Abstract
The F-box domain is a highly conserved structural motif that defines the largest class of ubiquitin ligases, Skp1/Cullin1/F-box protein (SCF) complexes. The only known function of the F-box motif is to form the protein interaction surface with Skp1. Here we show that the F-box domain can function as an environmental sensor. We demonstrate that the F-box domain of Met30 is a cadmium sensor that blocks the activity of the SCFMet30 ubiquitin ligase during cadmium stress. Several highly conserved cysteine residues within the Met30 F-box contribute to binding of cadmium with a KD of 8 µM. Binding induces a conformational change that allows for Met30 autoubiquitylation, which in turn leads to recruitment of the segregase Cdc48/p97/VCP followed by active SCFMet30 disassembly. The resulting inactivation of SCFMet30 protects cells from cadmium stress. Our results show that F-box domains participate in regulation of SCF ligases beyond formation of the Skp1 binding interface.
Similar content being viewed by others
Introduction
Cells must be able to accurately assess their environment for the availability of essential nutrients and potential threats. Thus, systems that detect the abundance of harmful substances are fundamental to protect the organism. The ubiquitin-proteasome system (UPS) is well known as a dynamic regulator of protein abundance as well as non-proteolytic signaling1,2,3,4,5. Therefore, it is not surprising that the UPS plays important roles in numerous biological pathways, including various cellular stress response programs6. Ubiquitin conjugation requires the E1-E2-E3 enzyme cascade in which the final step of substrate-specific ubiquitylation is carried out by the most diverse components in the system, the E3 ubiquitin ligases1. E3s can be classified in different subgroups of which the multi-subunit Cullin-RING complexes (CRLs) are the largest representative7,8. The CRL subfamily of SCF (Skp1-Cullin-F-box) ligases are composed of the RING finger protein Rbx1, the scaffold Cul1 (yeast Cdc53), and Skp1, which connects an array of substrate-specific F-box proteins to the core ligase9,10,11. The defining structural feature of SCF ubiquitin ligases is a short, highly conserved motif known as the F-box domain, which mediates the Skp1/F-box interaction12,13.
Typically, SCF ligase activity is regulated at the level of substrate binding9,14. However, signal-induced, subtype-selective SCF complex disassembly and modulation of the F-box/Skp1 interface by kinases has also been demonstrated as a novel mechanism of SCF regulation15,16,17,18,19,20. This mechanism is best characterized in the yeast SCFMet30 ubiquitin ligase. The two critical substrates of SCFMet30 are the transcriptional activator Met4 and the cell cycle inhibitor Met3215,21,22,23. Together they coordinate the initiation of a transcriptional response during nutritional or cadmium stress, which ensures cellular integrity, restoration of sulfur-containing metabolites, and the synthesis of glutathione for protection against cadmium17,18,21,24,25,26,27. Under normal growth conditions, both Met4 and Met32 are ubiquitylated by SCFMet30 with a lysine-48-linked chain. Even though this presents a classical destruction signal, only Met32 is directed to the 26S Proteasome. Met4 is kept in a stable but transcriptionally inactive state by ubiquitylation22,28,29. SCFMet30-dependent ubiquitylation of Met4 and Met32 are blocked during nutritional as well as cadmium stress. The mechanisms to control ligase activity are however profoundly different (Fig. 1A). During nutrient stress, the interaction between Met4 and SCFMet30 is prevented and substrate ubiquitylation cannot occur. Intriguingly, cadmium specifically leads to the dissociation of the F-box protein Met30 from Skp1, and thus the core ligase (cullin-Skp1), by triggering autoubiquitylation of Met3017,18. This ubiquitin chain serves as a recruitment signal for the AAA-ATPase Cdc48/p97 and its cofactor Shp1, which actively extract Met30 protein from the cullin-Skp1 complex15,30,31. Dissociated “Skp1-free” Met30 is then degraded by the non-canonical Cdc53/Rbx1 ligase via the proteasomal pathway32.
SCFMet30 is thus a hub that coordinates sulfur amino acid homeostasis and the cellular response to cadmium stress. How SCFMet30 senses cadmium or sulfur-containing metabolism is unknown. Here we show that the cadmium sensing element in SCFMet30 is the F-box domain itself. Multiple key cysteine residues in the F-box motif of Met30 enable selective cadmium binding, which triggers a cascade of downstream events to protect the organism during cadmium stress. Our results show that F-box domains can play a direct role in perceiving environmental cues and connecting them to cellular response pathways.
Results
Highly conserved cysteine-rich domains in Met30 as candidate cadmium sensors
The yeast ubiquitin ligase SCFMet30 coordinates a dedicated signaling pathway in response to the status of sulfur amino acid metabolism and cadmium stress (Fig. 1A). How SCFMet30 detects metabolites or cadmium is unknown. In order to define mechanisms of possible direct cadmium binding we focused on evolutionarily conserved cysteine-containing domains, as cysteine residues usually facilitate protein/metal interactions33. We identified two highly conserved cysteine-containing motifs (residues 95–99 and 236–239) that were good candidates for cadmium sensors (Supplementary Fig. 1A). Residues 95-99 proximal of the dimerization domain and residues 236–239 distal of the F-box motif were deleted individually at the genomic locus using a CRISPR/Cas9 approach, and cells were exposed to either methionine starvation or cadmium stress. Under normal growth conditions SCFMet30 ubiquitylates the transcriptional activator Met4 and therewith represses both the cadmium and methionine-starvation-related stress responses. Cadmium stress triggers the dissociation of Met30 from the Cul1-Skp1 complex, whereas low methionine levels lead to the separation of Me4 from SCFMet30 (Fig. 1A). Both events result in deubiquitylated and active Met4, leading to cell cycle arrest and the induction of the respective transcriptional response programs. Surprisingly, deletion of either domain completely blocked the response to methionine stress, while only modestly delaying the cadmium stress response (Supplementary Fig 1B). These results suggested that the cysteine rich conserved regions 95-99 and 236–239 are important for sensing the status of sulfur amino acid metabolism, but not cadmium stress. To confirm the latter, we evaluated cadmium-induced SCFMet30 disassembly in the ∆95–99 and ∆236–239 mutants. Met30 dissociation from the Cul1-Skp1 complex was unaffected by deletion of residues 95–99 or 236–239 (Fig. 1 B, C). To our surprise, these results exclude regions 95–99 and 236-239 as cadmium sensors, but instead suggest their role in sensing metabolic cues.
The above experiments excluded these conserved cysteine-rich regions as cadmium sensors, and we therefore initiated an unbiased approach by analyzing various truncation mutants of Met30. Neither deletions of the N-terminus (∆1–113), the dimerization domain (∆113-180), or the WD40-containing C-terminus (only aa 1-253 were expressed; Met301-253) blocked cadmium sensing as measured by dissociation of Met30 from Skp1 (Fig. 1 D, E, Supplementary Fig. 1C, D). Some truncation mutations showed delayed dissociation, but cadmium was still detected. We reasoned that the slower kinetics could be due to involvement of the relatively large deletions with steps downstream of cadmium sensing, such as Met30 autoubiquitylation, or recruitment of Cdc48 and/or recruitment of Shp115,30.
Highly conserved cysteine residues in the F-box are unique to Met30 family members
The truncation experiments likely excluded all but the F-box domain as the cadmium sensor in Met30. Intriguingly, an alignment of all characterized F-Box proteins in yeast revealed that Met30 contains the only F-box with high cysteine abundance (Fig. 2A). Furthermore, these cysteine residues are highly conserved throughout Met30 orthologs (Fig. 2B). All these observations suggested that the F-box domain in Met30 could function as a cadmium sensor. However, we could not employ the same strategy of analyzing Met30/Skp1 dissociation to define cadmium sensing capabilities of the F-box region, as the F-box is absolutely essential for the Met30/Skp1 interaction. We therefore exchanged the F-box motif of Met30 with those from the related F-box proteins Cdc4, Grr1, and Mfb1 and tested cadmium-induced dissociation of these hybrid Met30 proteins from Skp1. While the wild-type Met30 efficiently dissociated from Skp1 during cadmium stress, swapping F-box domains from either Cdc4, Grr1, or Mfb1 completely blocked dissociation (Fig. 2C). The non-native F-box domains from Cdc4 and Mfb1 mediated generally weaker binding to Skp1 than the native Met30 F-box, and the Grr1 F-box decreased overall Met30Grr1 stability, supporting that F-box domains are not simply interchangeable and evolved in the context of their surrounding sequences. Although the results obtained with these swapped in F-box domains are consistent with the idea of the Met30 F-box functioning as a cadmium sensor, the effects of non-native F-box domains on overall Met30 function complicated interpretation of results (Fig. 2C). Met30Mfb1 displayed the best compromise of protein stability and complex integrity (Supplementary Fig. 2). We therefore monitored disassembly kinetics in this hybrid mutant (Fig. 2D). This experiment further supported the model that the Met30 F-box is required to detect cadmium, because even after 60 min of cadmium exposure, SCFMet30 disassembly was not induced.
Cadmium sensing by the Met30 F-box domain is important to mediate the cadmium stress response
Although the F-box domain swap experiment is suggestive, to obtain more direct evidence for the role of the Met30 F-box domain in cadmium sensing we mutated the three conserved cysteine residues to serine by CRISPR/Cas9 mediated genome editing. However, when cysteine residues 201, 205, and 211 were simultaneously mutated to serine, the steady state interaction of Met30 with Skp1 was significantly decreased (Supplementary Fig. 3A). Notably, exposure to cadmium did not lead to further dissociation of Met30 from Skp1, but the compromised interaction of the serine mutants made it difficult to draw unambiguous conclusions. We therefore generated individual cysteine mutations. Consistent with these three F-box cysteines participating in cadmium sensing, the individual cysteine mutants were less effective in responding to cadmium stress because they maintained a significant fraction of Met4 in the ubiquitylated, repressed state after cadmium exposure (Fig. 3A). Furthermore, changing any of the three cysteine residues blocked cadmium-induced dissociation of Met30 from Skp1 in vivo, providing a rationale for continued Met4 ubiquitylation (Fig. 3B and Supplementary Fig. 3B). The suppression of cadmium-induced SCFMet30 disassembly by the individual cysteine mutations predicts that the Met4-controlled transcriptional stress response program is disrupted. Indeed, induction of the Met4-dependent genes MET25 and GSH1 was blunted (Fig. 3C). Importantly, expression of these genes was unaffected in response to metabolic stress signals indicating that all aspects of regulating the SCFMet30/Met4 system, except cadmium sensing, are fully functional (Fig. 3D).
Defects of SCFMet30 to detect or respond to cadmium stress result in blocked induction of a defense program mediated by Met4-dependent gene transcription. Most notably, induction of GSH1, which encodes the rate-limiting enzyme for glutathione synthesis, depends on Met415,17,18. Yeast cells lacking this response mechanism are hypersensitive to cadmium stress. Neither of the cysteine mutations resulted in a growth defect under normal growth conditions indicating that they are not required under non-stress conditions (Fig. 3E). However, mutation of these F-box cysteines rendered cells sensitive to cadmium exposure, further supporting their importance for the cadmium stress response (Fig. 3E and Supplementary Fig. 3C).
Our previous studies have demonstrated that when Cdc48/p97 activity is blocked during cadmium stress, Met30 is autoubiquitylated, but remains bound to Skp1, prone for extraction by the segregase15. Thus, mechanistically cadmium does not directly disrupt the Met30/Skp1 interaction, but rather induces Met30 autoubiquitylation, which in turn recruits Cdc48/p97 and its cofactor Shp1. Together they actively dissociate Met30 from Skp115,30. Disassembly of SCFMet30 was attenuated in all cysteine mutants, and we therefore analyzed upstream events that lead to Met30 extraction from the core SCF complex. All mutants that blocked dissociation showed decreased levels of Cdc48 recruitment during cadmium stress (Fig. 4A and Supplementary Fig. 3D, E). Segregase activity is required for complex dissociation and reduced Cdc48 recruitment can thus explain diminished Met30 dissociation. We next asked why Cdc48 recruitment was impaired in Met30 mutants during cadmium stress. Met30 autoubiquitylation is the recruitment signal for Cdc4815. All mutants show significantly decreased levels of autoubiquitylation compared to wild type (Fig. 4B and Supplementary Fig. 3F–H). Thus, lower levels of Cdc48 enrichment in the complex are likely caused by the autoubiquitylation defects in all mutants.
The role of cadmium is thus the induction of Met30 autoubiquitylation to initiate SCFMet30 disassembly. We hypothesized that cadmium induces a conformational change in Met30 to reposition it for autoubiquitylation. To probe for a potential cadmium-induced conformational change we analyzed SCFMet30 before and after cadmium exposure by cross-linking mass spectrometry. Cross-linking was achieved with disuccinimidyl sulfoxide (DSSO), a MS-cleavable, amine targeting chemical crosslinker, with two symmetric collision-induced dissociation-cleavable sites that allowed more effective identification of cross-linked peptides by mass spectrometry34. Consistent with our model, we observed a striking change in the spectrum of cross-linked peptides upon cadmium exposure, indicative of a conformational change (Fig. 4C, Supplementary Fig. 3I and Supplementary Data 1).
Cysteine 228 proximal to the F-box provides the fourth cadmium ligand
Most cadmium binding sites require four ligands35. Within the F-box motif there are no further candidates for a potential fourth binding site. However distal of the motif we found two highly conserved residues (H226 and C228) that might function as a fourth ligand. We used CRISPR/Cas9 editing to generate H226R and C228S point mutations. Since the H226R mutation was lethal in a wild-type background, a met32 knockout was used to prevent Met30-induced cell cycle arrest via Met32 stabilization36. The H226R mutant responded with dissociation of Met30 to cadmium stress excluding a role of H226 in cadmium sensing (Supplementary Fig. 4A). In contrast, in C228S mutant cells Met4 remained ubiquitylated and dissociation of Met30 from the core ligase was significantly attenuated (Fig. 4D, E, Supplementary Fig. 4B). Furthermore, induction of the Met4-dependent gene MET25 was significantly reduced upon cadmium exposure. Expression in response to methionine starvation was unaffected confirming the overall integrity of SCFMet30/Met4 activity (Fig. 4F). In addition, C228S cells exbibit cadmium hypersensitivity, further supporting a role for cysteine 228 as the fourth cadmium binding ligand (Supplementary Fig. 4C, D).
We next tested whether the cadmium-sensing cysteines may be prone to oxidation and oxidative stress can interfere with cadmium sensing. Note that exposing cells to oxidative stress does not trigger a response of the SCFMet30/Met4 system17. Cells were pre-exposed to H2O2 for 40 min to trigger oxidative stress followed by cadmium exposure. Both, cadmium-induced dissociation of Met30 and the downstream transcriptional response program were blocked by H2O2 priming (Supplementary Fig. 4E–G). We considered that H2O2 might induce glutathione production and prepare cells for cadmium stress. However, H2O2 concentrations used did not induce glutathione production as demonstrated by unchanged expression levels of the rate-limiting enzyme in the glutathione pathway, Gsh1 (Supplementary Fig. 4F). In addition, ∆gsh1 deletion cells remained unresponsive to cadmium stress when pre-exposed to H2O2 (Supplementary Fig. 4F, G). These results suggest that oxidative stress may change the oxidation state of one or more cadmium-sensing cysteines in Met30 and thereby block cadmium sensing. However, we cannot exclude that H2O2 priming induces antioxidant responses other than glutathione and decreases free cadmium levels.
The F-box motif in Met30 mediates specific binding to cadmium in vitro
To obtain more direct evidence for the role of the Met30 F-box domain in cadmium sensing, we measured the cadmium binding capability of Met30. To this end, we generated a Cd-NTA resin (Fig. 5A) and performed affinity chromatography with whole cell lysates (WCL) denatured in 8 M urea (Fig. 5). As demonstrated by Immobilized Metal Ion Affinity Chromatography (IMAC), metal binding protein domains can maintain binding specificity under fully denaturing conditions. We therefore initially used denaturing conditions to avoid indirect binding to Cd-NTA through Met30 binding partners. Met30 readily purified on Cd-NTA (Supplementary Fig. 5A), and binding was specific as the F-box protein Mfb1 did not bind to Cd-NTA (Fig. 5B). Consistent with intact cadmium sensing of truncation mutants that lack the N-terminus (∆1–113), the dimerization domain (∆113–180), or the WD40-containing C-terminus (Met301–253), these mutants bound to Cd-NTA with similar affinity as wild-type Met30 (Fig. 5C). The only common region in all these Met30 truncation mutants is the F-box domain further supporting location of the cadmium binding region in the F-box motif. We next compared Met30 binding to Cd-NTA in the absence and presence of the F-box motif. These experiments were done in the context of Met30 lacking the WD40 domain (Met301–253). This Met30 fragment showed full binding to cadmium (Fig. 5D). Met30∆F-box is very unstable in cells, but despite the low steady-state levels it was obvious that cadmium binding was abolished when the F-box was deleted (Fig. 5D and Supplementary Fig. 5B). We next changed all three conserved cysteine residues located in the F-box domain (201, 205 and 211) (Fig. 2A) to serine (“CS” in Fig. 4A and Supplementary Fig. 3A) and determined cadmium binding. The Met30CS mutant exhibited similar expression levels to wildtype Met30 but lost the ability to bind cadmium (Fig. 5D). Cysteines 201, 205, and 211 all contributed to cadmium binding because mutation of each individual F-box cysteine reduced binding to Cd-NTA (Supplementary Fig. 5C). Together these results strengthen out hypothesis that the F-box motif is the element in Met30 that mediates cadmium binding.
To further characterize cadmium binding capabilities of Met30 we performed a competition experiment by preincubating whole cell lysates with increasing amounts of CdCl2 before performing the Cd-NTA binding assay (Supplementary Fig. 5D). The titration of cadmium revealed decreased binding of Met30 with increasing cadmium concentration (Supplementary Fig. 5E). When we performed this competition Cd-NTA binding assay with lysates prepared from cells expressing the Met30CS mutant, no change of binding was observed, confirming specific requirement of these conserved cysteine residues in the F-box domain for cadmium binding (Fig. 5E). These competition experiments also excluded precipitation of Met30 upon addition of high cadmium concentrations as an experimental artifact that could be misinterpreted as binding to Cd-NTA.
Disassembly of SCFMet30 is only triggered by cadmium, but no other metals17. To ask if this specificity is reflected by selective Met30 metal binding, we performed the in vitro competition assay in the presence of metals other than cadmium. Whole-cell lysates of cells expressing Met301-253 were pretreated with cadmium, cobalt, or copper. Cobalt had no, and copper had a very modest effect on Met30 cadmium binding (Fig. 5F). However, pretreatment with cadmium potently attenuated binding. These results suggest that the F-box motif of Met30 confers specificity towards cadmium over other metals and explains the observed cadmium selectivity of the in vivo response17.
The Met30 F-box directly binds cadmium
Denaturing conditions were used to exclude indirect binding by protein complexes during the cadmium-NTA pull-down assay. However, we also wanted to address cadmium binding of Met30 and the effects of F-box motif deletion in native conditions. The previously introduced cadmium binding assay on cadmium-NTA beads focused on direct binding of F-box proteins and tried to exclude indirect effects through denaturing of protein complexes (Fig. 5). Non-specific background binding is a general problem with metal-chelate affinity chromatography under native conditions. Nevertheless, native binding experiments with the individual four cysteine ligand mutants (C201, C205, C211, and C228S) confirmed previous results obtained under denaturing conditions. All mutations significantly reduced recognition of cadmium by intact Met30-containing protein complexes (Fig. 6A).
To analyze cadmium binding of Met30 in native conditions independent of protein complexes formed in vivo, we purified recombinant Met30 from Escherichia coli (Supplementary Fig. 6A–C). Experiments were done in the context of recombinant MBP-Met301-253 fusions with and without the F-box motif. To confirm previous results obtained with Met30 purified from yeast we first analyzed recombinant purified proteins under denaturing conditions (Fig. 6B). Met30 containing the F-box motif (WT) readily purified on Cd-NTA, whereas binding was abolished in the absence of the F-box motif. Similarly, cadmium binding of recombinant Met30 in native conditions was observed with WT recombinant Met30, but binding was significantly reduced when the F-box was deleted. Identical results were obtained when the MBP fusion was removed excluding any effect of MBP (Fig. 6C). Finally, to obtain biophysical evidence of cadmium binding to recombinant, purified Met30 we performed isothermal calorimetry (ITC). ITC experiments were performed in the context of recombinant MBP-Met30180-253 (Supplementary Fig. 6D, E). This relatively small Met30 fragment maintained ability to interact with Skp1 indicating functional folding (Supplementary Fig. 6G). The titration confirmed the interaction between the F-box and cadmium and revealed 8 µM binding affinity for wildtype Met30. In contrast, both the F-box deletion and the cysteine to serine mutant of recombinant Met30 did not bind cadmium. Together these results provide strong evidence that the F-box motif is the element in Met30 that mediates cadmium binding (Fig. 6D and Supplementary Fig. 6F).
In summary, these results demonstrate that the conserved cysteines in the F-box of Met30 are necessary for cadmium binding and are part of the cadmium sensing mechanism that initiates SCFMet30 disassembly and activation of stress defense programs. Furthermore, these findings uncover potential functions for the F-box motif in addition to mediating protein-protein interactions with Skp1 (Fig. 7).
Discussion
SCF ubiquitin ligases play crucial roles in many biological processes throughout the eukaryotic kingdom. From cell cycle regulation, circadian rhythms, plant hormone sensing to regulation of stress response programs, SCFs are critical for cellular and organismal homeostasis. The defining element of SCF ubiquitin ligases is a highly conserved structural motif, the F-box domain, which guides the assembly of the vast array of different SCF complexes by mediating the F-box protein-Skp1 interactions. Here we demonstrate an additional function for the F-box motif of SCFMet30 as a sensor for environmental stress.
SCF ubiquitin ligases have been shown to monitor plant hormones37,38, metabolites39, and iron40, but always through dedicated domains well separated from the F-box motif. The F-box domain itself has not been linked to environmental sensing so far, and given the high degree of sequence conservation of F-box domains our results were unexpected. When we consider the vast number of F-box proteins (23 yeast, 69 human, and over 700 Arabidopsis), it is likely that other F-box domains have sensor functions as well. The human F-box protein ßTrCP is involved in various cellular processes such as cell cycle control and is the closest mammalian homolog of Met3020,41. However, the amino acid sequence of ßTrCP’s F-box motif does not show similarity to the conserved, cysteine-rich cluster of Met30. Interestingly, alignment of the human F-box motives shows that several contain three or more differentially spaced cysteine residues (Supplementary Fig. 7A), which could potentially function as metal sensors. In contrast, Met30 has the only F-box domain with a cysteine cluster in yeast (Fig. 2A). Met30 shows specific binding to cadmium in vitro (Fig. 5F) and only responds to cadmium and not other stressors in vivo17. While we did not observe significant binding of copper or cobalt to the Met30 F-box (Fig. 5F), similar competition/pulldown assay indicated binding of zinc (Supplementary Fig. 6H). These experiments suggest, that Met30 initially has a higher affinity towards zinc, that however plateaus (Supplementary Fig. 6H) and cannot completely compete with cadmium binding. These results suggest that zinc and cadmium share some binding residues, but binding sites are not identical. We next determined the dissociation constant for Zn binding to Met30 in ITC experiments as around 1 µM. The F-box motif was required for Zn binding (Supplementary Fig. 6I). However, when yeast cells were cultured with excess amounts of zinc the Met30/Skp1 interaction was unaffected, nor could zinc preincubation affect cadmium-induced dissociation of Met30 from the core ligase (Supplementary Fig. 6J). Of note is that intracellular concentrations of free Zn (Zn available for binding) are tightly controlled and in the picomolar/nanomolar range42, which may explain the lack of zinc-induced effects on SCFMet30 in vivo. An alternative hypothesis is that zinc is bound to the F-box region of Met30 under normal growth conditions. Once cadmium reaches a critical concentration, zinc is replaced by cadmium, which is accompanied by a conformational change.
The three-dimensional configuration of metal complexing cysteines and contributions from other residues are likely to determine selectivity towards specific metals, and it is thus tempting to speculate that F-box motifs with different cysteine arrangements could function in selective detection of a variety of metals. Conceptually F-box embedded sensors may function in a similar mode as the cadmium sensor in Met30, not by directly disrupting the F-box/Skp1 interaction, but by inducing a conformational change that repositions the F-box protein for autoubiquitylation, which then triggers Cdc48/p97 mediated extraction of the F-box protein15. Direct disruption of the F-box/Skp1 interaction by environmental toxins or metabolites is also feasible, but such mechanisms are perhaps more likely to prevent formation of interactions rather than directly inducing dissociation of the complex. The Cdc48/p97 catalyzed mechanism that was demonstrated for the cadmium stress response leads to a more rapid response as it can inactivate existing complexes15,30.
The selectivity of the SCFMet30/Met4 stress response for cadmium exposure is surprising but consistent with previous results17. Typically stress response pathways sense the stress and not the stressor, such as cadmium. For example, similar to most pathways sensing oxidative stress, cysteine oxidation of the ubiquitin ligase CRL3Keap1 triggers response pathways to most oxidative agents including cadmium and hydrogen peroxide43,44. SCFMet30 does not monitor oxidation and consequently is unresponsive to hydrogen peroxide17. Instead, SCFMet30 specifically detects stress induced by cadmium, by directly binding the stressor cadmium. Nevertheless, in many ways the CRL3Keap1/Nrf2 and SCFMet30/Met4 pathways have overlapping purpose. Both pathways respond to nutrient and oxidative stress, but SCFMet30/Met4 is selective for changes in sulfur amino acid metabolism and cadmium stress with dedicated stressor sensing mechanisms, whereas CRL3Keap1/Nrf2 triggers a general response to nutrient limitation and oxidative environments. Why such a specific cadmium sensing mechanism has developed is unclear, but it may have evolved from mechanisms that monitor abundance of other metals.
SCFMet30 forms the control hub for the response to methionine starvation and cadmium stress in yeast. Its most critical substrates are the transcriptional activator Met4 and the cell cycle inhibitor Met32, although other substrates have more recently been identified such as the centromeric histone H3 variant Cse445 and the autophagy protein Atg946. Met4 and Met32 coordinate a cell cycle checkpoint arrest with a transcriptional response program during nutritional or cadmium stress. Surprisingly, mechanisms that activate Met4 and Met32 in response to methionine limitation or cadmium stress are distinct (Fig. 1A). Exposure to cadmium triggers the autoubiquitylation of Met30, which initiates Cdc48/Shp1 mediated disassembly of SCFMet30 and thereby inactivation of all SCFMet30 functions15,30. Methionine stress blocks Met4 binding to SCFMet30 and thus only blocks ubiquitylation of substrates that depend on Met4 for recruitment to SCFMet30, such as Met32, but allows ubiquitylation of other substrates to continue (Fig. 1A). The diverse mechanisms of responding to methionine and cadmium stress are also reflected in clearly separated sensor mechanism, with the F-box domain serving as a dedicated cadmium sensor and two regions containing residues 95-99 and 236-239, respectively, responding to methionine stress. Why the cadmium stress response has evolved to block ubiquitylation of all SCFMet30 substrates is not clear. The histone H3 variant Cse4 is so far the only well-characterized substrate that is recruited to SCFMet30 independently of Met4, and thus selectively stabilized in cadmium but not methionine stress22,45. However, there may be several so far uncharacterized Met4-independent substrates, and once identified they may provide a rationale why and how the cadmium stress response is coordinated by the synchronized stabilization or activation of all these SCFMet30 substrates.
Alterations in SCF function have been linked to neurodegenerative diseases and several types of cancer47,48,49. Hence, SCF ubiquitin ligases are very attractive drug targets, but due to their similarity, inhibition of individual ligases is challenging. This study indicates that the F-box domain may present a promising avenue to target SCF subtypes to induce their disassembly in vivo. Indeed, the first subtype selective SCF inhibitor that was identified, the small molecular enhancer of rapamycin 3 (SMER3), may work through this mode of action. SMER3 is a selective inhibitor of SCFMet30 and induces dissociation of Met30 from the Cul1-Skp1 complex without affecting any other SCF complexes50. F-box protein dissociation is also observed in response to a SCFSkp2 inhibitor51, supporting this mode of action as a viable strategy for the development of subtype-selective SCF inhibitors.
In summary, our results demonstrate that the F-box domain has functions beyond forming the F-box protein-Skp1 interaction. Future experiments will show how common it is for F-box motifs to act as sensors for environmental or intracellular cues.
Methods
Plasmids, yeast strains, and growth conditions
Yeast strains used in this study are isogenic to 15DaubD, a bar1D ura3Dns, a derivative of BF264-15D52. Specific strains are listed in the Supplementary Information in Supplementary Table 1.
CRISPR vectors and guide RNAs
For CRISPR/Cas9 edited yeast strains the vector pML10753 which contains both sgRNA and Cas9 expression cassettes was used. To generate the guide RNA sequences the “CRISPR Toolset” (http://wyrickbioinfo2.smb.wsu.edu/crispr.html) was consulted. pML107 was linearized using SwaI and hybridized primers for gRNAs (see Supplementary Table 1) were inserted via Gibson assembly (GA) to generate pML107-Met30-guideRNA vectors. The vectors were transformed together with the hybridized 90mer oligos containing the Met30-specific repair sequence into PY1073, PY1314 or PY2231 respectively to generate marker-free 12xMYCMet30 or HBTHMet30 mutants.
Expression vector for recombinant Met30
PCR and GA or restriction digestion followed by ligation were used to generate pET28 MBP-TEV-Avi-Flag-Met30 1–253 (∆231–239) vectors. To add the Avi and Flag tag, Met30 was amplified from pYLEU_met30_12xMYC_Met30 wt with primers 310 & 311. Addgene Plasmid 69929 was used to amplify the expression vector backbone with primers 312 & 313. In this process, the C-terminal 6-His tag was deleted from the original construct. GA was used to generate pET28 MBP-TEV-Avi-Flag-Met30 1-253wt out of both PCR fragments. Met30∆FBX was amplified from pYLEU_met30_12xMYC_Met30 1–253 ∆FBX with primers 032 & 311. PCR fragment and pET28 MBP-TEV-Avi-Flag-Met30 1–253wt were digested using BamHI and NotI and ligation was used to generate pET28 MBP-TEV-Avi-Flag-Met30 1–253∆FBX. For better solubility in the native purification, aa 231–239 of Met30 were deleted from both constructs. For wt, pET28 MBP-TEV-Avi-Flag-Met30 1–253wt was amplified using primers 314 & 315. For ∆FBX, pET28 MBP-TEV-Avi-Flag-Met30 1–253∆FBX was amplified using primers 314 & 316. Gibson assembly was used to generate final vectors.
Generated plasmids and strains were verified by sequencing. All strains were cultured in standard media, and standard yeast genetic techniques were used unless stated otherwise54. References to the use of cadmium (Cd2+) are specifically to cadmium chloride (CdCl2). For cell spotting assays, strains were cultured to logarithmic growth phase, sonicated and then counted. Serial dilutions were made and spotted onto YEPD plates supplemented with or without indicated amounts of CdCl2 via a pin replicator (V&P Scientific, San Diego, CA).
Protein analysis
For Western blot analyses and immunoprecipitation assays, yeast whole cell lysates were prepared under native conditions in Triton X-100 buffer (50 mM HEPES, pH 7.5, 0.2% Triton X-100, 200 mM NaCl, 10% glycerol, 1 mM dithiothreitol, 10 mM Na-pyrophosphate, 5 mM EDTA, 5 mM EGTA, 50 mM NaF, 0.1 mM orthovanadate, 1 mM phenylmethylsulfonyl floride [PMSF], and 1 mg/ml each leupeptin, and pepstatin). Cells were homogenized in a screw-cap tube with 0.5 mm glass beads and Antifoam Y-30 using a MP FastPrep 24 (speed 4.0, 3 × 20 s). Lysates were separated from glass beads and transferred into 1.5 ml reaction tubes (USA Scientific). Lysates were cleared by centrifugation (10 min, 14,000 × g at 4 °C). For Western blot analyses proteins were separated by SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane. Proteins were detected with the following primary antibodies: anti-Met4 (1:20,000; a gift from M. Tyers), anti-Skp1 (1:5000; a gift from R. Deshaies), anti-Cdc48 (1:20000; a gift from E. Jarosch), anti-Myc (1:2000; Santa Cruz, 9E10), anti-HA (1:2000; Santa Cruz, F7) anti-RGS6H (1:2000; QIAGEN, Germantown, MD) anti-Tubulin (1:2000; Santa Cruz). Western blots results shown are representative blots from three experiments with independent cultures. Band intensities of immunoblots were quantified using either ImageJ or the Biorad Image Lab software. For immunoprecipitation of 12xMYC tagged proteins, 1 mg of total protein lysate was incubated in Triton X-100 buffer equilibrated MYC-trap beads (Chromotek) in a final volume of 500 µl overnight at 4 °C on a nutator. The next day beads and supernatants were separated by centrifugation (2 min, 100 × g at 4 °C). Beads were washed 3 times in 1 ml Triton X-100 buffer at 4 °C. Beads were resuspended in 2× Laemmli buffer and boiled for 5 min to elute proteins.
Cadmium-NTA assays: 1 ml of Nickel-NTA (Quiagen) was washed with 10 bead volumes (bv) H2O followed by a 10 min incubation in 10 bv 0.5 M NaCl at RT on a nutator. Beads were washed in 10 bv H2O and then incubated for 2 × 30 min in 50 mM EDTA at RT on a nutator. Beads were washed in 2 × 10 bv H2O and then incubated for 60 min in 100 mM CdCl2 at RT on a nutator. Beads were washed twice in 10 bv H2O and resuspended in 20% EtOH and stored at 4 °C.
Denaturing protein extracts were prepared with 8 M Urea buffer (8 M Urea, 150 mM NaCl, 50 mM Tris pH 7.4, 2% SDS, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl floride [PMSF], and 1 mg/ml each leupeptin, and pepstatin). Cells were homogenized in a screw-cap tube with 0.5 mm glass beads and Antifoam Y-30 using a MP FastPrep 24 (speed 4.0, 3 × 20 s). Lysates were separated from glass beads and transferred into 1.5 ml reaction tubes (USA Scientific). Lysates were cleared by centrifugation (10 min, 14,000 × g at RT). Five hundred micrograms of denatured protein extracts were incubated with 25 µl of Cd-NTA slurry. Depending on experimental set up, lysates were incubated for 90 min or overnight on a nutator at room temperature. Beads and supernatants were separated by centrifugation (2 min, 100 × g at RT). Beads were washed 3 times in 1 ml 8 M Urea buffer at RT. Beads were resuspended in 2× Laemmli buffer and boiled for 5 min to elute proteins.
For metal competition assays, native whole-cell lysates were prepared as described above. Five hundred micrograms lysate was incubated with the according concentration of metal for 30 min at 4 °C on a nutator. Denaturing buffer was added to a final concentration of 6.4 M Urea and reactions were incubated for 90 min on a nutator at room temperature. Beads were washed 3 times in 1 ml 8 M Urea buffer at RT. Beads were resuspended in 2× Laemmli buffer and boiled for 5 min to elute proteins.
Native Cd-NTA pulldown with recombinant Met30: Each plasmid (pET28-MBP-TEV-Avi-Flag-Met30 1–253 (∆231–239) wt or ∆FBX; see above) for protein expression in E. coli was transformed into Rosetta-BL21 (DE3) cells. Protein expression was induced with 0.15 mM IPTG for 16 h at 16 °C. Cells were harvested at 5000 rpm for 10 min and disrupted by sonication on ice in Triton X-100 buffer (50 mM HEPES, pH 7.5, 0.2% Triton X-100, 200 mM NaCl, 10% glycerol, 1 mM dithiothreitol, 0.1 mM orthovanadate, 1 mM phenylmethylsulfonyl floride [PMSF], and 1 mg/ml each leupeptin, and pepstatin). Lysates were cleared by centrifugation (20 min, 14,000 × g at 4 °C) and supernatants were incubated with amylose resin overnight at 4 °C on a nutator. The next day beads and supernatants were separated by centrifugation (2 min, 100 × g at 4 °C). Beads were washed 3 times in Triton X-100 buffer at 4 °C. Elution of recombinant proteins was performed in Triton X-100 buffer containing 20 mM Maltose for 20 min at RT. Purified proteins were digested with TEV for 1 h at 30 °C. Digested proteins were cleared by centrifugation (20 min, 14,000 × g at 4 °C) and supernatants were diluted in Ripa buffer (150 mM NaCl, 25 mM Tris-HCI [pH 7.4], 1% NP-40, 0.5 % DOC, 0.1% SDS and 1 mM dithiothreitol) and incubated with NTA or Cd-NTA slurry respectively for 90 min at 4 °C. Beads were washed twice with Ripa buffer for 5 min at RT on a nutator. Elution was performed in Ripa buffer containing 400 mM imidazole for 20 min at RT and 1000 rpm in a thermo-shaker. Eluted proteins were cleared by centrifugation for 20 min at 14,000 × g and supernatants were analyzed by Western blot and proteins were detected with HRP-Streptavidin antibodies.
Isothermal titration calorimetry
Each plasmid (pET28-MBP-TEV-Avi-Flag-Met30 180–253 (∆231–239) wt, C→S (201,205,211) or ∆FBX as well as pET28-MBP-TEV-Avi-Flag for protein expression in E. coli) was transformed into Rosetta-BL21 (DE3) cells. Protein expression was induced with 0.15 mM IPTG for 16 h at 16 °C in LB media. Cells were harvested at 5000 rpm for 10 min and disrupted by sonication on ice in Triton X-100 buffer (50 mM HEPES, pH 7.5, 0.2% Triton X-100, 200 mM NaCl, 10% glycerol, 1mM T-CEP, 1 mM phenylmethylsulfonyl floride [PMSF], and 1 mg/ml each leupeptin, and pepstatin). Lysates were cleared by centrifugation (30 min, 16,000 × g at 4 °C) and supernatants were incubated with amylose resin overnight at 4 °C on a nutator. The next day beads and supernatants were separated by centrifugation (2 min, 100 g at 4 °C). Beads were washed 3 times in Triton X-100 buffer at 4 °C. Elution of recombinant proteins was performed in 3 steps. First two elutions were each performed in 1 bv of Triton X-100 buffer (+1mM T-CEP) containing 20 mM Maltose for 20 min at RT. The third elution was performed in 1 bv Ripa buffer (25 mM Tris pH 7.4, 150 mM NaCl, 1% NP-40, 0.5% DOC, 0.1% SDS, and 1mM T-CEP) containing 40 mM Maltose for 30 min at RT. Proteins were dialyzed against 50 mM HEPES buffer, pH 7.4, containing 200 mM NaCl and 1mM T-CEP. After dialysis, proteins were diluted to a final concentration of 50 µM. CdCl2 was prepared at 500 µM in the same dialysis buffer as the corresponding proteins. ITC runs were performed at 25 C on a Malvern Micro-Cal PEAQ-ITC system starting with a single 0.4 µL injection of the cadmium solution into the chamber containing the protein solution, followed by twelve 2 µl injections, with 130 s spacing between each injection and continuous stirring at 750 rpm. To determine the baseline for each experiment, a titration of the cadmium solution into buffer was performed and subtracted accordingly. The obtained raw data was analyzed using software provided by the manufacturer to determine the apparent KD.
Native HBTHMet30 Purification for DSSO X-Linked MS
HBTHMet30 cells were cultured in YEP + 2% galactose + 4 µM Biotin at 30 °C and treated with 100 µM CdCl2 for 30 min. Native whole cells lysates were prepared in lysis buffer (50 mM Hepes pH7.5, 200 mM NaCl, 10% glycerol, 40 mM imidazole, 0.2% TritonX, 1 mM dithiothreitol, 0.1 mM orthovanadate, 1 mM phenylmethylsulfonyl floride [PMSF], and 1 mg/ml each leupeptin and pepstatin) and bound to Ni-resin. Proteins were eluted in the presence of 250 mM imidazole. For cross-linking analysis, eluted HBTHMet30 was first bound to Streptavidin beads and then on-bead cross-linked with 0.5 mM DSSO in PBS buffer for 1 h at 37 °C. Bead-bound proteins were reduced with TCEP and alkylated with iodocetamide and digested by trypsin prior to LC MSn analysis.
LC MSn analysis of cross-linked peptides were carried out using an UltiMate 3000 RSLC coupled to an Orbitrap Fusion Lumos mass spectrometer. Samples were loaded onto a 50 cm × 75 μm Acclaim PepMap C18 column and separated over a 102 min gradient of 4% to 25% acetonitrile at a flow rate of 300 nL/min. Ions were detected by Orbitrap in MS1 from m/z 375–1500 using a resolution of 120 K, AGC target of 4e5, and a maximum injection time of 50 ms. Precursor ions with charge of 4–8+ in the MS1 scan were selected for MS2 analysis and subjected to CID with NCE 23. The fragmentation of these ions was measured in the Orbitrap at 30 K resolution with AGC target of 5e4 and maximum injection time of 100 ms. Fragment ion pairs in each MS2 scan with mass difference corresponding to the difference of DSSO fragmentation moieties (31.9721 Da) were further selected and fragmented by CID with a normalized collision energy of 35% in MS3. The fragmentation ions of the precursors were detected by ion trap in Rapid mode with AGC target 2e4 for a maximum injection time of 150 ms.
Database searching and cross-linked peptide identification
MS3 spectra were extracted from RAW files using MSConvert (ProteoWizard 3.0.10738) and subjected to database searching using Batch-Tag within ProteinProspector (v.6.3.3) against a Saccharomyces cerevisiae database consisting of 20,240 entries concatenated with an equal number of decoy sequences. The mass tolerances were set as ±20 ppm for parent ions and 0.6 Da for fragment ions. Trypsin was set as the enzyme with three maximum missed cleavages allowed. Cysteine carbamidomethylation was selected as fixed modification, while a maximum of three variable modifications were also allowed, including methionine oxidation, N-terminal acetylation, and N-terminal conversion of glutamine to pyroglutamic acid. Three defined DSSO cross-linked modification on uncleaved lysines: alkene (C3H2O, +54 Da), thiol (C3H2SO, +86 Da) and sulfenic acid (C3H4O2S, +104 Da) were also selected as variable modifications. Search results were integrated via in-house software xl-Tools to identify cross-linked peptide pairs.
RNA and RT-qPCR: Yeast RNA was prepared using the RNeasy Plus Mini Kit (Quiagen) according to the manufacturers protocol. cDNA synthesis was performed using Super Sript II Reverse Transcriptase Kit (Invitrogen). 1.5 µg of RNA was transcribed into cDNA according to the manufacturers protocol. The synthesized cDNA was diluted 1:15 in nuclease-free water. qPCR was performed with a Biorad CFX Connect RT-PCR machine using the Biorad iTaq Universal SYBR Green SuperMix and 4 µl of the cDNA 1:15 dilution was used in a 20 µl reaction as a template. Primers were used at a final concentration of 0.2 µM. Sequences of primers are: MET25F: GCCACCACTTCTTATGTTTTCG, MET25R: AGCAGCAGCACCACCTTC, GSH1F: TGACAGCATCCATCAGGACCAG, GSH1R: GGAAGCCAGTTTCGCCTCTTTG, 18SrRNAF: GTGGTGCTAGCATTTGCTGGTTAT, 18SrRNAR: CGCTTACTAGGAATTCCTCGTTGAA. 18S rRNA was used as a normalization control for each sample. The ∆∆Ct method was used for analysis. Data are represented as mean ± SD.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Data availability
All data discussed are included within the paper, the provided supplementary information and source data files. Mass spectrometry data were deposited on ProteomeXchange under accession PXD048194. Source data are provided with this paper.
References
Hershko, A. & Ciechanover, A. The ubiquitin system. Annu. Rev. Biochem. 67, 425–479 (1998).
Finley, D., Ulrich, H. D., Sommer, T. & Kaiser, P. The ubiquitin-proteasome system of Saccharomyces cerevisiae. Genetics 192, 319–360 (2012).
Komander, D. & Rape, M. The ubiquitin code. Annu. Rev. Biochem. https://doi.org/10.1146/annurev-biochem-060310-170328. (2012).
Varshavsky, A. The ubiquitin system, an immense realm. Annu. Rev. Biochem. 81, 167–176 (2012).
Kerscher, O., Felberbaum, R. & Hochstrasser, M. Modification of proteins by ubiquitin and ubiquitin-like proteins. Annu. Rev. Cell Dev. Biol. 22, 159–180 (2006).
Finley, D., Özkaynak, E. & Varshavsky, A. The yeast polyubiquitin gene is essential for resistance to high temperatures, starvation, and other stresses. Cell 48 1035–1046 (1987).
Deshaies, R. J. & Joazeiro, C. A. P. Ring domain E3 Ubiquitin ligases. Annu. Rev. Biochem. https://doi.org/10.1146/annurev.biochem.78.101807.093809 (2009).
Duda, D. M. et al. Structural regulation of cullin-RING ubiquitin ligase complexes. Curr. Opin. Struct. Biol. 21, 257–264 (2011).
Petroski, M. D. & Deshaies, R. J. Function and regulation of cullin-RING ubiquitin ligases. Nat. Rev. Mol. Cell Biol. 6, 9–20 (2005).
Jin, J. et al. Systematic analysis and nomenclature of mammalian F-box proteins. Genes Dev. 18, 2573–2580 (2004).
Skaar, J. R., Pagan, J. K. & Pagano, M. Mechanisms and function of substrate recruitment by F-box proteins. Nat. Rev. Mol. Cell Biol. 14, 369–381 (2013).
Zheng, N. et al. Structure of the Cul1-Rbx1-Skp1-F boxSkp2 SCF ubiquitin ligase complex. Nature 416, 703–709 (2002).
Chang, B. et al. SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the F-box. Cell 86, 263–274 (1996).
Skowyra, D., Craig, K. L., Tyers, M., Elledge, S. J. & Harper, J. W. F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell 91, 209–219 (1997).
Yen, J. L. L. et al. Signal-induced disassembly of the SCF ubiquitin ligase complex by Cdc48/p97. Mol. Cell 48, 288–297 (2012).
Li, F. N. & Johnston, M. Grr1 of Saccharomyces cerevisiae is connected to the ubiquitin proteolysis machinery through Skp1: coupling glucose sensing to gene expression and the cell cycle. EMBO J. 16, 5629–5638 (1997).
Yen, J. L., Su, N. Y. & Kaiser, P. The yeast ubiquitin ligase SCFMet30 regulates heavy metal response. Mol. Biol. Cell 16, 1872–1882 (2005).
Barbey, R. et al. Inducible dissociation of SCF(Met30) ubiquitin ligase mediates a rapid transcriptional response to cadmium. EMBO J. 24, 521–532 (2005).
Choudhury, R. et al. The E3 ubiquitin ligase SCF(Cyclin F) transmits AKT signaling to the cell-cycle machinery. Cell Rep. 20, 3212–3222 (2017).
Paul, D. et al. Revealing β-TrCP activity dynamics in live cells with a genetically encoded biosensor. Nat. Commun. 13, 6364 (2022).
Kaiser, P., Su, N. Y., Yen, J. L., Ouni, I. & Flick, K. The yeast ubiquitin ligase SCFMet30: Connecting environmental and intracellular conditions to cell division. Cell Div. 1, 16 (2006).
Ouni, I., Flick, K. & Kaiser, P. A transcriptional activator is part of an SCF ubiquitin ligase to control degradation of its cofactors. Mol. Cell 40, 954–964 (2010).
Rouillon, A., Barbey, R., Patton, E. E., Tyers, M. & Thomas, D. Feedback-regulated degradation of the transcriptional activator Met4 is triggered by the SCF(Met30)complex. EMBO J. 19, 282–294 (2000).
Patton, E. E. SCFMet30-mediated control of the transcriptional activator Met4 is required for the G1-S transition. EMBO J. 19, 1613–1624 (2000).
Wheeler, G. L., Trotter, E. W., Dawes, I. W. & Grant, C. M. Coupling of the transcriptional regulation of glutathione biosynthesis to the availability of glutathione and methionine via the Met4 and Yap1 transcription factors. J. Biol. Chem. 278, 49920–49928 (2003).
Carrillo, E. et al. Characterizing the roles of Met31 and Met32 in coordinating Met4-activated transcription in the absence of Met30. Mol. Biol. Cell 23, 1928–1942 (2012).
Lee, T. A. et al. Dissection of combinatorial control by the Met4 transcriptional complex. Mol. Biol. Cell 21, 456–469 (2010).
Flick, K., Raasi, S., Zhang, H., Yen, J. L. & Kaiser, P. A ubiquitin-interacting motif protects polyubiquitinated Met4 from degradation by the 26S proteasome. Nat. Cell Biol. https://doi.org/10.1038/ncb1402 (2006).
Flick, K. et al. Proteolysis-independent regulation of the transcription factor Met4 by a single Lys 48-linked ubiquitin chain. Nat. Cell Biol. 6, 634–641 (2004).
Lauinger, L., Flick, K., Yen, J. L., Mathur, R. & Kaiser, P. Cdc48 cofactor Shp1 regulates signal-induced SCFMet30 disassembly. Proc. Natl Acad. Sci. USA 117, 21319–21327 (2020)
Lauinger, L., Flick, K. & Kaiser, P. Cdc48/Shp1 participates in dissociation of protein complexes to regulate their activity. Curr. Genet. 67, 263–265 (2021).
Mathur, R., Yen, J. L. & Kaiser, P. Skp1 independent function of Cdc53/Cul1 in F-box protein homeostasis. PLoS Genet. 11, 1–21 (2015).
Coyle, P., Philcox, J. C., Carey, L. C. & Rofe, A. M. Metallothionein: the multipurpose protein. Cell. Mol. Life Sci. 59, 627–647 (2002).
Kao, A. et al. Development of a novel cross-linking strategy for fast and accurate identification of cross-linked peptides of protein complexes. Mol. Cell Proteom. 10, M110 002212 (2011).
Dameron, C. T. & Harrison, M. D. Mechanisms for protection against copper toxicity. Am. J. Clin. Nutr. 67, 1091S-1097S (1998).
Flick, K. & Kaiser, P. Protein degradation and the stress response. Semin. Cell Dev. Biol. 23, 515–522 (2013).
Kepinski, S. & Leyser, O. The Arabidopsis F-box protein TIR1 is an auxin receptor. Nature 435, 446–451 (2005).
Dharmasiri, N., Dharmasiri, S. & Estelle, M. The F-box protein TIR1 is an auxin receptor. Nature 435, 441–445 (2005).
Busino, L. et al. SCFFbxl3 controls the oscillation of the circadian clock by directing the degradation of cryptochrome proteins. Science 316, 900–904 (2007).
Vashisht, A. A. et al. Control of iron homeostasis by an iron-regulated ubiquitin ligase. Science 326, 718–721 (2009).
Kaiser, P., Flick, K., Wittenberg, C. & Reed, S. I. Regulation of transcription by ubiquitination without proteolysis. Cell 102, 303–314 (2000).
Kambe, T., Tsuji, T., Hashimoto, A. & Itsumura, N. The physiological, biochemical, and molecular roles of zinc transporters in zinc homeostasis and metabolism. Physiol. Rev. 95, 749–784 (2015).
Dinkova-Kostova, A. T. et al. Direct evidence that sulfhydryl groups of Keap1 are the sensors regulating induction of phase 2 enzymes that protect against carcinogens and oxidants. Proc. Natl Acad. Sci. USA 99, 11908–11913 (2002).
He, X., Chen, M. G. & Ma, Q. Activation of Nrf2 in defense against cadmium-induced oxidative stress. Chem. Res. Toxicol. 21, 1375–1383 (2008).
Au, W.-C. et al. Skp, cullin, F-box (SCF)-Met30 and SCF-Cdc4-mediated proteolysis of CENP-A prevents mislocalization of CENP-A for chromosomal stability in budding yeast. PLoS Genet. 16, e1008597 (2020).
Feng, Y. et al. Downregulation of autophagy by Met30-mediated Atg9 ubiquitination. Proc. Natl Acad. Sci. USA 118, e2005539118 (2020).
Skaar, J. R., Pagan, J. K. & Pagano, M. SCF ubiquitin ligase-targeted therapies. Nat. Rev. Drug Discov 13, 889–903 (2014).
Schmidt, M. & Finley, D. Regulation of proteasome activity in health and disease. Biochim. Biophys. Acta Mol. Cell Res. 1843, 13–25 (2014).
Ciechanover, A. & Schwartz, A. L. Ubiquitin-mediated degradation of cellular proteins in health and disease. Hepatology 35, 3–6 (2002).
Aghajan, M. et al. Chemical genetics screen for enhancers of rapamycin identifies a specific inhibitor of an SCF family E3 ubiquitin ligase. Nat. Biotechnol. 28, 738–742 (2010).
Chan, C.-H. et al. Pharmacological inactivation of Skp2 SCF ubiquitin ligase restricts cancer stem cell traits and cancer progression. Cell 154, 556–68 (2013).
Reed, S. I., Hadwiger, J. A. & Lorincz, A. T. Protein kinase activity associated with the product of the yeast cell division cycle gene CDC28. Proc. Natl Acad. Sci. USA 82, 4055–4059 (1985).
Laughery, M. F. et al. New vectors for simple and streamlined CRISPR-Cas9 genome editing in Saccharomyces cerevisiae. Yeast 32, 711–720 (2015).
Guide to yeast genetics and molecular biology. Methods Enzymol. 194, 1–863 (1991).
Acknowledgements
We thank S. Jentsch, T. Rapoport, P. Silver, and R. Hampton for yeast strains; R. Deshaies, W. Harper, M. Tyers, T. Sommer, and E. Jarosch for antibodies. This work was supported by the National Institute of Health grant R35GM148350 to P.K. and the Hitachi-Nomura Award to L. L. NIH R35GM145249 to L.H. and NCI T32CA009054 to A.A.
Author information
Authors and Affiliations
Contributions
L.L., K.F. and P.K. designed research; L.L. performed most of the genetics and biochemical experiments with support from A.A. and G.D.; C.Y. ran, processed and analyzed MS data L.H. designed MS experiments and was consulted for MS data analysis. L.L. and P.K. analyzed the results; L.L. and P.K. wrote the manuscript and prepared the figures.
Corresponding authors
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Source data
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Lauinger, L., Andronicos, A., Flick, K. et al. Cadmium binding by the F-box domain induces p97-mediated SCF complex disassembly to activate stress response programs. Nat Commun 15, 3894 (2024). https://doi.org/10.1038/s41467-024-48184-6
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41467-024-48184-6
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.