack Stat1 expression in epithelial and myeloid cells, respectively, survived infection (Fig. 4h). In contrast, Vav-iCre+;Stat1f/f neonates, lacking Stat1 in haematopoietic and tuft cells, exhibited increased lethality versus littermate controls (Fig. 4h). Adult Stat1−/− mice exhibited increased intestinal and extraintestinal virus after CR6 infection32. Similarly, intestinal virus levels were higher in Stat1−/− versus wild-type neonates, and virus disseminated to extraintestinal sites in Stat1−/− neonates (Fig. 4i). Intestinal and systemic viral RNA were also higher in Vav-iCre+;Stat1f/f neonates compared with littermates (Fig. 4j). Additionally, we detected enhanced CR6 RNA in Stat1−/− ilea using RNA in situ hybridization (RNA-ISH) (Fig. 4k). Together, these data suggest that type I and II IFN signalling, acting at least partly in haematopoietic cells, limit viral replication, dissemination and lethality after neonatal CR6 inoculation.
We also assessed whether CR6 pathogenesis in Stat1−/− mice was CD300-dependent. Stat1−/−CD300lf−/− and Stat1−/−CD300lf−/−Cd300ld−/− neonates inoculated with CR6 exhibited significantly reduced lethality compared with Stat1−/− neonates (Fig. 4l), with reduced intestinal viral RNA and no detectable dissemination to spleen or brain (Fig. 4m). CR6 dissemination and pathogenesis in Stat1−/− neonates is thus CD300 receptor-dependent. Intriguingly, substantial viral RNA was still present in Stat1−/−CD300lf−/− and Stat1−/−CD300lf−/−Cd300ld−/− ilea (Fig. 4m), and faecal viral RNA was comparable to that in Stat1−/− mice (Fig. 4n), similar to observations in Cd300lf−/− and Cd300lf−/−Cd300ld−/− neonates (Fig. 3a,f). We therefore sought to further characterize the ileal and stool CR6 RNA in neonatal mice.
CR6 replicates in Stat1 −/− but minimally in wild-type neonates
To delineate the nature of CD300-independent CR6 RNA shedding in neonates, we treated mice with viral polymerase inhibitor 2′-C-methylcytidine (2-CMC), which limits CR6 replication and shedding in adult mice (Extended Data Fig. 5)34. 2-CMC treatment beginning at 3 dpi protected Stat1−/− neonates from lethality (Fig. 5a). While we were unable to directly compare tissue viral levels within these experiments, as untreated mice succumbed to infection by 7 dpi, we observed lower viral RNA in 2-CMC-treated Stat1−/− neonates across tissues compared with previous experiments (compared to Fig. 4i; average 1 × 104.1 in untreated versus 1 × 102.4 brain MNoV genome copies in 2-CMC-treated mice), suggesting that 2-CMC limits CR6 dissemination in Stat1−/− neonates (Fig. 5b). However, stool viral RNA in Stat1−/− neonates was unaffected by 2-CMC treatment (Fig. 5c). Similarly, 2-CMC treatment beginning at 3 dpi did not reduce ileal or stool viral RNA in wild-type mice at 7 dpi. When antiviral treatment began at 0 dpi, ileal and stool viral RNA decreased subtly but remained detectable (Fig. 5d,e). Thus, while CR6 may replicate immediately after inoculation in wild-type neonates, viral RNA in the ileum and stool at later timepoints is predominantly independent of viral replication.
We questioned whether the detected virus was infectious, as viral nucleic acids may be shed in the absence of infectious virus35. While tissues and stool from adult mice produced plaques on BV2 cells in vitro, no plaques were detected from samples of wild-type neonates at 3–10 dpi (Fig. 5f,g). Neonatal stool (1 and 2 dpi) produced plaques, consistent with passage of infectious inoculum (Extended Data Fig. 6a). Samples from Stat1−/− neonates produced plaques (Fig. 5h,i), suggesting that infectious virus is produced in neonates lacking IFN signalling. Additionally, double-stranded (ds) RNA and MNoV non-structural viral protein NS6/7 co-localized with CD45 in spleen from Stat1−/− neonates, supporting viral replication in haematopoietic cells (Fig. 5j and Extended Data Fig. 6b–d). Together, these data suggest that IFNs limit production of infectious CR6 in neonates, and CR6 RNA detected in ilea and stool of immunocompetent neonates is not due to replicative infection.
CR6 does not persistently infect mice inoculated as neonates
We next assessed how long viral RNA remained detectable in the stool of mice inoculated as neonates. At 14 dpi, CR6 RNA presence in stool depended on the infection status of the litter’s dam (Fig. 5k). As the dam was not directly inoculated, maternal infection probably occurred via coprophagy early after pup inoculation, and infected dams could transfer virus to pups after P16 as in Fig. 1. Without maternal infection, neonates generally shed no faecal viral RNA at 14 dpi. Similarly, Cd300lf−/− neonates largely cleared faecal viral RNA by 14 dpi (Fig. 5l). These data suggest that early-life CR6 inoculation does not lead to persistent infection without secondary transmission from infected dams.
Finally, to identify the source of viral RNA in wild-type neonatal stool, we assessed IEC extrusion, which is induced by rotavirus infection in neonatal mice36. We quantified expression of murine housekeeping gene Rps29 in faecal samples of CR6-inoculated mice. CR6 inoculation increased IEC extrusion in adult but not in neonatal mice (Fig. 5m). However, extrusion was markedly higher in P13 neonates than in P20 or adult mice. CR6 RNA in neonatal stool may thus originate from extruded IECs.
CR6 RNA accumulates in neonates by non-specific uptake
Persistent detection of CR6 RNA in neonatal ilea and stool raised the possibility of prolonged transit time. Adult mice gavaged with Evans blue dye clear dye by 24 h (Extended Data Fig. 7a)24. Conversely, neonates had visibly blue stool at 24 h post-gavage and only cleared dye by 72 h (Extended Data Fig. 7b), suggesting delayed transit time in neonates. However, since CR6 RNA was detectable up to 10 dpi (Fig. 2c), reduced transit time did not fully explain prolonged shedding. Interestingly, wild-type neonatal ilea were visibly blue at 7 dpi (Extended Data Fig. 7c), suggesting that the ileum retained inoculum. Enterocytes in the neonatal ileum internalize luminal material via non-specific endocytosis, a process which ceases by weaning37,38. We detected viral RNA in the epithelium of distal but not proximal small intestine of CR6-inoculated neonates (Fig. 6a and Extended Data Fig. 8). These data suggest that viral inoculum is taken up, potentially via non-specific endocytosis, into neonatal ileal IECs.
Neonatal uptake of luminal material is mediated by the endocytic machinery, including adapter protein DAB2 (ref. 37). Ileal Dab2 expression was high at P6 and P13 but dropped by P21 (Fig. 6b), consistent with when neonatal ileal macromolecule uptake ceases in rodents38. Similarly, lysosomal enzyme N-acetylgalactosaminidase (Naga, involved in early-life macromolecule uptake39), transcriptional repressor Blimp1/Prdm1 (regulates intestinal maturation39,40) and sucrase isomaltase (Sis, involved in transition to solid food consumption39,40) exhibited a profound transition between P13 and P21 (Extended Data Fig. 7d–f).
In neonatal rats, treatment with the steroid cortisone acetate blocks non-specific uptake by driving premature maturation of the intestinal epithelium41. Cortisone treatment decreased ileal Dab2 expression (Fig. 6b) and conferred adult-like expression of Naga, Prdm1 and Sis (Extended Data Fig. 7d–f), consistent with premature maturation of the neonatal mouse intestine. Ileal Evans blue retention was blocked by cortisone treatment (Extended Data Fig. 7c) and indeed, cortisone treatment of wild-type neonates decreased ileal CR6 RNA levels at 7 dpi (Fig. 6c), although it did not affect stool viral RNA levels (Fig. 6d). Intriguingly, cortisone treatment of Cd300lf−/− neonates decreased both ileal and stool viral RNA at 7 dpi, suggesting that a combinatorial effect of viral receptor and non-specific uptake or early infection may contribute to ongoing faecal shedding (Fig. 6e,f). Blocking virus uptake with cortisone treatment in wild-type neonates decreased ileal IFN-stimulated gene expression at 1 and 7 dpi (Fig. 6g,h), although whether this effect was secondary to decreased viral RNA or indirect immunosuppressive effects of steroids remains to be determined. Further, cortisone treatment increased serum anti-MNoV IgM and decreased anti-MNoV IgG, suggesting that it may inhibit class switching and IgG responses to inoculum (Fig. 6i,j). Cortisone treatment of adult mice did not alter stool or tissue CR6 levels, suggesting that steroid administration does not modulate viral susceptibility independent of effects on neonatal non-specific uptake (Extended Data Fig. 9). These findings support the idea that viral RNA in wild-type neonatal ilea is largely due to non-specific uptake of inoculum.
Discussion
Here we discovered intriguing developmental differences contributing to dramatically changed outcomes between neonatal and juvenile or adult mice after inoculation with persistent MNoV. In early life, intact IFN signalling and an absence of tuft cells contribute to resistance to persistent MNoV. However, neonates retain viral RNA input in the absence of productive infection via non-specific endocytosis of inoculum by enterocytes.
Because faecal-oral transmission is the dominant means of interhost transmission for persistent MNoV, natural transmission from infected dams only after P16 is consistent with the lack of coprophagic behaviour while pups rely exclusively on breastmilk. Indeed, cross-fostering pups of MNoV-infected dams to MNoV-naïve dams effectively eliminates litter infection42. If this natural transmission is bypassed by direct inoculation, however, distinct host factors in neonates promote viral RNA uptake but restrict productive infection.
Endocytosis in immature small intestinal enterocytes promotes early-life nutrient absorption, and early gut maturation delays growth and increases neonatal mortality37,39,40. Luminal material uptake also facilitates immune development, enabling passive immunity via transport of breastmilk antibodies, helping establish tolerance to food and microbial antigens38. However, our work demonstrates that pathogenic materials may also be taken up by endocytosis of luminal materials. Neonatal mice are highly susceptible to rotavirus until approximately P15–17, when gut closure occurs, and cortisone treatment of younger mice before inoculation decreases infection43. Thus, if permissive cells are available, passive uptake may facilitate neonatal infections. Conversely, early viral exposure induces innate and adaptive responses, raising the possibility that non-specific endocytosis can protect against later infections. Juvenile mice represent an intriguing intermediate group, as they may experience non-specific endocytosis early in infection, but have undergone intestinal maturation by 7 dpi. Future studies exploring the long-term immunological impact of juvenile infection may reveal how exposures throughout development influence adult immunity.
The persistence of viral RNA after clearance of infectious virus is recognized for numerous RNA viruses including measles virus and SARS-CoV-2. RNA persistence may complicate diagnosis, as viral RNA can be detected after infectious virions have cleared. Persistent RNA may also contribute to chronic immune activation, although its consequences have not been well-defined and may be pathogen- and site-specific35. Heightened IEC shedding in neonates may contribute to prolonged detection of faecal CR6 RNA.
Additional barriers limit neonatal CR6 infection despite passive inoculum uptake. Tuft cells, the target of CR6 in adults, are undetectable in our neonatal mice. Non-epithelial cells also express CD300 molecules, although expression may vary between neonates and adults44. Our data support the idea that without viral restriction by IFNs in haematopoietic cells, CR6 replicates in non-tuft cells in neonates, leading to viral dissemination and lethality. CR6 infection is more lethal in Stat1−/− neonates versus Stat1−/− adults31,32. Viral sensors such as MDA5 and RIG-I are upregulated at weaning compared with early life45, so Stat1-independent responses in adult mice may limit severe infection. Early-life endocytosis may also increase viral uptake compared with CD300LF-dependent infection alone. Alternatively, the microbiota enables CR6 infection in adult mice24 and the neonatal gut microbiome composition is distinct from adults46, so unique features of the neonatal Stat1−/− microbiota may increase infectivity.
Beyond increased lethality in Stat1−/− mice, the specific IFNs controlling CR6 are distinct in neonates versus adults. Type III IFNs control intestinal CR6 replication15, while type I IFNs limit CR6 extraintestinal dissemination in adults33. In contrast, regulation of CR6-driven neonatal lethality is dominated by type I and II IFNs, although type III IFNs may also play a role. Involvement of different IFNs may reflect age-dependent tissue-specificity of IFN responses. In adults, IECs primarily express the type III IFN receptor47, while neonatal IECs respond to both type I and III IFNs48. Multiple IFN classes may thus control viral replication and restrict systemic spread in neonates.
CD300LF plays a minor role in CR6 RNA uptake in wild-type neonates, as disrupting or blocking this receptor decreased viral RNA. Similarly, blocking virus replication with 2-CMC starting at 0 dpi reduced viral RNA shedding, whereas treatment at 3 dpi did not, suggesting early replication. Interestingly, CD300LF has been implicated in facilitating cellular internalization of MNoV not via direct capsid binding but instead via interactions with phosphatidylserines49 while shuttling vesicle-cloaked viral clusters into the endocytic pathway50. We found that cortisone reduced viral RNA shedding in Cd300lf−/− but not in wild-type neonates. Thus, whether CD300LF itself could contribute to passive ileal absorption of virus in neonates remains an intriguing open question. CD300LF dependence is revealed in Stat1−/− neonates, as CD300LF is necessary for systemic spread13. Our work thus identifies numerous context-dependent host factors regulating viral RNA shedding in neonatal mice.
Despite children’s high disease burden and important role in NoV transmission, host factors contributing to age-specific prolonged viral shedding are not well-defined. Host immunity limits NoV persistence, as immunocompromised patients of all ages experience extremely prolonged viral shedding51. Although anti-NoV antibodies accumulate with age, correlated with decreasing infection prevalence52, antibody protection is limited in duration and against heterologous strains3,53, and thus may not fully explain age-based differences. Innate immune regulation of NoV infection has not been well-studied in humans, although many aspects of innate immunity are immature in children54. Whether differences in immune control can explain the variation in disease progression in young children is thus currently unclear. Our study points to both physiological and innate immune characteristics regulating viral outcomes that differ between neonates and juvenile or adult mice, highlighting the critical need to explore how developmental changes may govern infection responses.
Methods
Mice
Unless otherwise specified, C57BL/6J wild-type mice were originally purchased from Jackson Laboratories (JAX 000664) and bred and housed in WUSTL animal facilities under specific-pathogen-free, including MNoV-free, conditions. Animal protocols were approved by the Washington University Institutional Animal Care and Use Committee (protocol numbers 20160126, 20190162 and 22-1040). Animals were housed at up to five adult mice in a cage or a single dam with a lactating litter. The conditions in animal rooms used in this study fall within the standards set by the ‘Guide for the Care and Use of Laboratory Animals’. Temperatures were maintained between 68–72 °F and humidity between 30–70%. The room light cycle is 12 h light:12 h dark. Age- and sex-matched adults were used in adult mouse infections. Litters of pups including males and females were used in neonatal mouse experiments. No statistical methods were used to predetermine sample sizes, but our sample sizes are similar to those reported in previous publications19.
Knockout mice in the C57BL/6J background were maintained in the same conditions and included the following strains: Pou2f3−/−32, Cd300lf−/−12, Rag1−/− (JAX 002216)55, Stat1−/− (JAX 012606)56, Ifnar1−/−57, Ifngr1−/− (JAX 003288)58 and Ifnlr114. Ifnar1−/− mice were originally provided by Michael Aguet (ISREC - School of Life Sciences Ecole Polytechnique Fédérale de Lausanne). Pou2f3−/−, Cd300lf−/−, and Ifnlr1−/− mice were previously generated at Washington University in St. Louis. Ifnar1−/−Ifngr1−/− mice were generated by crossing Ifnar1−/− and Ifngr1−/− mice.
Stat1 conditional knockout mice were generated by crossing Stat1f/f mice (MMRRC 32054)59 to the following Cre lines: Villin-Cre (JAX 004586)60, Lysm-Cre (JAX 004781)61 and Vav-iCre (JAX 008610)62,63. All infections were performed on Cre+ and Cre− littermates born to Cre− dams. Vav-iCre pups were screened for germline deletion of the floxed allele.
Cd300lf−/−CD300ld−/− mice were generated by co-injecting guide RNAs targeting the CD300lf and Cd300ld loci into C57BL/6J fertilized zygotes along with Cas9 mRNA. A founder mouse with the following mutations was recovered:
Cd300lf locus – WT:CGATATACCTCA–GGCTGGAAGGAT
KO:CGATATACCTCAAGGCTGGAAGGAT
Cd300ld locus – WT:TATTCCTCATAC–TGGAAGGGTTAC
KO:TATTCCTCATACGTGGAAGGGTTAC
Additional generations were genotyped by Transnetyx from tail biopsy specimens using real-time PCR with mutation-specific probes.
For comparison of pups by vendor source (Extended Data Fig. 1A), C57BL/6 mice were bred at WUSTL, or purchased as lactating dams with litters from Jackson Laboratories (JAX 000664) or Charles River (CR 027). For comparison of pups by genetic background (Extended Data Fig. 1B), C57BL/6 (000664), BALB/c (000651), A/J (000646), NOD (001976) and 129S1 (002448) lactating dams with litters were purchased from JAX. PWK/PhJ (003715) adults were purchased from JAX and bred at WUSTL due to unavailability of lactating dams for this strain. For comparison of C57BL/6 and BALB/c pups (Extended Data Fig. 1C,D), lactating dams with litters were purchased from CR (CR 027 and 028, respectively). For comparison of C57BL/6 and BALB/c adults (Extended Data Figs. 1E,F), 6-week-old adults were purchased from CR (CR 027 and 028, respectively).
Generation of viral stocks
Stocks of MNoV strain CR6 were generated from molecular clones as previously described13. Briefly, plasmids encoding the viral genomes were transfected into 293T cells to generate infectious virus, which was subsequently passaged on BV2 cells. After two passages, BV2 cultures were frozen and thawed to liberate virions. Virus was concentrated by centrifugation in a 100,000 MWCO ultrafiltration unit (Vivaspin, Sartorius). Titres of virus stocks were determined by plaque assay on BV2 cells.
MNoV infections and sample collection
For adult MNoV infections, 6–9-week-old mice were orally inoculated with 1 × 106 plaque-forming units (p.f.u.) of CR6 in a volume of 25 μl. For neonatal and juvenile infections, P6 and P15 mice, respectively, were gavaged with 1 × 106 p.f.u. of CR6 in a volume of 50 μl using a 22 gauge plastic feeding tube. Virus stocks contained a range of 1 × 107.4–1 × 107.7 genome copies in 1 × 106 p.f.u. Stool samples were collected by gently palpating the abdomen to encourage defecation. Given the challenge of collecting stool from young mice, stool was collected as possible, and the number of samples collected was generally representative of a much greater number of mice. Tissues were collected from mice at the time of euthanasia or shortly after natural death when tissues were still intact. Stool and tissues were collected into 2 ml tubes (Sarstedt) with 1-mm-diameter zirconia/silica beads (Biospec). Samples were frozen and stored at −80 °C until RNA extraction or plaque assay. For controls for treatment groups, infected groups included mice treated with PBS or PBS containing 2% Tween-80.
RNA extraction and quantitative reverse transcription PCR (RT-qPCR)
As previously described14, RNA was isolated from stool using a ZR-96 viral RNA kit (Zymo Research) according to the manufacturer’s protocol. RNA from tissues was isolated using TRI reagent with a Direct-zol-96 RNA kit (Zymo Research) according to the manufacturer’s protocol. RNA (5 μl) from stool or tissue was used for complementary DNA synthesis with the ImPromII reverse transcriptase system (Promega). MNoV TaqMan assays were performed using a standard curve for determination of absolute viral genome copies. PrimeTime RT-qPCR assays were used for Cd300lf (Mm.PT.58.13995989), Ifit1 (Mm.PT.58.32674307) and Mx2 (Mm.PT.58.11386814) using a standard curve. SYBR green PCR was performed for Dab2 (Fw 5′-TCATCAAACCCCTCTGTGGT, Rv 5′-AGCGAGGACAGAGGTCAACA), Naga (Fw 5′- TGCCTTCCTAGCTGACTATGC, Rv 5′- GTCATTTTGCCCATGTCCTC), Prdm1 (Fw 5′- AGTTCCCAAGAATGCCAACA, Rv 5′- TTTCTCCTCATTAAAGCCATCAA), Sis (Fw 5′- TGCCTGCTGTGGAAGAAGTAA, Rv 5′- CAGCCACGCTCTTCACATTT) using Power SYBR Green master mix (Applied Biosystems). RT-qPCR for housekeeping gene Rps29 was performed as previously described14. All samples were analysed with technical duplicates.
MNoV-specific enzyme-linked immunosorbent assay (ELISA)
CR6 at a concentration of 5 × 106 p.f.u. per well diluted in PBS was used to coat a 96-well MaxiSorp plate overnight at 4 °C. Twofold serial dilutions in PBS of mouse IgG (Sigma-Aldrich, I5381, starting at 12.5 ng ml−1) or mouse IgM (Sigma-Aldrich, PP50, starting at 250 ng ml−1) were used to coat plates overnight as standard controls. Wells were washed three times with wash buffer (0.05% Tween-20 in PBS) between incubations. After 1 h of blocking with 1% BSA in PBS (blocking buffer), serum diluted in blocking buffer at 1:50 was incubated for 2 h. After washing, anti-mouse IgG-HRP (Sigma-Aldrich, A3673, 1:2,000 dilution in blocking buffer) or anti-mouse IgM-HRP (Sigma-Aldrich, A8786, 1:2,000 dilution in blocking buffer) was incubated for 2 h. After washing, ELISA TMB Substrate solution (eBioscience) was added and the reaction stopped with the addition of stop solution (2 N H2SO4). Optical density was read at 450 nm and reference wavelength 570 nm, and concentration of samples was determined against the standard curve.
RNA-ISH
Ilea and colons were collected, and intestinal contents flushed with 10% neutral buffered formalin. Tissues were Swiss rolled and fixed overnight in 10% neutral buffered formalin at 4 °C, washed three times with 70% ethanol and embedded in paraffin. RNAscope assays were performed using RNAscope Multiplex Fluorescent v2 assays (ACD) according to manufacturer instructions. Briefly, 5 μm sections were baked at 60 °C for 1 h, then deparaffinized by washing with xylene and 100% ethanol. Antigen retrieval was performed by boiling sections in Target Retrieval reagent (ACD) for 15 min, followed by 30 min of treatment with Protease Plus (ACD) at 40 °C. Tissues were hybridized with a custom-designed probe against MNoV strain CR6 RNA (ACD; 20 probe pairs targeted to strain CR6, within nucleotides 5359–6394 as in GenBank accession number JQ237823.1; used undiluted), and in some experiments a probe against Epcam (418151, ACD, diluted 1:50 in MNoV probe), for 2 h at 40 °C, followed by amplification and development of channel-specific signals according to manufacturer protocol, and staining with DAPI to visualize nuclei. Positive- and negative-control probes were included to validate staining protocols. Images were acquired using an AxioScan Z1 (Zeiss) slide scanner, and ImageJ (v.2.9.0) was used to analyse the images.
Immunofluorescent staining
Ilea and colon sections were Swiss rolled and paraffin embedded as described above. Staining for DCLK1 and NS6/7 was generally performed as described previously10. Briefly, 5 μm sections were deparaffinized by washing three times (5 min each) in xylene and isopropanol, followed by 5 min in running water and 5 min in Tris buffered saline with 0.1% Tween-20 (TBST). Antigen retrieval was performed by boiling for 10 min in antigen unmasking solution (Vector), followed by washing for 5 min in TBST. Blocking was performed in 1% bovine serum albumin and 10% goat serum in TBST for 30 min at room temperature. When staining for dsRNA, an additional 1 h blocking with F(ab) fragment anti-mouse IgG (ab6668, Abcam, 0.1 mg ml−1) was performed. Primary staining was performed overnight at 4 °C using rabbit anti-DCLK1 (D2U3L, Cell Signaling, 62257S, 1:300), guinea pig anti-NS6/7 (1:1,000, gift from Kim Green) and mouse anti-dsRNA (rJ2, MilliporeSigma, MABE113425, 1:200). Samples were washed in TBST, followed by secondary staining for 1 h at room temperature with goat anti-rabbit AlexaFluor 488 (A11008, Invitrogen, 1:500), goat anti-guinea pig AlexaFluor 647 (A21450, Invitrogen, 1:500) and goat anti-mouse AlexaFluor 555 (A21425, Invitrogen, 1:500). Samples were washed in TBST, counterstained with DAPI (1:1,000) and mounted with Fluorshield mounting media. Tuft cells were quantified as DCLK1-positive cells per crypt/villus, counting at least 50 crypts/villi per mouse, beginning at the distal end of the ileum and the proximal end of the colon.
Plaque assay
For CR6 plaque assays, BV2 cells were seeded at 2 × 106 cells per well in a 6-well plate and grown overnight. Tissues were weighed and samples homogenized by bead beating in 500 μl DMEM medium. Samples were spun at 2,500 g for 3 min at 4 °C, then the supernatant was removed and incubated for 1 h at room temperature with rocking. Tenfold dilutions were prepared and applied to each well of BV2 cells, followed by 1 h of incubation at room temperature with gentle rocking. Inoculum was removed and 2 ml of overlay media was added (MEM, 10% FBS, 2 mM l-glutamine, 10 mM HEPES and 1% methylcellulose). Plates were incubated for 72 h before visualization after crystal violet staining (0.2% crystal violet and 20% ethanol).
Fc-CD300lf blocking
CR6 neutralization was assessed in vitro by measuring cytotoxicity. BV2 cells (2 × 104 per well) were plated in a 96-well plate. CR6 was incubated with dilutions of the Fc region of murine IgG2b fused to the human CD300LF ectodomain13 or mouse CD300LF ectodomain30 for 1 h at 37 °C and used to infect BV2 cells at a multiplicity of infection of 0.05. Plates were incubated at 37 °C for 48 h, then 25 μl of CellTiter Glo (Promega, G7571) added per well and luminescence measured using a BioTek Synergy 2 plate reader with an integration time of 1 second to quantify viability via cellular ATP concentrations. Assays were performed in triplicate.
For neutralization with Fc-fusion proteins in vivo, 1 × 106 p.f.u. CR6 was incubated with 1.17 μg of human or mouse Fc-CD300lf in 50 μl media for 1 h at 37 °C before oral infection as described above.
Mouse treatments
Cortisone acetate (Sigma, C3130) was dissolved to 25 mg ml−1 in PBS containing 2% Tween-80 at 37 °C and vortexed to make a fine suspension before injection. Mice were treated by subcutaneous injection at 0.5 mg g−1 body weight41 or the equivalent volume of vehicle using a 31 ga (neonates) or 28 ga (adults) needle to inject into the scruff. Cortisone acetate reduced weight gain and variably contributed to death in pups, probably due to reduced nutrient absorption after premature gut maturation.
2-CMC (Neta Scientific, AST-F12743) was dissolved to 20 mg ml−1 in PBS. Mice were treated by subcutaneous injection at 100 mg kg−1 body weight34 or the equivalent volume of vehicle using a 31 ga needle to inject into the scruff daily.
For intestinal transit time assessment, mice were gavaged with 50 μl (neonates) or 400 μl (adults) of a 1% Evans blue solution. Faecal pellets were resuspended in PBS and intestines were collected from neonatal mice for assessment of blue colour.
Statistical analysis
Data were analysed using GraphPad Prism 9 software. In all graphs, NS indicates not significant (P > 0.05), *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001. Data were tested for normal distribution using Shapiro-Wilk tests and non-parametric tests were performed if data were not normally distributed. F tests or Brown Forsythe tests were performed to confirm equal variances between groups. No statistical method was used to predetermine sample size. No data were excluded from the analyses. When possible, littermate controls were randomized to groups to minimize weight variability between groups. The investigators were not blinded to allocation during experiments and outcome assessment, except for tuft cell quantification which was performed blinded to sample source.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Materials availability
All reagents are available from M.T.B. under a material transfer agreement with Washington University.
Data availability
Data from this study are included in the main paper and in Extended Data. Source data are provided with this paper.
References
Grytdal, S. P. et al. Incidence of norovirus and other viral pathogens that cause acute gastroenteritis (AGE) among Kaiser Permanente member populations in the United States, 2012–2013. PLoS ONE 11, e0148395 (2016).
Cannon, J. L., Lopman, B. A., Payne, D. C. & Vinjé, J. Birth cohort studies assessing norovirus infection and immunity in young children: a review. Clin. Infect. Dis. 69, 357–365 (2019).
Saito, M. et al. Multiple norovirus infections in a birth cohort in a Peruvian periurban community. Clin. Infect. Dis. 58, 483–491 (2014).
Shioda, K. et al. Can use of viral load improve norovirus clinical diagnosis and disease attribution? Open Forum Infect. Dis. 4, ofx131 (2017).
Simmons, K., Gambhir, M., Leon, J. & Lopman, B. Duration of immunity to norovirus gastroenteritis. Emerg. Infect. Dis. 19, 1260–1267 (2013).
Baldridge, M. T., Turula, H. & Wobus, C. E. Norovirus regulation by host and microbe. Trends Mol. Med. 22, 1047–1059 (2016).
Grau, K. R. et al. The major targets of acute norovirus infection are immune cells in the gut-associated lymphoid tissue. Nat. Microbiol. 2, 1586–1591 (2017).
Graziano, V. R. et al. CD300lf conditional knockout mouse reveals strain-specific cellular tropism of murine norovirus. J. Virol. 95, e01652−20 (2020).
Nice, T. J., Strong, D. W., McCune, B. T., Pohl, C. S. & Virgin, H. W. A single-amino-acid change in murine norovirus NS1/2 is sufficient for colonic tropism and persistence. J. Virol. 87, 327–334 (2013).
Wilen, C. B. et al. Tropism for tuft cells determines immune promotion of norovirus pathogenesis. Science 360, 204–208 (2018).
Haga, K. et al. Functional receptor molecules CD300lf and CD300ld within the CD300 family enable murine noroviruses to infect cells. Proc. Natl Acad. Sci. USA 113, E6248–E6255 (2016).
Orchard, R. C. et al. Discovery of a proteinaceous cellular receptor for a norovirus. Science 353, 933–936 (2016).
Graziano, V. R. et al. CD300lf is the primary physiologic receptor of murine norovirus but not human norovirus. PLoS Pathog. 16, e1008242 (2020).
Baldridge, M. T. et al. Expression of Ifnlr1 on intestinal epithelial cells is critical to the antiviral effects of interferon lambda against norovirus and reovirus. J. Virol. 91, e02079-16 (2017).
Nice, T. J. et al. Interferon-λ cures persistent murine norovirus infection in the absence of adaptive immunity. Science 347, 269–273 (2015).
Nice, T. J. et al. Type I interferon receptor deficiency in dendritic cells facilitates systemic murine norovirus persistence despite enhanced adaptive immunity. PLoS Pathog. 12, e1005684 (2016).
Grau, K. R. et al. The intestinal regionalization of acute norovirus infection is regulated by the microbiota via bile acid-mediated priming of type III interferon. Nat. Microbiol. 5, 84–92 (2020).
Thackray, L. B. et al. Critical role for interferon regulatory factor 3 (IRF-3) and IRF-7 in type I interferon-mediated control of murine norovirus replication. J. Virol. 86, 13515–13523 (2012).
Roth, A. N. et al. Norovirus infection causes acute self-resolving diarrhea in wild-type neonatal mice. Nat. Commun. 11, 2968 (2020).
Helm, E. W. et al. Environmentally-triggered contraction of the norovirus virion determines diarrheagenic potential. Front. Immunol. 13, 1043746 (2022).
Ebino, K. Y. Studies on coprophagy in experimental animals. Jikken Dobutsu 42, 1–9 (1993).
Rasmussen, T. S. et al. Mouse vendor influence on the bacterial and viral gut composition exceeds the effect of diet. Viruses 11, 435 (2019).
Hildebrand, F. et al. Inflammation-associated enterotypes, host genotype, cage and inter-individual effects drive gut microbiota variation in common laboratory mice. Genome Biol. 14, R4 (2013).
Baldridge, M. T. et al. Commensal microbes and interferon-λ determine persistence of enteric murine norovirus infection. Science 347, 266–269 (2015).
Blutt, S. E., Warfield, K. L., O’Neal, C. M., Estes, M. K. & Conner, M. E. Host, viral, and vaccine factors that determine protective efficacy induced by rotavirus and virus-like particles (VLPs). Vaccine 24, 1170–1179 (2006).
Gerbe, F. et al. Intestinal epithelial tuft cells initiate type 2 mucosal immunity to helminth parasites. Nature 529, 226–230 (2016).
Saqui-Salces, M. et al. Gastric tuft cells express DCLK1 and are expanded in hyperplasia. Histochem. Cell Biol. 136, 191–204 (2011).
Schneider, C. et al. A metabolite-triggered tuft cell-ILC2 circuit drives small intestinal remodeling. Cell 174, 271–284.e14 (2018).
Haber, A. L. et al. A single-cell survey of the small intestinal epithelium. Nature 551, 333–339 (2017).
Nelson, C. A. et al. Structural basis for murine norovirus engagement of bile acids and the CD300lf receptor. Proc. Natl Acad. Sci. USA 115, E9201–E9210 (2018).
Strong, D. W., Thackray, L. B., Smith, T. J. & Virgin, H. W. Protruding domain of capsid protein is necessary and sufficient to determine murine norovirus replication and pathogenesis in vivo. J. Virol. 86, 2950–2958 (2012).
Walker, F. C. et al. Norovirus evolution in immunodeficient mice reveals potentiated pathogenicity via a single nucleotide change in the viral capsid. PLoS Pathog. 17, e1009402 (2021).
Hwang, S. et al. Nondegradative role of Atg5-Atg12/Atg16L1 autophagy protein complex in antiviral activity of interferon gamma. Cell Host Microbe 11, 397–409 (2012).
Rocha-Pereira, J., Van Dycke, J. & Neyts, J. Treatment with a nucleoside polymerase inhibitor reduces shedding of murine norovirus in stool to undetectable levels without emergence of drug-resistant variants. Antimicrob. Agents Chemother. 60, 1907–1911 (2015).
Griffin, D. E. Why does viral RNA sometimes persist after recovery from acute infections? PLoS Biol. 20, e3001687 (2022).
Zhang, Z. et al. IL-22-induced cell extrusion and IL-18-induced cell death prevent and cure rotavirus infection. Sci. Immunol. 5, eabd2876 (2020).
Park, J. et al. Lysosome-rich enterocytes mediate protein absorption in the vertebrate gut. Dev. Cell 51, 7–20.e6 (2019).
Weström, B., Arévalo Sureda, E., Pierzynowska, K., Pierzynowski, S. G. & Pérez-Cano, F.-J. The immature gut barrier and its importance in establishing immunity in newborn mammals. Front. Immunol. 11, 1153 (2020).
Harper, J., Mould, A., Andrews, R. M., Bikoff, E. K. & Robertson, E. J. The transcriptional repressor Blimp1/Prdm1 regulates postnatal reprogramming of intestinal enterocytes. Proc. Natl Acad. Sci. USA 108, 10585–10590 (2011).
Muncan, V. et al. Blimp1 regulates the transition of neonatal to adult intestinal epithelium. Nat. Commun. 2, 452 (2011).
Daniels, V. G., Hardy, R. N., Malinowska, K. W. & Nathanielsz, P. W. The influence of exogenous steroids on macromolecule uptake by the small intestine of the new-born rat. J. Physiol. 229, 681–695 (1973).
Compton, S. R. Prevention of murine norovirus infection in neonatal mice by fostering. J. Am. Assoc. Lab. Anim. Sci. 47, 25–30 (2008).
Wolf, J. L., Cukor, G., Blacklow, N. R., Dambrauskas, R. & Trier, J. S. Susceptibility of mice to rotavirus infection: effects of age and administration of corticosteroids. Infect. Immun. 33, 565–574 (1981).
Zenarruzabeitia, O. et al. The expression and function of human CD300 receptors on blood circulating mononuclear cells are distinct in neonates and adults. Sci. Rep. 6, 32693 (2016).
Pott, J. et al. Age-dependent TLR3 expression of the intestinal epithelium contributes to rotavirus susceptibility. PLoS Pathog. 8, e1002670 (2012).
Al Nabhani, Z. et al. A weaning reaction to microbiota is required for resistance to immunopathologies in the adult. Immunity 50, 1276–1288.e5 (2019).
Sommereyns, C., Paul, S., Staeheli, P. & Michiels, T. IFN-lambda (IFN-λ) is expressed in a tissue-dependent fashion and primarily acts on epithelial cells in vivo. PLoS Pathog. 4, e1000017 (2008).
Lin, J.-D. et al. Distinct roles of type I and type III interferons in intestinal immunity to homologous and heterologous rotavirus infections. PLoS Pathog. 12, e1005600 (2016).
Voss, O. H., Tian, L., Murakami, Y., Coligan, J. E. & Krzewski, K. Emerging role of CD300 receptors in regulating myeloid cell efferocytosis. Mol. Cell. Oncol. 2, e964625 (2015).
Santiana, M. et al. Vesicle-cloaked virus clusters are optimal units for inter-organismal viral transmission. Cell Host Microbe 24, 208–220.e8 (2018).
Henke-Gendo, C. et al. New real-time PCR detects prolonged norovirus excretion in highly immunosuppressed patients and children. J. Clin. Microbiol. 47, 2855–2862 (2009).
Nurminen, K. et al. Prevalence of norovirus GII-4 antibodies in Finnish children. J. Med. Virol. 83, 525–531 (2011).
Newman, K. L. & Leon, J. S. Norovirus immunology: of mice and mechanisms. Eur. J. Immunol. 45, 2742–2757 (2015).
Simon, A. K., Hollander, G. A. & McMichael, A. Evolution of the immune system in humans from infancy to old age. Proc. Biol. Sci. 282, 20143085 (2015).
Mombaerts, P. et al. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68, 869–877 (1992).
Durbin, J. E., Hackenmiller, R., Simon, M. C. & Levy, D. E. Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 84, 443–450 (1996).
Muller, U. et al. Functional role of type I and type II interferons in antiviral defense. Science 264, 1918–1921 (1994).
Huang, S. et al. Immune response in mice that lack the interferon-gamma receptor. Science 259, 1742–1745 (1993).
Wallner, B. et al. Generation of mice with a conditional Stat1 null allele. Transgenic Res. 21, 217–224 (2012).
Madison, B. B. et al. Cis elements of the villin gene control expression in restricted domains of the vertical (crypt) and horizontal (duodenum, cecum) axes of the intestine. J. Biol. Chem. 277, 33275–33283 (2002).
Clausen, B. E., Burkhardt, C., Reith, W., Renkawitz, R. & Förster, I. Conditional gene targeting in macrophages and granulocytes using LysMcre mice. Transgenic Res. 8, 265–277 (1999).
Ogilvy, S. et al. Promoter elements of vav drive transgene expression in vivo throughout the hematopoietic compartment. Blood 94, 1855–1863 (1999).
Shimshek, D. R. et al. Codon-improved Cre recombinase (iCre) expression in the mouse. Genesis 32, 19–26 (2002).
Acknowledgements
We thank all members of the Baldridge laboratory for helpful discussions, and specifically H. Deng and L. Foster for assistance with mouse colony maintenance; and R. Orchard (University of Texas Southwestern Medical Center) for providing Fc-CD300lf complexes. We are grateful to Kim Green (NIAID, NIH) for providing anti-NS6/7 antibody. We are grateful to Michael Aguet (ISREC - School of Life Sciences Ecole Polytechnique Fédérale de Lausanne) for providing Ifnar1−/− mice. This work was supported by the National Institutes of Health (NIH) grants R01AI141478 (S.M.K., M.T.B.), R01AI139314 and R01AI127552 (M.T.B.), R01A1148467 (C.B.W.) and F31AI167499-01 (E.A.K.), as well as the Burroughs Wellcome Fund (C.B.W.), National Science Foundation DGE-1745038/DGE-2139839 (E.A.K.), and the Pew Biomedical Scholars Program of the Pew Charitable Trusts (M.T.B.). The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.
Author information
Authors and Affiliations
Contributions
E.A.K., A.D. and S.A. performed the experiments. E.A.K. and M.T.B. analysed the results. E.A.K., S.M.K., C.B.W. and M.T.B. designed the project. E.A.K. and M.T.B. wrote the manuscript. All authors read and edited the manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Microbiology thanks Nihal Altan-Bonnet, Jason Mackenzie and the other, anonymous, reviewer(s) for their contribution to the peer review of this work.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Extended data
Extended Data Fig. 1 Source and genetic background of mice influences persistent MNoV shedding as neonates and adults.
(A) C57BL/6 neonates bred at Washington University in St. Louis (WUSTL), Charles River (CR), or Jackson Laboratories (JAX) were orally inoculated with CR6 at P6 and MNoV genome copies detected in 7dpi stool samples by RT-qPCR. (B) Neonates on the indicated backgrounds, all sourced from JAX, were orally inoculated with CR6 at P6 and MNoV genome copies detected in 7dpi stool samples by RT-qPCR. (C, D) Neonates on the indicated background, sourced from CR, were orally inoculated with CR6 at P6 and MNoV genome copies detected in 7dpi samples by RT-qPCR in stool (C) and tissues (D). (E, F) Adult mice on the indicated background, sourced from CR, were orally inoculated with CR6 and MNoV genome copies detected in 10dpi samples by RT-qPCR in stool (E) and tissues (F). Analyzed by Kruskal-Wallis test with Dunn’s multiple comparisons test (A, B), two-tailed t-test (C) two-tailed Mann-Whitney test (D-F) corrected with the Holm-Šídák method (D, F). (A) WUSTL (n = 15, 4 litters), CR (n = 16, 3 litters), JAX (n = 10, 2 litters), *p = 0.0427, **p = 0.0037. (B) C57Bl/6 (n = 10, 2 litters), BALB/c (n = 4, 2 litters), A/J (n = 10, 3 litters), NOD (n = 10, 3 litters), 129S1 (n = 9, 2 litters), PWK/PhJ (n = 6, 2 litters), **p = 0.0023 (C57BL/6 vs. A/J), **p = 0.0012 (C57BL/6 vs. 129S1), ***p = 0.0003. (C) C57Bl/6 (n = 16, 3 litters), BALB/c (n = 8, 2 litters). (D) C57Bl/6 (n = 12, 2 litters), BALB/c (n = 10, 2 litters). ***p = 0.0001. (E) N = 10 mice per group from 2 independent experiments, **p = 0.0015. (F) N = 4 mice per group from one experiment, p = 0.0563 (ileum), p = 0.0571 (colon). Dashed lines indicate limit of detection for assays. ns, not significant (p > 0.05).
Extended Data Fig. 2 Tuft cells and Cd300lf expression in early life.
(A) Representative images of tuft cells quantified by immunofluorescent staining of DCLK1 in naïve C57BL/6 mice (quantified data shown in Fig. 3C). (B) Cd300lf was quantified in intestinal samples from naïve C57BL/6 mice by RT-qPCR at the indicated timepoints. P6 (n = 6, 1 litter), P13 (n = 4, 2 litters), P21 (n = 4, 2 litters), adult (n = 7, 2 experiments), analyzed by Kruskal-Wallis test with Dunn’s multiple comparisons test. *p = 0.0183, **p = 0.0087. Dashed lines indicate limit of detection for assay. ns, not significant (p > 0.05).
Extended Data Fig. 3 Mouse but not human Fc-CD300LF blocks CR6 infection in vitro.
CR6 was incubated with Fc-fusion proteins with either the human or mouse CD300LF ectodomains for 1 hour at 37 C, prior to infection of BV2 cells at an MOI of 0.05. Cell viability was measured by CellTiter Glo 48 hours post-infection. 3 technical replicates from a single experiment.
Extended Data Fig. 4 CR6 induces ISG expression in the ileum.
Wild-type neonates were orally inoculated with CR6 at P6. Mx2 was quantified by RT-qPCR from ilea collected at 1 dpi (A) or 7 dpi (B) and compared to naïve neonates. (C) Ifit1 expression was quantified in the ileum and colon of CR6-inoculated neonates at 7dpi. (A) Naïve (n = 5, 1 litter), infected (n = 6, 3 litters), analyzed by Welch’s two-tailed t-test, *p = 0.0289. (B) Naïve (n = 5, 2 litters), infected (n = 13, 4 litters), analyzed by two-tailed t-test, **p = 0.0188. (C) N = 12 pups from 2 litters sourced from Charles River, analyzed by two-tailed Mann-Whitney test, ****p < 0.0001.
Extended Data Fig. 5 2-CMC blocks CR6 shedding in wild-type adult mice.
Wild-type adult mice were orally inoculated with CR6. 100 mg/kg 2-CMC or PBS were injected subcutaneously daily at 7-9dpi. Stool was collected from 7-11dpi (A) and tissues at 11dpi (B), and MNoV genome copies quantified by RT-qPCR. (A) PBS (n = 4), 2-CMC (n = 6), from two experiments. Analyzed by two-tailed Mann-Whitney test corrected with the Holm-Šídák method, *p = 0.0376 (9dpi, 10dpi), *p = 0.0236 (11dpi). (B) PBS (n = 2), 2-CMC (n = 4), from one experiment. Dashed lines indicate limit of detection for assays. ns, not significant.
Extended Data Fig. 6 CR6 replicates in the spleens of Stat1-/- neonates.
(A) Wild-type neonates (P6) were orally inoculated with CR6. Infectious virus from 1-2dpi stool was quantified by plaque assay on BV2 cells. n = 2 stools collected per time point. (B) Additional replicates of spleens from CR6-inoculated Stat1-/- neonates, stained as in Fig. 5J. (C) Spleen from a naïve neonate stained as in Fig. 5J. (D) 2’ only antibody control for spleen in Fig. 5J.
Extended Data Fig. 7 Evans blue dye is retained in the distal small intestine of neonatal mice.
(A) Adult mice were gavaged with 400ul Evans blue dye and stool collected at 4- and 24-hours post-gavage. (B) Neonates were gavaged at P6 with 50ul Evans blue dye and stool collected at 24- and 72-hours post-gavage. Stool was resuspended in PBS for assessment of blue colour. Representative of 3 adults from one experiment and 8 neonates from three litters. (C) Neonates were gavaged at P6 with 50ul Evans blue dye and treated with 0.5 mg/g cortisone acetate or vehicle. Intestines were collected at 7dpi post-gavage and assessed for blue colour across the length of the intestines. Representative of 3 cortisone acetate and 3 vehicle-treated neonates from two litters. (D-F) Ileal samples were collected from naïve mice at P6, P13, P21, and as adults (left) or at 7dpi (P13) from littermates inoculated with CR6 and treated subcutaneously with 0.5 mg/g cortisone acetate or vehicle at P6 (right). Naga (D), Prdm1 (E), and Sis (F) expression was quantified by RT-qPCR. P6 (n = 4,1. litter), P13 (n = 4, 2 litters), P21 (n = 3, 2 litters), adult (n = 3, 1 experiment), 7dpi cortisone acetate (n = 5, 2 litters), 7dpi vehicle (n = 5, 2 litters). Naïve time course analyzed by Welch’s ANOVA test with Dunnett’s T3 multiple comparisons test (D, E, time course), ANOVA with Dunnett’s multiple comparisons test (F, time course), two-tailed Mann-Whitney test (D, F, vehicle vs. cortisone acetate), or Welch’s two-tailed t-test (E, vehicle vs cortisone acetate). (D) *p = 0.0295 (P6 vs. P21), *p = 0.0298 (P6 vs. adult), **p = 0.0079 (vehicle vs. cortisone acetate). (E) *p = 0.0399 (P6 vs. P21), *p = 0.0245 (P6 vs. adult), ***p = 0.0003 (vehicle vs. cortisone acetate). (F) ****p < 0.0001 (P6 vs. P21, P6 vs. adult), **p = 0.0079 (vehicle vs. cortisone acetate). ns, not significant (p > 0.05).
Extended Data Fig. 8 CR6 uptake is localized to the distal small intestine.
Ilea stained for Epcam and CR6 RNA. All replicates collected are shown. (A) Additional replicates of distal small intestinal sections from neonates inoculated with CR6 at P6, collected at 4 or 8hpi. (B) Proximal small intestinal sections collected at 8hpi. (C) Distal small intestinal sections from naïve neonates. Scale bars are 100μm long.
Extended Data Fig. 9 Cortisone acetate treatment does not affect CR6 infection in adult mice.
Wild-type adult mice were orally inoculated with CR6 and treated subcutaneously with 0.5 mg/g cortisone acetate or vehicle. Stool (A) and tissue (B) virus levels were quantified by RT-qPCR at 7dpi. Vehicle (n = 5) and cortisone acetate (n = 5), from two independent experiments. Analyzed by Welch’s two-tailed t-test (A) and two-tailed Mann-Whitney test corrected with the Holm-Šídák method (B). Dashed lines indicate limit of detection for assays. ns, not significant.
Supplementary information
Source data
Source Data Fig. 1
Statistical source data.
Source Data Fig. 2
Statistical source data.
Source Data Fig. 3
Statistical source data.
Source Data Fig. 4
Statistical source data.
Source Data Fig. 5
Statistical source data.
Source Data Fig. 6
Statistical source data.
Source Data Extended Data Fig. 1
Statistical source data.
Source Data Extended Data Fig. 2
Statistical source data.
Source Data Extended Data Fig. 3
Statistical source data.
Source Data Extended Data Fig. 4
Statistical source data.
Source Data Extended Data Fig. 5
Statistical source data.
Source Data Extended Data Fig. 6
Statistical source data.
Source Data Extended Data Fig. 7
Statistical source data.
Source Data Extended Data Fig. 9
Statistical source data.
Rights and permissions
Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.
About this article
Cite this article
Kennedy, E.A., Aggarwal, S., Dhar, A. et al. Age-associated features of norovirus infection analysed in mice. Nat Microbiol 8, 1095–1107 (2023). https://doi.org/10.1038/s41564-023-01383-1
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/s41564-023-01383-1