Correction to: Nature Communications https://doi.org/10.1038/s41467-018-05559-w, published online 22 August 2018.
The original version of this Article contained errors in the listed sequences for GADPH, ISG56, IL-6 and RIG-I in Supplementary Table 1. The labelled orientations of primer sequences for GADPH were also incorrect. The Rantes primers were incorrectly included in the original Supplementary Table 1.
The forward primer sequence for GADPH has been corrected from ‘GAGTCAACGGATTTGGTGGT’ to ‘GAGTCAACGGATTTGGTCGT’. ‘GACAAGCTTCCCGTTCTCAG’ is now correctly listed as the reverse primer for GADPH and ‘GAGTCAACGGATTTGGTCGT’ as the forward primer.
The ISG56 reverse primer has been corrected from ‘CCACACTGTATTTGGTGTCTACG’ to ‘CCACACTGTATTTGGTGTCTAGG’.
The forward and reverse primer sequences for IL-6 have been corrected from ‘TCTGCAAGAGACTTCCATCCAGTTGC‘ to ‘TTCTCCACAAGCGCCTTCGGTC’ and ‘AGCCTCCGACTTGTGAAGTGGT’ to ‘TCTGTGTGGGGCGGCTACATCT’, respectively.
The forward and reverse primer sequences primer sequences for RIG-I have been corrected from ‘GAGGAGGTGAAAGACCAGAGCA’ to ‘ACGCAGCCTGCAAGCCTTCC’ and ‘TAGCATCTCGGCTGGACTTCGA’ to ‘TGTGGCAGCCTCCATTGGGC’, respectively.
The Rantes primers have been deleted from Supplementary Table 1.
The HTML has been updated to include a corrected version of the Supplementary Information. The correct version of the Supplementary Information can be found as Supplementary Information associated with this correction.
Author information
Authors and Affiliations
Corresponding authors
Supplementary information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Lian, H., Wei, J., Zang, R. et al. Author Correction: ZCCHC3 is a co-sensor of cGAS for dsDNA recognition in innate immune response. Nat Commun 12, 5526 (2021). https://doi.org/10.1038/s41467-021-25397-7
Published:
DOI: https://doi.org/10.1038/s41467-021-25397-7
This article is cited by
-
Climate-driven zooplankton shifts cause large-scale declines in food quality for fish
Nature Climate Change (2023)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
