Clinical NEC prevention practices drive different microbiome profiles and functional responses in the preterm intestine

Neumann, Charlotte J.; Mahnert, Alexander; Kumpitsch, Christina; Kiu, Raymond; Dalby, Matthew J.; Kujawska, Magdalena; Madl, Tobias; Kurath-Koller, Stefan; Urlesberger, Berndt; Resch, Bernhard; Hall, Lindsay J.; Moissl-Eichinger, Christine

doi:10.1038/s41467-023-36825-1

Download PDF

Article
Open access
Published: 11 March 2023

Clinical NEC prevention practices drive different microbiome profiles and functional responses in the preterm intestine

Nature Communications volume 14, Article number: 1349 (2023) Cite this article

5427 Accesses
2 Citations
63 Altmetric
Metrics details

Subjects

Abstract

Preterm infants with very low birthweight are at serious risk for necrotizing enterocolitis. To functionally analyse the principles of three successful preventive NEC regimens, we characterize fecal samples of 55 infants (<1500 g, n = 383, female = 22) longitudinally (two weeks) with respect to gut microbiome profiles (bacteria, archaea, fungi, viruses; targeted 16S rRNA gene sequencing and shotgun metagenomics), microbial function, virulence factors, antibiotic resistances and metabolic profiles, including human milk oligosaccharides (HMOs) and short-chain fatty acids (German Registry of Clinical Trials, No.: DRKS00009290). Regimens including probiotic Bifidobacterium longum subsp. infantis NCDO 2203 supplementation affect microbiome development globally, pointing toward the genomic potential to convert HMOs. Engraftment of NCDO 2203 is associated with a substantial reduction of microbiome-associated antibiotic resistance as compared to regimens using probiotic Lactobacillus rhamnosus LCR 35 or no supplementation. Crucially, the beneficial effects of Bifidobacterium longum subsp. infantis NCDO 2203 supplementation depends on simultaneous feeding with HMOs. We demonstrate that preventive regimens have the highest impact on development and maturation of the gastrointestinal microbiome, enabling the establishment of a resilient microbial ecosystem that reduces pathogenic threats in at-risk preterm infants.

A distinct Fusobacterium nucleatum clade dominates the colorectal cancer niche

Article Open access 20 March 2024

Blimp-1 and c-Maf regulate immune gene networks to protect against distinct pathways of pathobiont-induced colitis

Article Open access 12 April 2024

Interaction between microbiota and immunity in health and disease

Article Open access 20 May 2020

Introduction

About eleven percent of all infants worldwide are born prematurely, i.e., before 37 weeks’ gestation¹. Very low birth weight (VLBW) preterm infants (<1500 g) are particularly vulnerable to acute and long-term clinical complications. Of particular concern is the development of necrotizing enterocolitis (NEC), a serious gastrointestinal threat that occurs in 7–11% of VLBW infants². In such cases, mortality can reach up to 30%³.

NEC is a devastating multifactorial disease that is driven in part by perturbations of the microbiome, including colonization and overgrowth of certain microbes with potentially pathogenic potential such as Escherichia coli or Clostridium perfringens⁴.

Given the rapid onset of NEC, a number of neonatal intensive care units (NICUs) have developed specific NEC prophylaxis programmes that include the use of probiotics, antibiotics, and differentiated feeding protocols and that have resulted in a recent, substantial decrease in NEC rates in preterm infants⁵.

Probiotic treatments are usually based on the use of Bifidobacterium and Lactobacillus species⁶. Bifidobacterium, in particular, is considered as an important member of the resident infant microbiome that is maintained into early childhood and promotes healthy infant development^7,8.

Antibiotics are administered intravenously at the first signs of infection to control early-onset sepsis. As a result, the majority of VLBW infants are exposed to antibiotics in the first few days of life and for extended periods of time⁹. A number of publications have emphasized the need for responsible antibiotic usage in such vulnerable patients, as their use is associated with the risk of infection with multi-drug resistant (MDR) microorganisms¹⁰ and is believed to have other, largely unknown, long-term effects. Overall, antibiotic exposure is often considered as preventable^9,11.

Additionally, the use of enteral antibiotics may be effective as NEC prophylaxis. The findings of the Cochrane Neonatal Collaborative Review Group¹² suggest that oral administration of prophylactic enteral antibiotics results in a statistically significant reduction in NEC and in NEC-related deaths in low-birth-weight preterm infants. However, the risks of enteral antibiotics have not yet been quantified; thus, this strategy has never been widely adopted due to concerns about the emergence of resistant bacteria and the absorption of antibiotics from the gut¹³. However, such adverse effects have not been reported so far¹⁴.

Human milk (HM), the gold standard for infant feeding, is a surprisingly complex synbiotic that contains probiotic bacteria and prebiotics to nourish probiotic bacteria. Prebiotic human milk oligosaccharides (HMOs) are complex carbohydrates present in large quantities in HM that are not broken down by intestinal enzymes. Therefore, they serve only as a specific substrate for certain bacteria in the infant’s gastrointestinal tract (GIT), such as mainly Bifidobacterium (Bifidobacterium bifidum and Bifidobacterium longum subsp. infantis) but also Bacteroides (Bacteroides vulgatus and Bacteroides fragilis)^15,16. Indeed, Bifidobacterium is enriched in infants fed HM¹⁷, due to its ability to metabolize HMOs. The sophisticated, individual complexity of HM can only be partially mimicked by formula milk (FM); nevertheless, newer products also contain standardized pre- and probiotics for optimal nutrition.

Southern Austrian neonatal units have implemented various combinations of these prophylactic measures with great success, resulting in an exceptionally low average NEC rate of 2.9% in VLBW infants (2007–2016¹⁸).

In this work, we take the opportunity to deeply analyse the mechanism for success across these different regimens on the level of the gut microbiome and metabolome.

We recruited 55 VLBW infants in three closely neighboured hospital centers (Graz, Klagenfurt, Leoben), that differ in antibiotic treatment (enteral gentamicin or none), antifungal treatment (enteral nystatin or parenteral fluconazole), probiotic use (Lactobacillus rhamnosus LCR 35, Bifidobacterium longum subsp. infantis NCDO 2203 in combination with Lactobacillus acidophilus NCDO 1748, or none) and feeding (HM, FM). Using a multi-omics approach, we examine the composition and function of the microbiome and its metabolites in the first weeks of life to understand the importance of the interactions among dietary components, antibiotics and probiotics.

Our study differs from previous studies in that a focus is placed on different NEC-prevention protocols, not in just one but in three different clinics. This study setup also allowed us to avoid the problematic cross-contamination of probiotics into the control groups^19,20. To understand the effects and mechanisms of the different treatments, we analyse the microbiome on a multi-kingdom level and include functional metagenomics and metabolomics, as well as genome profiling on the species level. We conclude our study with a suggestion to further improve existing protocols to support a healthy microbiome development in VLBW infants by combining effective probiotics (including Bifidobacterium longum subsp. infantis NCDO 2203) and human milk.

Results

Details on the study design are provided within the Methods. In brief, fecal samples were collected prospectively in three independent NICUs in Austria using a different NEC prophylaxis regimen (Table 1, in Methods) from preterm infants with a birthweight <1500 g. Samples were collected every other day, starting with the meconium, up until two weeks of age. The study groups do not differ statistically significantly in any observed metadata except for the length of hospital stay of the mothers after birth²¹, Table 2 therein).

Table 1 Prophylactic regimens of probiotics, antibiotics, antifungals and feeding protocols of the three different neonatal intensive care units (NICUs): Graz (G), Klagenfurt (K), and Leoben (L)

Full size table

Table 2 Distribution of overall metagenomic reads across the domains of life and between the centers on different taxonomic levels

Full size table

It should be mentioned that the three clinical situations studied here differed in a number of confounding factors, both recorded and possibly unrecorded, and we can only draw conclusions based on the overall setting in each NICU, which includes medication and probiotic regimens. However, the three hospitals are geographically very close to each other, so the patient catchment area also overlaps, and we may consider other factors to be minor compared with the medication and feeding protocols. Indeed, PERMANOVA analyses revealed that the combined variables Bifidobacterium administration (yes/no), feeding protocol (formula milk, FM; human milk, HM; mixed), gentamycin administration (yes/no) had the same or even stronger effect (R² = 0.6763 (time point 7), R² = 0.3430 (tp3), R² = 0.2710 (all); p = 0.001 (all tests)), than the grouping according to the hospital (R² = 0.6763 (time point 7), R² = 0.2618 (time point 3), R² = 0.2623 (all); p = 0.001 (all tests)), indicating that the major observed differences were indeed driven by the regimens (Suppl. Table 1, amplicon dataset).

Early-life therapy regimen influences microbiome composition and development across all microbial domains

Assessing the microbial composition of all infants with metagenomic analyses and 16S rRNA gene sequencing, we detected an association of the preventive NEC regimen on all microbial domains and groups, including bacteria (99.62% of all metagenomic reads), their phages and viruses (0.15%), but also on archaea (0.04%) and fungi (Ascomycota/ Basidiomycota: 0.09%) (Table 2, Fig. 1, Fig. 2).

**Fig. 1: Overall distribution and abundances of microbial signatures of different domains, according to the different centers.**

**Fig. 2: Distribution of bacterial taxa between the centers and influence of probiotic species.**

The role or even presence of archaeal signatures in the premature infants’ gut is still unclear and underexplored. Previous publications concluded that infants generally do not carry a substantial amount of archaea until five years of age²², and especially in preterm infants, archaea were found only in a little proportion of screened infants^23,24. Our archaea-focused approach enabled us to successfully detect 290 different ASVs with amplicon-based analyses and 75 different archaeal species with metagenomic-based sequencing. In particular, Methanobrevibacter was abundant, as it was detected in all infants in at least one sample and across all time points. In addition to typical human-associated archaea, Methanobrevibacter, Methanosphaera, Methanomethylophilaceae (incl. Methanomassiliicoccus), and various Nitrososphaeria (likely derived from skin sources)^25,26 (Fig. 1a, amplicon data), abundant signatures of Methanosarcina and Methanocorpusculum were additionally identified using shotgun metagenomics (Fig. 1b, MGS data), indicating that even VLWB newborns are in contact with a wide diversity of archaea. Archaea reflected the center, with, for example, Methanocorpusculum and Methanospirillum being significantly more abundant in samples from Klagenfurt (K) (Methanocorpusculum,DESeq2, K:G q < 0.001, K:L q < 0.001), than in Graz (G) and Leoben (L) (Fig. 1c, MGS data).

The contribution of fungal signatures to the overall microbiome was largely limited (also probably due to the application of antifungals) to Basidiomycota and Ascomycota (Fig. 1d, e, MGS data), which, however, also revealed a center-specific pattern: Neosarorya, Penicillum, Aspergillus and Coprinopsis (significantly increased in G and L with DESeq2 q < 0.001) were antiparallel to Malassezia, Neurospora and Clavispora, which were increased in K.

In order to confirm the center-specific profiles of the multiple-component microbiome data (further details, see below), a network analysis was performed based on the ten most differentially abundant genera of bacteria, methanogens, ascomycota/basidiomycota and phages (Suppl. Fig. 2 MGS data). The network revealed the formation of two separate clusters, whose nodes were mainly composed of K taxa and taxa from G and L, respectively. Those two clusters were connected with negative associations only, underlining the separating effect of the different regimens (see also PERMANOVA results, mentioned above). Some taxa were even shared by both centers (e.g., Methanococcus, Candida), suggesting an interaction between the domains.

Supplemented Bifidobacterium longum subsp. infantis outweighs natural pathobiont colonizers and co-administered Lactobacillus acidophilus

The bacteriomes of the infants were mainly characterized by the predominance and differential abundance of six bacterial key taxa, namely Enterococcus, Bifidobacterium, Lactobacillus, Staphylococcus, Geobacillus and Escherichia (Fig. 2a, amplicon data, tp7).

Enterococcus was found to predominate the bacterial microbiome in G and L (~77%), followed by Lactobacillus and Staphylococcus, the relative abundance of which decreased with maturation. In contrast, the K samples were dominated by Bifidobacterium at each time point and reached a relative abundance of > 82% at tp7 (Fig. 2b, amplicon data). Thus, G and L were dominated by a typical colonizer of the GI in preterm infants, whereas K samples showed an overall predominance of a supplemented probiotic taxon. The phenomenon of detection of Geobacillus signatures exclusively in K samples has been discussed previously²¹ and in the next section.

Notably, 16 of all 89 phage species were strongly associated with bacterial key species, resulting in a center-specific, strongly differing phage profile (Fig. 1f, MGS data). No bacteriophages were identified for Bifidobacterium, Escherichia-Shigella and Geobacillus; however, other phages from key species correlated with the relative abundance of their host, exemplified by Streptococcus in Suppl. Fig. 3. In particular, phages targeting Lactobacillus (Kruskal-Wallis; G:K q = 0.004, G:L q = 0.003) and Enterococcus (Kruskal-Wallis; K:L q = 0.012) were lowest in K.

Shotgun metagenomics confirmed the significantly differential abundance of Bifidobacterium in the three centers that was already observed in the amplicon sequencing approach (DESeq2, K:G q < 0.001, K:L q < 0.001). Although B. longum subsp. infantis NCDO 2203 was the only Bifidobacterium administered in K, nine additional Bifidobacterium species were detected, with six species present in all K infants (B. longum, B. dentium, B. breve, B. bifidum, B. animalis, B. adolescentis). B. longum accounted for 95% of all reads from Bifidobacterium, and indeed this taxon was verified as Bifidobacterium longum subsp. infantis NCDO 2203 by genomic comparisons (see Material and Methods and Suppl. Table 3b). These analysis results support our assumption that the major Bifidobacterium signatures in K infants were indeed from the administered probiotic. Of note, the signatures of B. longum subsp. infantis are abbreviated as B. infantis in the following.

Naturally, bifidobacteria are uncommon in the premature infants’ GI in the first days of life and start colonizing naturally beginning from week four and on^6,27. Our data also indicate an absence of bifidobacteria in preterm infants who did not receive it via supplementation. Furthermore, administration of B. infantis NCDO 2203 resulted in very high abundances over other bacteria, including the co-administered L. acidophilus NCDO 1748: Although both probiotic species, B. infantis NCDO 2203 and L. acidophilus NCDO 1748, were administered in equal amounts in K, L. acidophilus NCDO 1748 was substantially lower in abundance than the predominant B. infantis NCDO 2203 (0.21% relative abundance of L. acidophilus NCDO 1748 at tp7 vs. 75.69% relative abundance of B. infantis NCDO 2203). We suggest, that the colonizing potential of B. infantis NCDO 2203 is higher than the one of L. acidophilus NCDO 1748 probably due to its different metabolic capacities. In agreement with our data, it was already shown before, that lactobacilli do not colonise the preterm gut in large numbers²⁸.

Probiotic administration of lactobacilli increases their natural abundance and diversity

In total, 27 species of the genus Lactobacillus (see details on classification issues in Methods), were detected by shotgun sequencing with different profiles between the centers (Fig. 2c). Probiotic lactobacilli were administered only in K (L. acidophilus NCDO 1748) and G (L. rhamnosus LCR 35). The presence of these lactobacilli in the infants’ intestinal samples was confirmed by amplicon sequencing but also by read-mapping (Fig. 2d, Suppl. Table 3a).

Lactobacillus rhamnosus was also detected with low relative abundance (3%) in L, where it was not administered, suggesting that this species is a low abundant part of the natural infant gut microbiome of preterm infants and is possibly transmitted through breastfeeding or other sources²⁹. In G, L. rhamnosus LCR 35 exhibited the highest abundance in G infants (21%) indicating a seven-fold increase in probiotic lactobacilli through its probiotic administration. K had the lowest absolute Lactobacillus abundance, with 56% of all Lactobacillus reads representing L. acidophilus NCDO 1748, the species administered there (K: 45,268 reads; G: 10,207; L: 12,431). Similar to L. rhamnosus, L. acidophilus was also detected in almost all infants in all centers, even when not supplemented as probiotics (Fig. 2d).

Although L. acidophilus NCDO 1748 was administered in K, it does not result in high abundances, compared to B. infantis NCDO 2203 administered at the same concentration. This is reflected by an L. acidophilus NCDO 1748 / B. infantis NCDO 2203 ratio of ~1:300 and Lactobacillus: Bifidobacterium ratio of ~1:200 (for genera see Suppl. Table 4).

PERMANOVA analyses confirmed the superior impact of Bifidobacterium (R² = 0.2084 (all samples), R² = 0.1258 (tp 3), R² = 0.5716 (tp7)) over Lactobacillus administration (R² = 0.04733 (all samples), R² = 0.0631, R² = 0.1394), explaining up to 57.16% and 13.94% of the observed variance, respectively (Suppl. Table 1). The dominance of Bifidobacterium over Lactobacillus could also be underlined with the BioEnv Biplot (Fig. 2e, amplicon data). This plot shows the metadata whose Euclidean distances have the maximum (rank) correlation with community dissimilarities. In particular, the administration of Bifidobacterium and gentamicin correlated strongly with dissimilarities between the centers, whereas the administration of lactobacilli and HM correlates to a lesser degree.

Key species are reflected by MAGs and active replication of probiotic species could be inferred

Samples from tp3 (days 5–8) and tp7 (days 13–21) allowed for deep metagenomic sequencing and genome binning. Metagenome assembled genomes (MAGs) were obtained for B. infantis NCDO 2203 (K), G. stearothermophilus (K), E. faecium (G, L), E. coli (K), L. rhamnosus (G), Veillonella parvula (G, inactive), Klebsiella oxytoca (G, inactive) and Escherichia flexneri (L, inactive). Successful binning of the bacterial genomes followed the scheme of probiotic supplementation, with B. infantis NCDO 2203 MAGs in K samples and L. rhamnosus LCR 35 MAGs in G samples. Of the L samples, only MAGs of Enterococcus faecium were obtained (Fig. 3a, MGS data). Application of iRep³⁰ suggested that MAGs might correspond to actively replicating bacteria (iRep values >1), and in consequence indicate niche colonization by probiotic (B. infantis NCDO 2203 and L. rhamnosus LCR 35) or naturally predominant bacteria (E. faecium) (Fig. 3a, MGS data).

**Fig. 3: Replication values for MAGs, distribution of potentially NEC causing microbes, and specific functions.**

Notably, high-quality G. stearothermophilus genomes with iRep values above 1.41 were isolated from four out of eight infant samples from K (tp7) (see also ref. ²¹). G. stearothermophilus is a frequent, most probably harmless contaminant in milk plants³¹, which probably transforms to an active form during formula milk preparation and is then ingested by the infant. Thermophilic G. stearothermophilus grows in the temperature range of 40–70 °C, with optimal growth rates achieved at 55–65 °C^32,33; thus, an active proliferation in the infant GI is unlikely. Staphylococcus MAGs could not be retrieved, despite its high abundance and identification as a key microorganism in this study (Fig. 3a).

Low level occurrence of diverse types of potentially pathogenic bacteria

Next, we searched specifically for signatures that had been associated with outbreaks or cases of NEC in previous reports²⁷. In our shotgun metagenomic dataset, we identified E. faecalis as having the highest abundance in this dataset, while S. epidermidis, E. coli and others were found in varying amounts in samples from tp7 (Fig. 3b). While the infants from the other centers showed a more or less homogenous presence of potential NEC-causing microorganisms, the hits in K samples concentrated solely on two infants, K16 and K18 (Fig. 3b). Reads of E. faecalis derived mainly from K18, whereas a high number of E. coli signatures originated almost exclusively from K16, the only infant in this subset that developed NEC later on. Furthermore, a MAG of probably active E. coli could be obtained from this infant at tp7 (i.e., 14 days after birth), suggesting the possible initial bloom of E. coli already at this early time point before NEC is usually diagnosed. As E. coli MAGs were not retrieved from any other sample, our data support the potential for microbiome analyses to be used for NEC monitoring and diagnosis (Fig. 3a).

Functional profiles possibly mirror earlier gut maturity in infants following regiments with B. infantis

We also profiled microbiome functional characteristics at tp7 given the sufficient sequencing coverage obtained at this time point (Fig. 3c, MGS data). K samples showed an overall significantly reduced level of genes involved in osmotic stress, acid stress and respiration (DESeq2, osmotic stress, K:G q < 0.001, K:L q < 0.001; acid stress; K:G q = 0.033, K:L q = 0.029; respiration; K:G q = 0.007, K:L q = 0.014). Additionally, the GI microbiome in K was capable to degrade more complex sugars reflected by the increased relative abundance of genes involved in polysaccharide metabolism, which was also confirmed by metabolomics (Fig. 3d; see also below). Summing up those points, it seems as if already rather anaerobic and more complex metabolism takes place in K than in G and L. In general, complex metabolism and anoxic environment are characteristics of a more mature gut microbiome.

Notably, the number of genes related to transposable elements (involved in the distribution of pathogenic genomic features), were significantly higher in K samples (Kruskal-Wallis, K:G q < 0.001, K:L q < 0.001), suggesting a potentially higher bacterial pathogenesis signature in these infants.

Next, we performed NMR-based metabolomics on 111 samples from tp1, tp3 and tp7 to determine the concentration of short-chain fatty acids (SCFAs) and complex sugars in the infants’ stool samples. We found a general increase in acetic acid, formic acid, valeric acid and butyric acid over time in all centers, regardless of the microbiome composition or probiotic supplementation (Suppl. Fig. 4a–d). However, unlike previous reports, we observed an unexpected spike in propionic acid at tp3 in all centers (Suppl. Fig. 4e)³⁴. We hypothesize that this spike in propionic acid is related to a delayed uptake of propionate by the intestinal epithelium during maturation.

Human milk supports Bifidobacterium by associated HMO conversion which is impaired by formula milk feeding

Genes involved in carbohydrate metabolism were the most abundant functional features in our shotgun metagenomic dataset. Notably, the samples from K had a significantly lower proportion than the other centers (Kruskal-Wallis, K:G q = 0.005, K:L q = 0,026). Upon further examination, particularly genes involved in the metabolism of monosaccharides were significantly lower in K than in L (Kruskal-Wallis, q < 0.001) (Fig. 4a). The significantly lower availability of monosaccharides in K was confirmed by a representative, metabolomic-based quantitative assessment of glucose and fructose. However, an overall increase of both compounds was observed in all centers over time (Suppl. Fig 4f, g). Similarly, genes involved in metabolism of di- and oligosaccharides were reduced in K samples, but not significantly (Fig. 4a). In contrast, the gene proportion involved in polysaccharide metabolism was found to be significantly increased in K samples (Kuskal–Wallis-test, K:G q < 0.001, K:L q < 0.001) (Fig. 4a), indicating a higher genetic potential for the metabolism of complex sugars in K.

**Fig. 4: Distribution patterns of sugars and HMOs.**

To answer the question regarding the genetic potential for complex HMO degradation, we searched for HMO gene clusters in the obtained MAGs and contigs. Indeed, the potential for HMO metabolism was notably higher in samples from K (Fig. 5d). The total hits with HMO gene clusters were G: 45, K: 307, L: 0, indicating a seven-fold higher numbers of HMO genes in K than in G. Moreover, only one MAG from G17 possessed the potential to convert and digest HMOs, in contrast to all infants from K with at least one MAG (Fig. 5d).

**Fig. 5: Results of taxonomic correlation analyses and distribution patterns of metabolites, antibiotic resistances and virulence factors.**

Using metabolomics, we assessed HMOs in the preterm stool samples. A total of 13 HMOs were detected measuring 111 stool samples at tp1, tp3 and tp7 (Fig. 4b). For most fucosylated HMOs (2′-fucosyllactose [2′FL], 3′fucosyllactose [3′FL], lacto-N-ducopentaoise I [LNFP1], lacto-N-fucopentaose III [LNFP3], lacto-N-difuco-hexaose [LNDFH], lactodifucotetraose [LDFT]) as well as LS-tetrasaccharide a [LSTa] and lacto-N-tetraose [LNT], at time point 7, a significantly decreased amount for K samples was detected as compared to G and L (Kruskal-Wallis; 2′FL, K:G q = 0.091, K:L q = 0.033; 3′FL, K:G q = 0.062, K:L q = 0.020; LDFP3, K:G q = 0.003, K:L q = 0.009; LNDFH, K:G q = 0.059, K:L q = 0.003; LDFT, K:G q = 0.091, K:L q = 0.003; LSTa, K:G q = 0.003, K:L q = 0.003; LSTb, K:G q = 0.062, K:L q = 0.020) (Fig. 4ci). For syalisated HMOs (such as 3′-sialyllactose [3′SL], 6′-sialyllactose [6′SL], LS-tetrasaccharide b [LSTb], LS-tetrasaccharide c [LSTc], but also lacto-N-neotetraose [LNnT]), few differences between centers or time points were observed (Fig. 4cii).

We conclude that the K microbiomes have the largest potential to degrade HMOs effectively; however, this process is impaired by the lowered availability of HMOs by preferred formula feeding.

Regimens and their key taxa correlate with crucial metabolites, antibiotic resistance genes, and virulence factors

We were interested in the correlations among the six microbial key players with HMOs, carbohydrates, amino acids and short-chain fatty acids, as measured using metabolomics (Fig. 5a) (additional metabolites are shown in Suppl. Fig. 5). Bifidobacterium (K) showed positive correlations with several carbohydrates (galactose and fructose), and weaker ones, with certain amino acids and short-chain fatty acids. It appears under HMO-depleted conditions, Bifidobacterium uses galactose and fructose as alternative substrates for its carbohydrate metabolism, producing formate and acetate. In the absence of Bifidobacterium (G and L), the role of formate and acetate production is taken over by Enterococcus, indicating its importance for early SCFA production, probably from citrate or pyruvate³⁵. Staphylococcus showed an inconsistent pattern across the centers, supporting our hypothesis that this microorganism played a smaller role for the preterm GIT. The metabolic pattern of Lactobacillus (G, K) could not be clearly resolved, as lactate was not included in the metabolomic approach.

The antibiotic gentamicin (used in G and L; Table 1) has a broad spectrum of activity including: Enterobacter, Escherichia, Proteus, Klebsiella, Pseudomonas, Serratia and Staphylococcus³⁶. Surprisingly, the influence of gentamicin on these genera was not evident in the preterm microbiome samples, and only limited perturbations were observed. However, it should be noted that, in this study, gentamicin was administered enterally and not intravenously, which may result in an altered mode of action. Acquired resistance to the gentamicin administered was rarely detected.

Overall, clear differences were observed in the antibiotic resistance (AMR) profiles between the key genera (Fig. 5b) and centers (Fig. 5c). AMR potential of the MAGs was substantially reduced in K samples as compared to samples from G and L (G: 93 hits, K: 35 hits, L: 123 hits), once again highlighting the influence of Bifidobacterium on microbiome composition and function. Of the AMR signatures detected, most were positively correlated with the potential NEC/sepsis pathogens Enterococcus, Staphylococcus and Escherichia, including resistance against β-lactams and erythromycin (Fig. 5b). In contrast, AMR profiles were highly limited in the probiotic genera Bifidobacterium and Lactobacillus, underscoring the safety of probiotic administration. Geobacillus was also found to not encode AMR genes; therefore, it did not appear to pose an increased health risk.

The virulence factor analysis results show that K infants had fewer pathogenic factors in their microbiomes than G and L infants (G: 64 hits, K: 193 hits, L: 173 hits) (Fig. 5d). Enrichment in E. coli-associated virulence traits was also observed in two infants in K and L (K16 and L18). Only six out of 431 hits were observed for Staphylococcus in six infants. We can assume that Staphylococcus is a key player in the context of its abundance, but not in the context of either replication or virulence factors. As expected, no virulence factors were found for the other key players, including Bifidobacterium, Lactobacillus, and Geobacillus.

Discussion

NEC prophylaxis and therapy have become a central aspect in the clinical management of VLBW preterm infants. Although probiotics, human milk, and antibiotics are used by many NICUs to prevent NEC, to our knowledge, an in-depth, systematic comparison of different preventive regimens had not yet been performed. In this study, we show that NEC prophylaxis not only impacts the bacterial gut microbiome composition and function strongly, but also drives strong center-specific patterns observed in the fungal, archaeal and viral parts of the microbiome. This is particularly important with respect to archaea and phages/viruses, as NEC prophylaxes are not directly administered to change this part of the microbiome.

Our iRep analyses and the steady increase in relative abundance (Fig. 2b) suggest that B. infantis NCDO 2203 might be actively replicating and thus colonizing the GIT during the administration period. This could be supported by the presence of HMO gene clusters and low levels of HMOs in the stool. Nevertheless, iRep is no sufficient approach to conclude on colonization potential. Although Bifidobacterium does not yet appear to naturally colonize the GIT of preterm infants in large numbers, the reliable health benefits of supplemented Bifidobacterium have been demonstrated in multiple ways³⁷, including the negative correlation between Bifidobacterium and opportunistic pathogens³⁸.

Unlike bifidobacteria, a variety of lactobacilli, including L. acidophilus NCDO 1748 (administered in center K) and especially L. rhamnosus LCR 35 (administered in G), have been observed as natural colonizers of the GIT of preterm infants. In this study, we consider human milk (HM) to be the most likely source, as HM naturally contains large amounts of live lactobacilli³⁹. For example, L. rhamnosus was successfully isolated from 8.13% of all human milk samples examined by Lubiech et al.²⁹ and was also detected in culture-independent assays alongside other, more frequently occurring Lactobacillus species (L. salivarius, L. fermenting, L. gasseri^17,29,40). It should be noted, however, that the HM was pasteurized, especially if it came from a milk bank, and pasteurization may obviously reduce the chance that live lactobacilli are transmitted. As all except one infant in the metagenomic subset were born via C-section and not vaginally, vertical transfer from the maternal vaginal microbiome is untenable in this case.

The dynamics of naturally occurring and supplemented (non-natural) probiotic strains are interesting to study, as supplemented bacteria have to “invade” an ecosystem that is evolving to provide colonization resistance against other, potentially pathogenic bacteria. To avoid disrupting this process, and also considering that naturally occurring bacterial residents are likely to persist over a longer period of time⁴¹, an ecologically oriented probiotic choice would tend to include supplementation with L. rhamnosus LCR 35 or another beneficial preterm Lactobacillus strain.

However, we and others observed that the co-administration of B. infantis and L. acidophilus in equal amounts results in the overgrowth and predominance of B. infantis over L. acidophilus^6,42. The absence of replicating Lactobacillus MAGs in the presence of replicating Bifidobacterium MAGs leads us to hypothesize that L. acidophilus NCDO 1748 cannot successfully colonize the GIT of preterm infants when B. infantis NCDO 2203 is co-administered. On the other hand, it may be that Lactobacillus plays a pioneering role in anaerobic bifidobacterial colonization by removing oxygen from the GIT⁴³. This supporting role of Lactobacillus tends to underscore the benefits of taking a multispecies probiotic approach.

Most importantly, administration of L. rhamnosus LCR 35 alone had no appreciable effect on the composition or function of the gut microbiome and did not result in a substantial increase in Lactobacillus colonization as seen before⁴⁴. Potentially pathogenic bacteria and antibiotic resistance genes were also not substantially reduced when L. rhamnosus LCR 35 was administered alone.

We argue that the GIT of VLBW infants per se is not a “normal” natural habitat, and the action of Lactobacillus may be too mild or too slow to rapidly support the establishment of a healthy microbiome. In contrast, B. infantis NCDO 2203, although not naturally occurring, seems to be a strong, stable, and reliable keystone microbe of the nearly empty niche of the preterm GIT, overgrowing pathogenic threats, and microorganisms carrying antibiotic resistance genes.

Moreover, Bifidobacterium together with Bacteroides has been described as an effective converter of HMOs^16,45, producing substantial amounts of beneficial SCFAs⁴⁶. The efficient conversion of HMOs and thus SCFA production is an extremely important process for premature infants, which is underscored by the finding that concentrations of HMOs in HM are substantially increased when the infant is born prematurely^29,47. In fact, the bifidobacteria found in the faeces of K infants exhibited a marked genetic ability to convert HMOs. This could be related to changes in the GIT environment such as lower pH or improved colonization resistance.

This capacity, however, could not be observed in our metabolomic analyses because the K infants were fed with (HMO-lacking) FM. In contrast, in centers L and G, where HMOs were administered in the natural form of HM, the small natural proportion of microbial HMO converters was too low for observable efficient turnover. Consequently, only the simultaneous administration of HMOs and HMO-converters would result in optimal utilization of the health benefits for the infants. This highlights the importance of combining the right probiotic with the right diet.

Furthermore, clinically relevant findings from our study are related to enteral antibiotic administration, as gentamicin was administered in two NICUs, G and L. Indeed, the prophylactic enteral, but not parenteral, administration of antibiotics has been shown to substantially decrease NEC rates^12,48, which is also reflected in the low number of NEC cases observed in center G¹⁴. To date, no single causative microbial agent of NEC has been described; thus, the antibiotics used, such as gentamicin, must cover a broad spectrum. Our study was not designed to investigate the performance and efficiency of gentamicin in eliminating specific bacteria. However, we did not find consistent negative correlations between gentamicin administration with certain taxa or the occurrence of gentamicin resistances in the microbiome at tp7. Nevertheless, we cannot rule out a negative effect on concomitantly administered probiotic bacteria.

In several studies, intravenous antibiotic administration at a young age has been associated with adverse health outcomes later in life^49,50,51. It is also proposed that antibiotic prophylaxis does not reduce NEC incidences but may rather increase the risk for high-risk premature infants of NEC⁵. Nevertheless, in these studies, antibiotics were administered enteral, not intravenously, which needs to be evaluated strictly differently. Still, the prophylactic use of antibiotics must always be weighed against the potential risk. On the one hand, prophylactic administration of antibiotics probably minimizes the outbreak of pathogenic bacteria, especially since infections in premature infants develop alarmingly rapidly, and the success of treatment is time critical. On the other hand, antibiotics could also suppress the growth of beneficial (probiotic) bacteria, which is also underlined by our study results showing that probiotic Lactobacillus and Bifidobacterium carry few AMR genes and are therefore more susceptible for antibiotics. The long-term effects of antibiotic administration at such an early, vulnerable age are difficult to predict. In general, AMR is a global threat⁵² and their horizontal gene transfer to pathogenic bacteria might also be implicated in NEC.

Our study has several strengths and limitations. Overall, due to the extensive analysis performed, the study cohort was kept rather small, and the survey period was limited to the first weeks of life. Unfortunately, the early (meconium) samples could not be used for metagenomic analyses because of their exceptionally low microbial biomass, so we had to focus on tp7 for detailed functional assessments. We could not draw any conclusions about the colonization potential of the probiotically administered strains, as iRep is no sufficient tool to prove replication or colonization. Due to the study design, we cannot discern which factor (antibiotics, probiotics, nutrition) is driving which result, as more than one of those factors changes between the centers. However, we successfully and comprehensively conducted a multicenter study in which we analysed the longitudinal composition of the microbiome of 55 VLBW preterm infants using amplicon-based and metagenomic sequencing, which also enabled us to elucidate the contribution of archaea, fungi, and phages. A large wealth of taxonomic and functional data were obtained, and analyses revealed the HMO conversion potential and the emergence of antibiotic resistance. In addition, genetically detected functions could be effectively combined with well-found metabolomic analyses.

Our study provides a solid basis for further evaluation and analyses. We found that the combination of feeding HM and administering B. infantis NCDO 2203 during the first weeks of life in VLBW infants could be a promising synergistic approach. Overall, all treatment regimens analysed in this study resulted in NEC rates well below the global average, confirming the very successful and strategic management of this devastating disease in our NICUs.

Methods

Study design

We conducted a prospective, triple-center cohort pilot study investigating the gut microbiome of preterm infants with a birthweight <1500 g in three Austrian neonatal intensive care units (NICUs). These centers (Klagenfurt, K; Leoben, L; Graz, G) used different regimens for NEC prophylaxis which are summarized in Table 1 and have been described in detail previously^53,21. A detailed description of the study design is available in⁵³ and first results have already been published elsewhere²¹.

In G, prophylaxis consisted of administration of probiotic Lactobacillus rhamnosus LCR 35 twice a day, nystatin, and enteral gentamicin. Probiotic bacterial species were also administered in K, namely Bifidobacterium longum subsp. infantis NCDO 2203 and Lactobacillus acidophilus NCDO 1748 in combination with fluconazole. In center L, no probiotic species, but enteral gentamicin and nystatin were used. Next to medication and probiotic supplementation, the feeding regimen also differed between the centers. In G and L, mainly human milk (HM) was provided. In K, enteral nutrition consisted mainly of formula milk (FM). The feeding history for each infant and time point is shown in Suppl. Fig. 1.

Between October 2015 and March 2017, stool samples were collected from preterm infants at those three centers. Inclusion criteria were birth weight <1500 g and survival in the first three weeks of life. Clinical data on the infants have been published recently²¹, with no significant differences between the centers (APGAR, sex, gestational age, gestational weight), except length of hospital stay (G: 72, K: 68.5, L:58; p = 0.04). In case of genetic diseases, syndromes or congenital anomalies or meconium ileus, infants were excluded from the study. A total of 55 infants were included in the study (male = 33, female = 22; age 0–3 weeks). The infants’ stool samples were collected every other day from meconium for the first two weeks of life, with each infant providing stool samples at seven time points (time points of samples were slightly variable (see Suppl. Table 2) due to the varying availability of fecal samples; average sampling time points were tp1: within day 1-3; tp2: day 4; tp3: day 6; tp4: day 8; tp5: day 10; tp6: day 12; tp7: day 15). A total of 383 samples and 16 negative controls were collected.

The diagnostic criteria for NEC definition were the same in all three centers and followed the AWMF guideline with Bell criteria with modifications of Walsh. NEC incidence rates are 2.2% in K, 2.7% in G, and 4.6% in L²¹. The study is registered wtihin German Registry of Clinical Trials No.: DRKS00009290 and received ethical approval from the local ethic committees (number 27-366 ex14/15) and written informed consent was obtained from the parents of the infants and participants were not compensated.

Sample processing

DNA extraction, sequencing, and metabolomics

Samples were processed as described in detail earlier²¹. In short, genomic DNA was isolated according to manufacturer’s instructions using the MagnaPure LC DNA Isolation Kit III (Roche).

Targeted amplicon sequencing was performed for three different regions: one using universal primers but mainly targeting bacterial V4 16S rRNA gene sequences (515F/R926, 5′GTGYCAGCMGCCGCGGTAA3′/5′AGCCGYCAATTYMTTTRAGTTT3′), the other aimed for optimized amplification of archaeal 16S rRNA gene sequences in a nested PCR (PCR1 344F/1041R, 5′ACGGGGYGCAGCAGGCGCGA3′/5′GGCCATGCACCWCCTCTC3′; PCR2 519F/806R, 5′CAGCMGCCGCGGTAA3′/5′GGACTACVSGGGTATCTAAT3′) and the third of the ITS region of fungi (ITS86F/ITS4R, 5′GTGAATCATCGAATCTTTGAA3′/5′TCCTCCGCTTATTGATATGC3′)^54,55. See ref. ⁵⁶ for detailed primer sequences and PCR protocols. PCRs were run in triplicates and pooled subsequently. No human DNA sequence depletion, enrichment of microbial or viral DNA, or mRNA was performed. Library preparation and sequencing of the amplicons were carried out at the Core Facility Molecular Biology of the Center for Medical Research at the Medical University Graz, Austria. Sequencing was performed in paired-end run mode on an Illumina MiSeq with v3 600 chemistry and 300 bp read length⁵⁷. Raw reads are publicly available at the European Nucleotide Archive PRJEB37883. Raw reads were processed using Qiime2 v2019.1 to v2021.2⁵⁸. Briefly, reads that were first quality filtered with DADA2 v2019.1.0 to v2021.2.0⁵⁹ were then denoised into Amplicon Sequence Variants (ASVs). The taxonomy was assigned with a Naive-Bayes classifier based on SILVA 132 for bacterial and archaeal signatures^60,61. Potential contaminant ASVs were removed considering the sequenced negative controls with the R package decontam v3.9 in prevalence mode, isContaminant setting, and threshold 0.5⁶², (https://github.com/benjjneb/decontam/). Subsequently negative controls as well as signatures of chloroplasts and mitochondria were removed manually. As no quantification experiments were applied, relative abundance methods were applied.

The genus Lactobacillus has recently been taxonomically re-structured⁶³, in which the genus was divided into 25 separate genera. In this study, we continue to refer to the amended nomenclature and dimension of the genus Lactobacillus, as this work is a supplement to the previously published amplicon data of this study, and we prefer to be consistent between those two publications. In addition, the taxonomic assignment of the datasets on which all other analyses are was performed using SILVA 132⁶⁰ prior to the renaming event. In this publication, we mention only two representatives of the original Lactobacillus genus, namely Lactobacillus rhamnosus (now: Lacticaseibacillus rhamnosus) and Lactobacillus acidophilus, the latter remaining unchanged. It shall be noted, that for the important probiotic representatives of the amended Lactobacillus genus, the new names also begin with “L” and the abbreviations of the “L.” genus may continue to be used⁶³.

An initial insight into the bacteriome of the analyzed 55 infants, based on 16S rRNA gene amplicons was provided earlier²¹. In this subsequent data analysis, we intensify the analytical assessments and include shotgun metagenomics and functional metabolomics, to substantially deepen the understanding of the development within the first weeks. Further, we include information on the archaeal, fungal, and viral part of the gut microbiome as well as on their function.

We performed shotgun metagenomic sequencing of a subset of infants for three time points (tp1, tp3, tp7). Sequencing libraries were generated with the Nextera XT Library construction kit (Illumina, Eindhoven, the Netherlands) and sequenced on an Illumina HiSeq (Illumina, Eindhoven, the Netherlands; Macrogen, Seoul, South Korea). The raw reads were quality assessed with fastqc v0.11.8⁶⁴ and filtered accordingly with trimmomatic v0.38⁶⁵ with a minimal length of 50 bp and a Phred quality score of 20 in a sliding window of 5 bp.

Both probiotics used in this study (“Antibiophilus”, containing Lactobacillus rhamnosus LCR 35, and “Infloran”, containing Bifidobacterium longum subsp. infantis NCDO2203 and Lactobacillus acidophilus NCDO1748) are pharmaceuticals according the Austrian regulations, and as such, their quality is strictly regulated and controlled. Therefore, we proceed on the assumption, that the probiotics contain the labeled strain purely and constant over time. However, to confirm the presence of the signatures of the probiotics in the stool of the infants, we compared their genomic information with our amplicon and metagenomic data. Therefore, amplicon sequences of interest were blasted against the respective 16S rRNA genes of the lactobacilli (L. rhamnosus LCR35, accession: EU184020; L. acidophilus NCDO1748, accession: ATCC4356), indicating a 100% identity for both. As metagenomic MAGs were available for Bifidobacterium from Klagenfurt samples, we used genomic information for comparison, showing 99.97% to 100% similarity (FastANI, B. longum subsp. infantis NCDO2203, accession: ATCC15696). The results are listed in Suppl. Tables 2a and 2b and on our Github repository (https://github.com/CharlotteJNeumann/preterm_shared)⁶⁶.

Samples from time points tp1 and tp3 yielded only small amounts of DNA, so that library preparation or post-sequencing quality filtering failed for most samples. Thus, we focus mainly on data from tp7 for analysis and interpretation.

The obtained reads were analyzed both in a genome- as well as gene-centric way. For the gene-centric approach, data were annotated with diamond v0.9.25⁶⁷ using blastx search against NCBInr database from 2019-07-19 and analyzed in the open-submission data platform MG-RAST according to the manual using default settings⁶⁸, on taxonomic and functional (SEED subsystems⁶⁹) level.

For the genome-centric analysis the reads were co-assembled with Megahit v1.1.3⁷⁰ by using the default setting “meta-sensitive” into contigs which were then binned with MaxBin2 v2.2.4⁷¹. Potential chimers and contaminations of representative dereplicated MAGs were detected with Genome UNClutterer (GUNC v. 1.0.1)⁷² using the default diamond GUNC database 2.0.4, its sensitive mode and a detailed output till species level. Genome chimerism was visualized as interactive html plots for each MAG. Finally, all outputs from GUNC were merged with those from checkM v.1.1.0⁷³ and all models from checkM2 v.0.1.3⁷⁴. The bins were then de-replicated with dRep v2.0.5⁷⁵ to generate a list of representative metagenome assembled genomes (MAGs). Taxonomic classification of those MAGs was performed with GTDB-Tk v1.5.1. Replication rates were determined with iRep v1.1⁷⁶. Indices for MAGs with the following default parameters were included: ≥75% completeness; ≤175 fragments/Mbp sequence; ≤2% contamination; ≥5 kbp scaffold length; min cov = 5; min wins = 0.98; min r² = 0.9; GC correction min r² = 0.0.

A subset of 111 stool samples for tp1, tp3 and tp7 from all three centers (corresponding to metagenomic sequencing) were analyzed with untargeted NMR (nuclear magnetic resonance spectroscopy) for several metabolites in house as described previously⁷⁷. In short, methanol water was added to the samples, cells were lysed, lyophilized, and mixed with NMR buffer. NMR was performed on an AVANCE^TM Neo Bruker Ultrashield Plus 600 MHz spectrometer equipped with a TXI probe head at 310 K and processed as described elsewhere⁷⁸.

Data analysis, statistics and visualization

Multiple analyses were performed in R v4⁷⁹ using the Microbiome Explorer package⁸⁰ using CSS normalization and DESeq2 for differentially abundance analyses: microbial composition analysis and visualization as stacked bar charts and correlation analysis of abundance of specific bacterial genera with their phages. Differential abundance was plotted in R⁷⁹ using the ggplot2 package⁸¹ and asterisks refer to DESEq2 q-values (q-values <0.05 (*), <0.01 (**) and <0.001 (***)) which are available in our Github repository⁶⁶. A pie chart for the Lactobacillus genus was created using Krona charts⁸². The BioEnv Biplot for bacterial dissimilarity of the groups was created using the vegan package⁸³ in R. Significance of differential abundance was calculated in SPSS v27⁸⁴ using a Kruskal-Wallis with Bonferroni correction for multiple comparisons and evaluating significance with q-values <0.05 (*), <0.01 (**) and <0.001 (***).

The network was created by using SparCC^85,86 within the SCNIC tool (Sparse Cooccurrence Network Investigation for Compositional data)^87,88 to calculate co-occurences from CSS normalized metagenomic observations. Apart from default settings we used 10 bootstraps to calculate p-values for the SparCC R value, filtered the dataset with activated –sparcc_filter parameter and used the recommended minimum correlation value of 0.35 to determine edges. Calculated correlations and networks were then visualized in Cytoscape v.3.9.1 in an edge-weighted spring embedded network where nodes represent taxa and edges positive and negative co-occurences according to the SparCC R values.

Permanova was used for analyzing biological and technical variations of the data. For that, the amplicon dataset was CSS normalized (RSV level), before feeding into the R-script provided by Lahti, Shetty et al.: https://microbiome.github.io/tutorials/PERMANOVA.html (microbiome::transform: “compositional”, permutations=999, method= bray). Input files (all samples, tp3 samples, tp7 samples, and metadata), including script and output, are provided in the Github repository (https://github.com/CharlotteJNeumann/preterm_shared)⁶⁶.

Metabolite correlation with taxonomic information

Metabolites measured by NMR were then correlated with CLR transformed relative abundance of genera of amplicon sequencing in R⁷⁹. As the centers differed greatly in terms of species present, this analysis was performed separately for each center. Therefore, amplicon data for each center were normalized with bestNormalized⁸⁹ and then correlated with Pearson. The list of normalizations bestNormalize chose is available in our Github repository⁶⁶. The analysis was plotted in a heatmap using ggplot2⁸¹. For each center, only the genera with the highest abundance and differentially abundance representing the six key players were selected based on abundance and DESeq2 (p < 0.001).

Antibiotic resistance genes counts and virulence factors

MAGs and contigs were aligned against several databases in abricate (Seemann T, Abricate, Github https://github.com/tseemann/abricate) with options mincov = 70 and minid = 70, including HMO gene clusters sequences⁹⁰, EcOH⁹¹, VFDB⁹², and Resfinder⁹³. To correlate antibiotic resistance gene patterns with specific genera, the taxonomy of the MAGs was assigned by GTDB-Tk⁹⁴. The number of hits per infant and per time point is shown in a circle packing plot created with rawgraphs⁹⁵. Data were analyzed on genus level whereas features were only depicted when the genus was represented by more than one MAG. Correlation of antibiotic resistance gene patterns with the six key species were visualized in a heatmap with R⁷⁹.

All graphs were combined and assimilated in Inkscape v1.1 (URL: https://inkscape.org/en/ RRID:SCR_014479) to obtain a uniform appearance.

Statistics & reproducibility

We conducted a prospective, triple-center cohort pilot study. As it was a pilot study, sample size was not pre-determined beforehand. Randomization and blinding of the investigators was not foreseen in the chosen study set-up, as all hospitals use different regimens and this protocol was not changed. A full study flow chart is provided in Suppl. Fig. 6. No data were excluded from the analyses. Overall, the study is considered to be only partially reproducible, as the data are dependent on the study cohort, which was only sampled once within this study, and sampling of cohorts in the same time-window cannot be repeated. However, starting from the raw sequencing data, the analysis is fully reproducible and all required data, scripts, and details are provided. Statistics mostly focus on single time points, mostly tp7; longitudinal statistics was not performed.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

Data availability

The raw sequencing reads generated in this study have been deposited in the European Nucleotide Archive Database under accession code PRJEB37883. ASV-tables, sequences of MAGs and metabolomic, as well as metabolomic data and used scripts are openly available and shared via Github (https://github.com/CharlotteJNeumann/preterm_shared)⁶⁶. All files used for the figures are listed in the Source Data File, which is also provided at Github (“list_raw_data_figures.xlsx”).

Raw NMR data have been deposited in Metabolites under accession code MTBLS6866. Clinically-relevant, anonymized information on each sample (sex, hospital, birth mode, nutrition, medication etc.) is provided in the metadata table located along with the respective ASV tables in the open Github repository. Source data are provided in the open GitHub repository⁶⁶. Source data are also provided with this paper.

Code availability

R scripts are openly available and shared via Github (https://github.com/CharlotteJNeumann/preterm_shared)⁶⁶.

References

Blencowe, H. et al. National, regional, and worldwide estimates of preterm birth rates in the year 2010 with time trends since 1990 for selected countries: a systematic analysis and implications. Lancet 379, 2162–2172 (2012).
Article PubMed Google Scholar
Fanaroff, A. A. et al. Trends in neonatal morbidity and mortality for very low birthweight infants. Am. J. Obstet. Gynecol. 196, 147.e1–147.e8 (2007).
Article PubMed Google Scholar
Neu, J. & Walker, W. A. Necrotizing Enterocolitis. N. Engl. J. Med. 364, 255 (2011).
Article CAS PubMed PubMed Central Google Scholar
Högberg, N., Stenbäck, A., Carlsson, P. O., Wanders, A. & Lilja, H. E. Genes regulating tight junctions and cell adhesion are altered in early experimental necrotizing enterocolitis. J. Pediatr. Surg. 48, 2308–2312 (2013).
Article PubMed Google Scholar
Jin, Y.-T., Duan, Y., Deng, X.-K. & Lin, J. Prevention of necrotizing enterocolitis in premature infants—an updated review. World J. Clin. Pediatr. 8, 23 (2019).
Article PubMed PubMed Central Google Scholar
Alcon-Giner, C. et al. Microbiota supplementation with Bifidobacterium and Lactobacillus modifies the preterm infant gut microbiota and metabolome: an observational study. Cell Rep. Med. 1, 100077 (2020).
Article CAS PubMed PubMed Central Google Scholar
Bäckhed, F. et al. Dynamics and stabilization of the human gut microbiome during the first year of life. Cell Host Microbe 17, 690–703 (2015).
Article PubMed Google Scholar
Oki, K. et al. Long-term colonization exceeding six years from early infancy of Bifidobacterium longum subsp. longum in human gut. BMC Microbiol. 18, 1–13 (2018).
Article Google Scholar
Bizzarro, M. J. Avoiding unnecessary antibiotic exposure in premature infants: understanding when (not) to start and when to stop. JAMA Netw. Open 1, e180165–e180165 (2018).
Google Scholar
van Duin, D. & Paterson, D. L. Multidrug resistant bacteria in the community: trends and lessons learned. Infect. Dis. Clin. North Am. 30, 377 (2016).
Article PubMed PubMed Central Google Scholar
Gustavsson, L., Lindquist, S., Elfvin, A., Hentz, E. & Studahl, M. Reduced antibiotic use in extremely preterm infants with an antimicrobial stewardship intervention. BMJ Paediatr. Open 4, e000872 (2020).
Article PubMed PubMed Central Google Scholar
Bury, R. G. & Tudehope, D. Enteral antibiotics for preventing necrotizing enterocolitis in low birthweight or preterm infants. Cochrane Database Syst. Rev. https://doi.org/10.1002/14651858.cd000405 (2001).
Bell, E. F. Preventing necrotizing enterocolitis: What works and how safe? Pediatrics 115, 173–174 (2005).
Article PubMed Google Scholar
Schmolzer, G. et al. Multi-modal approach to prophylaxis of necrotizing enterocolitis: Clinical report and review of literature. Pediatr. Surg. Int. 22, 573–580 (2006).
Article CAS PubMed Google Scholar
Kujawska, M., Collado, M. C. & Hall, L. J. Microbes, human milk, and prebiotics. Hum. Microbiome Early Life 197–237, https://doi.org/10.1016/B978-0-12-818097-6.00009-2 (2021).
Marcobal, A. & Sonnenburg, J. L. Human milk oligosaccharide consumption by intestinal microbiota. Clin. Microbiol. Infect. 18, 12 (2012).
Article CAS PubMed PubMed Central Google Scholar
Ruiz, L., García-Carral, C. & Rodriguez, J. M. Unfolding the human milk microbiome landscape in the omicsera. Front. Microbiol. 10, 1378 (2019).
Article PubMed PubMed Central Google Scholar
Wellmann, F. Epidemiologie der nekrotisierenden Enterokolitis im südlichen Österreich eine retrospektive Studie. Diploma thesis, Medical University of Graz (2018).
Costeloe, K. et al. A randomised controlled trial of the probiotic Bifidobacterium breve BBG-001 in preterm babies to prevent sepsis, necrotising enterocolitis and death: the Probiotics in Preterm infantS (PiPS) trial. Health Technol. Assess. 20, vii–83 (2016).
Article Google Scholar
Karthikeyan, G. & Bhat, B. V. The PiPS (Probiotics in Preterm Infants Study) Trial—controlling the confounding factor of cross-contamination unveils significant benefits. Indian Pediatr. 54, 162 (2017).
CAS PubMed Google Scholar
Kurath-Koller, S. et al. Hospital regimens including probiotics guide the individual development of the gut microbiome of very low birth weight infants in the first two weeks of life. Nutrients 12, 1256 (2020).
Article CAS PubMed PubMed Central Google Scholar
Gaci, N., Borrel, G., Tottey, W., O’Toole, P. W. & Brugère, J. F. Archaea and the human gut: New beginning of an old story. World J. Gastroenterol. 20, 16062–16078 (2014).
Article CAS PubMed PubMed Central Google Scholar
Rao, C. et al. Multi-kingdom ecological drivers of microbiota assembly in preterm infants HHS Public Access. https://doi.org/10.1038/s41586-021-03241-8.
Wampach, L. et al. Colonization and succession within the human gut microbiome by archaea, bacteria, and microeukaryotes during the first year of life. Front. Microbiol. 8, 738 (2017).
Article PubMed PubMed Central Google Scholar
Probst, A. J., Auerbach, A. K. & Moissl-Eichinger, C. Archaea on human skin. PLoS One 8, e65388 (2013).
Article ADS CAS PubMed PubMed Central Google Scholar
Moissl-Eichinger, C. et al. Human age and skin physiology shape diversity and abundance of Archaea on skin. Sci. Rep. 7, 4039 (2017).
Article ADS PubMed PubMed Central Google Scholar
Underwood, M. A. & Sohn, K. The microbiota of the extremely preterm infant. Clin. Perinatol. 44, 407 (2017).
Article PubMed PubMed Central Google Scholar
Healy, D.B., Ryan, C.A., Ross, R.P., Stanton, C & Dempsey, E.M. Clinical implications of preterm infant gut microbiome development. Nat. Microbiol. https://doi.org/10.1038/s41564-021-01025-4 (2021).
Łubiech, K. & Twarużek, M. Lactobacillus bacteria in breast milk. Nutrients 12, 1–13 (2020).
Article Google Scholar
Brown, C. T. et al. Measurement of bacterial replication rates in microbial communities. Nat. Biotechnol. 34, 1256–1263 (2017).
Article Google Scholar
Kumar, M., Flint, S., Palmer, J., Chanapha, S. & Hall, C. Influence of incubation temperature and total dissolved solids on biofilm and spore formation by dairy isolates of Geobacillus stearothermophilus. Appl. Environ. Microbiol. 87, 1–10 (2021).
Article Google Scholar
Durand, L., Planchon, S., Guinebretiere, M. H., Carlin, F. & Remize, F. Genotypic and phenotypic characterization of foodborne Geobacillus stearothermophilus. Food Microbiol. 45, 103–110 (2015).
Article CAS PubMed Google Scholar
Nazina, T. N. et al. Taxonomic study of aerobic thermophilic bacilli: Descriptions of Geobacillus subterraneus gen. nov., sp. nov. and Geobacillus uzenensis sp. nov. from petroleum reservoirs and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus, Bacillus thermoleovorans. Int. J. Syst. Evol. Microbiol. 51, 433–446 (2001).
Article CAS PubMed Google Scholar
Wang, X. et al. Evolution of intestinal gases and fecal short-chain fatty acids produced in vitro by preterm infant gut microbiota during the first 4 weeks of life. Front. Pediatr. 0, 1011 (2021).
Google Scholar
Ramsey, M., Hartke, A. & Huycke, M. The physiology and metabolism of Enterococci. From Commensals to Leading Causes of Drug Resistant Infection. In: Enterococci: From Commensals to Leading Causes of Drug Resistant Infection. Boston: Massachusetts Eye and Ear Infirmary (2014).
Corporation, B. Gentamicin(e) Product Monograph PRODUCT MONOGRAPH. (2012).
Picard, C. et al. Review article: bifidobacteria as probiotic agents - physiological effects and clinical benefits. Aliment. Pharmacol. Ther. 22, 495–512 (2005).
Article CAS PubMed Google Scholar
Klopp, J. et al. Meconium microbiome of very preterm infants across Germany. mSphere https://doi.org/10.1128/MSPHERE.00808-21 (2022).
Lyons, K. E., Ryan, C. A., Dempsey, E. M., Ross, R. P. & Stanton, C. Breast milk, a source of beneficial microbes and associated benefits for infant health. Nutrients 12, 1039 (2020).
Article CAS PubMed PubMed Central Google Scholar
Soto, A. et al. Lactobacilli and bifidobacteria in human breast milk: influence of antibiotherapy and other host and clinical factors. J. Pediatr. Gastroenterol. Nutr. 59, 78 (2014).
Article PubMed PubMed Central Google Scholar
Dalby, M. J. & Hall, L. J. Populating preterm infants with probiotics. Cell Rep. Med. 2, 100224 (2021).
Article CAS PubMed PubMed Central Google Scholar
Abdulkadir, B. et al. Routine use of probiotics in preterm infants: longitudinal impact on the microbiome and metabolome. Neonatology 109, 239–247 (2016).
Article CAS PubMed Google Scholar
Koskella, B., Hall, L. J. & Metcalf, C. J. E. The microbiome beyond the horizon of ecological and evolutionary theory. Nat. Ecol. Evol. 1, 1606–1615 (2017).
Article PubMed Google Scholar
Martí, M. et al. Effects of Lactobacillus reuteri supplementation on the gut microbiota in extremely preterm infants in a randomized placebo-controlled trial. Cell Rep. Med. 2, 100206 (2021).
Article PubMed PubMed Central Google Scholar
Marcobal, A. et al. Consumption of human milk oligosaccharides by gut-related microbes. J. Agric. Food Chem. 58, 5334 (2010).
Article CAS PubMed PubMed Central Google Scholar
Esaiassen, E. et al. Effects of probiotic supplementation on the gut microbiota and antibiotic resistome development in preterm infants. Front. Pediatr. 6, 347 (2018).
Article PubMed PubMed Central Google Scholar
Austin, S. et al. Human milk oligosaccharides in the milk of mothers delivering term versus preterm infants. Nutrients 11, 1282 (2019).
Article CAS PubMed PubMed Central Google Scholar
Birck, M. M. et al. Enteral but not parenteral antibiotics enhance gut function and prevent necrotizing enterocolitis in formula-fed newborn preterm pigs. Am. J. Physiol. Gastrointest. Liver Physiol. 310, G323–G333 (2016).
Article PubMed Google Scholar
Cotten M. et al. Prolonged duration of initial empirical antibiotic treatment is associated with increased rates of necrotizing enterocolitis and death for extremely low birth weight infants. Pediatrics 123, 58 (2009).
Article PubMed Google Scholar
Fan, X. et al. The initial prophylactic antibiotic usage and subsequent necrotizing enterocolitis in high-risk premature infants: a systematic review and meta-analysis. Pediatr. Surg. Int. 34, 35–45 (2017).
Article PubMed Google Scholar
Alexander, V. N., Northrup, V. & Bizzarro, M. J. Antibiotic exposure in the newborn intensive care unit and the risk of necrotizing enterocolitis. J. Pediatr. 159, 392 (2011).
Article PubMed PubMed Central Google Scholar
World Health Organization. Global action plan on antimicrobial resistance. https://ahpsr.who.int/publications/i/item/global-action-plan-on-antimicrobial-resistance (2015).
Kurath-Koller, S. et al. Changes of intestinal microbiota composition and diversity in very low birth weight infants related to strategies of NEC prophylaxis: protocol for an observational multicentre pilot study. Pilot Feasibility Stud. 3, 52 (2017).
Article PubMed PubMed Central Google Scholar
Turenne, C. Y., Sanche, S. E., Hoban, D. J., Karlowsky, J. A. & Kabani, A. M. Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. J. Clin. Microbiol. 37, 1846 (1999).
Article CAS PubMed PubMed Central Google Scholar
White, T. J., Bruns, T., Lee, S. & Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. 315–322, https://doi.org/10.1016/B978-0-12-372180-8.50042-1 (1990).
Pausan, M. R. et al. Exploring the Archaeome: Detection of archaeal signatures in the human body. Front. Microbiol. 10, 2796 (2019).
Article PubMed PubMed Central Google Scholar
Klymiuk, I., Bambach, I., Patra, V., Trajanoski, S. & Wolf, P. 16S based microbiome analysis from healthy subjects’ skin swabs stored for different storage periods reveal phylum to genus level changes. Front. Microbiol. 7, 2012 (2016).
Article PubMed PubMed Central Google Scholar
Bolyen, E. et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 37, 852–857 (2019).
Article CAS PubMed PubMed Central Google Scholar
Callahan, B. J. et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 13, 581–583 (2016).
Article CAS PubMed PubMed Central Google Scholar
Quast, C. et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 41, D590–D596 (2013).
Article CAS PubMed Google Scholar
Bokulich, N. A. et al. Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2’s q2-feature-classifier plugin. Microbiome 6, 1–17 (2018).
Article Google Scholar
Davis, N. M., Proctor, D. M., Holmes, S. P., Relman, D. A. & Callahan, B. J. Simple statistical identification and removal of contaminant sequences in marker-gene and metagenomics data. Microbiome 6, 226 (2018).
Article PubMed PubMed Central Google Scholar
Zheng, J. et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol. 70, 2782–2858 (2020).
Article CAS PubMed Google Scholar
Andrews S. (2010). FastQC: a quality control tool for high throughput sequence data. Available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc.
Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120 (2014).
Article CAS PubMed PubMed Central Google Scholar
Neumann, C. J. et al. Clinical NEC prevention practices drive different microbiome profiles and functional responses in the preterm intestine. github repository preterm_shared, https://doi.org/10.5281/zenodo.7602026 (2023).
Buchfink, B., Reuter, K. & Drost, H. G. Sensitive protein alignments at tree-of-life scale using DIAMOND. Nat. Methods 18, 366–368 (2021).
Article CAS PubMed PubMed Central Google Scholar
Meyer, F. et al. The metagenomics RAST server - A public resource for the automatic phylogenetic and functional analysis of metagenomes. BMC Bioinforma. 9, 1–8 (2008).
Article Google Scholar
Overbeek, R. et al. The subsystems approach to genome annotation and its use in the project to annotate 1000 genomes. Nucleic Acids Res. 33, 5691–5702 (2005).
Article CAS PubMed PubMed Central Google Scholar
Li, D., Liu, C. M., Luo, R., Sadakane, K. & Lam, T. W. MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics 31, 1674–1676 (2015).
Article CAS PubMed Google Scholar
Wu, Y. W., Tang, Y. H., Tringe, S. G., Simmons, B. A. & Singer, S. W. MaxBin: An automated binning method to recover individual genomes from metagenomes using an expectation-maximization algorithm. Microbiome 2, 1–18 (2014).
Article Google Scholar
Orakov, A. et al. GUNC: detection of chimerism and contamination in prokaryotic genomes. Genome Biol. 22, 1–19 (2021).
Article Google Scholar
Parks, D. H., Imelfort, M., Skennerton, C. T., Hugenholtz, P. & Tyson, G. W. CheckM: assessing the quality of microbial genomes recovered from isolates, single cells, and metagenomes. Genome Res. 25, 1043–1055 (2015).
Article CAS PubMed PubMed Central Google Scholar
Chklovski, A., Parks, D. H., Woodcroft, B. J. & Tyson, G. W. CheckM2: a rapid, scalable and accurate tool for assessing microbial genome quality using machine learning. bioRxiv 2022.07.11.499243 https://doi.org/10.1101/2022.07.11.499243 (2022).
Olm, M. R., Brown, C. T., Brooks, B. & Banfield, J. F. dRep: a tool for fast and accurate genomic comparisons that enables improved genome recovery from metagenomes through de-replication. ISME J.11, 2864–2868 (2017).
Article CAS PubMed PubMed Central Google Scholar
Brown, C. T., Olm, M. R., Thomas, B. C. & Banfield, J. F. Measurement of bacterial replication rates in microbial communities. Nat. Biotechnol. 34, 1256–1263 (2016).
Article CAS PubMed PubMed Central Google Scholar
Kumpitsch, C. et al. Reduced B12 uptake and increased gastrointestinal formate are associated with archaeome-mediated breath methane emission in humans. Microbiome 9, 1–18 (2021).
Article Google Scholar
Alkan, H. F. et al. Cytosolic aspartate availability determines cell survival when glutamine is limiting. Cell Metab. 28, 706–720.e6 (2018).
Article CAS PubMed PubMed Central Google Scholar
R Core Team (2021). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/.
Reeder, J., Huang, M., Kaminker, J. S. & Paulson, J. N. MicrobiomeExplorer: an R package for the analysis and visualization of microbial communities. Bioinformatics 37, 1317 (2021).
Article CAS PubMed Google Scholar
Wickham, H. ggplot2: Elegant Graphics for Data Analysis. Springer-Verlag New York. https://doi.org/10.18637/jss.v035.b01 (2016).
Ondov, B. D., Bergman, N. H. & Phillippy, A. M. Interactive metagenomic visualization in a Web browser. BMC Bioinforma. 12, 1–10 (2011).
Article Google Scholar
Oksanen, A. J. et al. The vegan package. Community ecology package. http://CRAN.R-project.org/package=vegan (2015).
IBM Corp. Released 2020. IBM SPSS Statistics for Windows, V. 27. 0. A. N. I. C. SPSS. (2020).
Watts, S.C., Ritchie, S.C., Inouye, M., Holt, K.E. & Stegle, O. Genetics and population analysis FastSpar: rapid and scalable correlation estimation for compositional data. https://doi.org/10.1093/bioinformatics/bty734.
Friedman, J. & Alm, E. J. Inferring correlation networks from genomic survey data. PLoS Comput. Biol. 8, 1002687 (2012).
Article ADS Google Scholar
ShafferM, G. Github SCNIC. https://github.com/shafferm/SCNIC.
Shaffer, M., Thurimella, K., Sterrett, J.D. & Lozupone, C.A. SCNIC: Sparse correlation network investigation for compositional data. Mol. Ecol. Resour https://doi.org/10.1111/1755-0998.13704 (2022).
Peterson, Ryan A. Finding Optimal Normalizing Transformations via bestNormalize. R. J. 13, 310 (2021).
Article Google Scholar
Lawson, M. A. E. et al. Breast milk-derived human milk oligosaccharides promote Bifidobacterium interactions within a single ecosystem. ISME J. 14, 635–648 (2019).
Article PubMed PubMed Central Google Scholar
Ingle, D. J. et al. In silico serotyping of E. coli from short read data identifies limited novel O-loci but extensive diversity of O:H serotype combinations within and between pathogenic lineages. Microb. Genom. 2, e000064 (2016).
PubMed PubMed Central Google Scholar
Chen, L. et al. VFDB: a reference database for bacterial virulence factors. Nucleic Acids Res. 33, D325–D328 (2005).
Article CAS PubMed Google Scholar
Zankari, E. et al. Identification of acquired antimicrobial resistance genes. J. Antimicrob. Chemother. 67, 2640–2644 (2012).
Article CAS PubMed PubMed Central Google Scholar
Chaumeil, P. A., Mussig, A. J., Hugenholtz, P. & Parks, D. H. GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. Bioinformatics 36, 1925–1927 (2020).
CAS Google Scholar
Mauri, M., Elli, T., Caviglia, G., Uboldi, G. & Azzi, M. RAWGraphs: A Visualisation Platform to Create Open Outputs. In Proceedings of the 12th Biannual Conference on Italian SIGCHI Chapter (CHItaly '17). Association for Computing Machinery, New York, NY, USA, 1–5. (2017). https://doi.org/10.1145/3125571.3125585.

Download references

Acknowledgements

We highly appreciate the contributions of Raimund Kraschl, Claudia Kanduth, and Barbara Hopfer. This research was funded in in part by the Austrian Science Fund (FWF) [DOC 31 DP-iDP and P32697, given to CME]. For the purpose of open access, the author has applied a CC BY public copyright licence to any author-accepted manuscript version arising from this submission. TM was supported by Austrian Science Fund (FWF) grants P28854, I3792 and DK-MCD W1226, the Austrian Research Promotion Agency (FFG) grants 864690 and 870454; the Integrative Metabolism Research Center Graz; Austrian Infrastructure Program 2016/2017, the Styrian Government (Zukunftsfonds) and BioTechMed-Graz (Flagship project DYNIMO). BR was supported in part by a grant of the parent association “Kleine Helden –Initiative für Früh- und Neugeborene”, Graz, Austria. LJH is supported by Wellcome Trust Investigator Awards (100974/C/13/Z and 220876/Z/20/Z); the Biotechnology and Biological Sciences Research Council (BBSRC), Institute Strategic Programme Gut Microbes and Health (BB/R012490/1), and its constituent projects BBS/E/F/000PR10353 and BBS/E/F/000PR10356. The authors acknowledge computational resources of the MedBioNode at the Medical University of Graz and the support of the ZMF Galaxy Team: Core Facility Computational Bioanalytics, Medical University of Graz, funded by the Austrian Federal Ministry of Education, Science, and Research Hochschulraum-Strukturmittel 2016 grant as part of BioTechMed Graz. The funding body had no influence on the study, collection, analysis, and interpretation of data or on the manuscript content.

Author information

Authors and Affiliations

Diagnostic and Research Institute of Hygiene, Microbiology and Environmental Medicine; Medical University of Graz, Graz, Styria, 8010, Austria
Charlotte J. Neumann, Alexander Mahnert, Christina Kumpitsch & Christine Moissl-Eichinger
Quadram Institute Bioscience, Norwich Research Park, Norwich, NR4 7UQ, UK
Raymond Kiu, Matthew J. Dalby & Lindsay J. Hall
Chair of Intestinal Microbiome, School of Life Sciences, ZIEL-Institute for Food & Health; Technical University of Munich, Freising, Bavaria, 85354, Germany
Magdalena Kujawska & Lindsay J. Hall
Gottfried Schatz Research Center for Cell Signaling, Metabolism and Aging, Molecular Biology & Biochemistry, Medical University of Graz, Graz, Styria, 8010, Austria
Tobias Madl
BioTechMed, Graz, Styria, 8010, Austria
Tobias Madl & Christine Moissl-Eichinger
Division of Paediatric Cardiology, Department of Paediatrics and Adolescent Medicine, Medical University of Graz, Graz, Styria, 8036, Austria
Stefan Kurath-Koller
Division of Neonatology; Department of Paediatrics and Adolescent Medicine, Medical University of Graz, Graz, Styria, 8036, Austria
Berndt Urlesberger & Bernhard Resch
Research Unit for Neonatal Infectious Diseases and Epidemiology, Medical University of Graz, Graz, Styria, 8036, Austria
Berndt Urlesberger & Bernhard Resch
Norwich Medical School, University of East Anglia, Norwich Research Park, Norwich, NR4 7TJ, UK
Lindsay J. Hall

Authors

Charlotte J. Neumann
View author publications
You can also search for this author in PubMed Google Scholar
Alexander Mahnert
View author publications
You can also search for this author in PubMed Google Scholar
Christina Kumpitsch
View author publications
You can also search for this author in PubMed Google Scholar
Raymond Kiu
View author publications
You can also search for this author in PubMed Google Scholar
Matthew J. Dalby
View author publications
You can also search for this author in PubMed Google Scholar
Magdalena Kujawska
View author publications
You can also search for this author in PubMed Google Scholar
Tobias Madl
View author publications
You can also search for this author in PubMed Google Scholar
Stefan Kurath-Koller
View author publications
You can also search for this author in PubMed Google Scholar
Berndt Urlesberger
View author publications
You can also search for this author in PubMed Google Scholar
Bernhard Resch
View author publications
You can also search for this author in PubMed Google Scholar
Lindsay J. Hall
View author publications
You can also search for this author in PubMed Google Scholar
Christine Moissl-Eichinger
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Conceptualization: B.U., B.R., S.K.K., C.M.E. Methodology: C.J.N., S.K.K., A.M., C.K., R.K., M.D., T.M. Formal Analysis: C.J.N., A.M., C.K., R.K., M.D., M.K., T.M. Investigation: C.J.N., C.M.E. Writing—Original draft: C.J.N., C.M.E. Writing—Review & Editing: all authors. Visualization: C.J.N. Supervision: C.M.E., B.R., B.U., L.H. Project Administration: C.J.N., B.U., C.M.E. Funding Acquisition: B.R., B.U., T.M., C.M.E.

Corresponding authors

Correspondence to Bernhard Resch or Christine Moissl-Eichinger.

Ethics declarations

Competing interests

The authors declare no competing interests.

Inclusion and diversity statement

We worked to ensure sex balance in the selection of participants, as well as authors. We further actively worked to promote gender balance in our reference list.

Peer review

Peer review information

Nature Communications thanks Pamela Ferretti, Huang Lin, and the other, anonymous, reviewer for their contribution to the peer review of this work. Peer reviewer reports are available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Peer Review File

Reporting Summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Neumann, C.J., Mahnert, A., Kumpitsch, C. et al. Clinical NEC prevention practices drive different microbiome profiles and functional responses in the preterm intestine. Nat Commun 14, 1349 (2023). https://doi.org/10.1038/s41467-023-36825-1

Download citation

Received: 29 June 2022
Accepted: 13 February 2023
Published: 11 March 2023
DOI: https://doi.org/10.1038/s41467-023-36825-1

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.