Cannabinoid CB1 receptor gene inactivation in oligodendrocyte precursors disrupts oligodendrogenesis and myelination in mice

Sánchez-de la Torre, Aníbal; Aguado, Tania; Huerga-Gómez, Alba; Santamaría, Silvia; Gentile, Antonietta; Chara, Juan Carlos; Matute, Carlos; Monory, Krisztina; Mato, Susana; Guzmán, Manuel; Lutz, Beat; Galve-Roperh, Ismael; Palazuelos, Javier

doi:10.1038/s41419-022-05032-z

Download PDF

Article
Open access
Published: 07 July 2022

Cannabinoid CB₁ receptor gene inactivation in oligodendrocyte precursors disrupts oligodendrogenesis and myelination in mice

Aníbal Sánchez-de la Torre^1,2,3^na1,
Tania Aguado^1,2,3^na1,
Alba Huerga-Gómez^1,2,3,
Silvia Santamaría^1,2,3,
Antonietta Gentile^4,5,
Juan Carlos Chara^2,6,7,
Carlos Matute ORCID: orcid.org/0000-0001-8672-711X^2,6,7,
Krisztina Monory⁵,
Susana Mato^2,6,7,8,
Manuel Guzmán^1,2,3,
Beat Lutz⁵,
Ismael Galve-Roperh ORCID: orcid.org/0000-0003-3501-2434^1,2,3 &
…
Javier Palazuelos ORCID: orcid.org/0000-0002-0409-1398^1,2,3

Cell Death & Disease volume 13, Article number: 585 (2022) Cite this article

2459 Accesses
6 Citations
4 Altmetric
Metrics details

Subjects

Abstract

Cannabinoids are known to modulate oligodendrogenesis and developmental CNS myelination. However, the cell-autonomous action of these compounds on oligodendroglial cells in vivo, and the molecular mechanisms underlying these effects have not yet been studied. Here, by using oligodendroglial precursor cell (OPC)-targeted genetic mouse models, we show that cannabinoid CB₁ receptors exert an essential role in modulating OPC differentiation at the critical periods of postnatal myelination. We found that selective genetic inactivation of CB₁ receptors in OPCs in vivo perturbs oligodendrogenesis and postnatal myelination by altering the RhoA/ROCK signaling pathway, leading to hypomyelination, and motor and cognitive alterations in young adult mice. Conversely, pharmacological CB₁ receptor activation, by inducing E3 ubiquitin ligase-dependent RhoA proteasomal degradation, promotes oligodendrocyte development and CNS myelination in OPCs, an effect that was not evident in OPC-specific CB₁ receptor-deficient mice. Moreover, pharmacological inactivation of ROCK in vivo overcomes the defects in oligodendrogenesis and CNS myelination, and behavioral alterations found in OPC-specific CB₁ receptor-deficient mice. Overall, this study supports a cell-autonomous role for CB₁ receptors in modulating oligodendrogenesis in vivo, which may have a profound impact on the scientific knowledge and therapeutic manipulation of CNS myelination by cannabinoids.

Pathological oligodendrocyte precursor cells revealed in human schizophrenic brains and trigger schizophrenia-like behaviors and synaptic defects in genetic animal model

Article Open access 21 September 2022

Systemic and intrinsic functions of ATRX in glial cell fate and CNS myelination in male mice

Article Open access 04 November 2023

Regulation of adult neurogenesis by the endocannabinoid-producing enzyme diacylglycerol lipase alpha (DAGLa)

Article Open access 12 January 2022

Introduction

During developmental CNS myelination, oligodendrocyte progenitor cells (OPCs) proliferate, migrate, and differentiate into mature myelinating oligodendrocytes (OLs), which generate the myelin sheath internode and, thereby, interact with axons to organize the nodal, paranodal, and juxtaparanodal regions [1, 2]. Thus, the OL developmental program is temporally and spatially controlled by a high number of extracellular signals that coordinately regulate essential intracellular signaling pathways and their downstream transcriptional programs. Alterations in essential genes modulating OPC differentiation and/or OL maturation cause myelination defects, which is translated into neuronal dysfunction and, eventually, behavioral alterations in mice [2,3,4,5]. Despite the identification of a high number of these regulatory signals, the whole molecular network that controls developmental oligodendrogenesis and CNS myelination has remained incomplete.

Almost two decades after the first evidence supporting that cannabinoid compounds modulate OL development and CNS myelination [6, 7], several pharmacological studies have shown that synthetic cannabinoids [8], phytocannabinoids [9], and endocannabinoids (eCBs) [10] modulate oligodendrogenesis and CNS myelination. Elevated levels of the endocannabinoid 2-arachidonoylglycerol (2-AG) upon pharmacological inhibition of the 2-AG-degrading enzyme monoacylglycerol lipase (MAGL) enhances OL development in cultured OPCs [11], both at embryonic stages in mice [10] and in the Theiler’s murine encephalomyelitis virus (TMEV) progressive mouse model of multiple sclerosis (MS) [12, 13]. Moreover, administration of the phytocannabinoid Δ⁹-tetrahydrocannabinol (THC) [9] or of synthetic cannabinoids [8] promotes OPC differentiation and developmental CNS myelination, as well as OL regeneration and functional CNS remyelination upon cuprizone-induced demyelination [14]. Moreover, the phytocannabinoid cannabidiol (CBD) prevents hypoxia/ischemia-induced hypomyelination in newborn rats [15]. Of note, collectively, these studies have only been based on systemic pharmacological approaches. Owing to the abundant expression of CB₁ receptors in various neuronal and glial cell populations [16], the cell-autonomous action of cannabinoid compounds in OPCs to modulate OL development in vivo has remained unexplored. Thus, deciphering the cellular neurobiology of the eCB system may help to identify the cellular targets of cannabinoids under physiological or pathophysiological settings.

Here, by using genetic mouse models aimed to inactivate CB₁ receptor gene expression selectively in OPCs, we show that CB₁ receptors exert an essential function in modulating OPC differentiation and oligodendrogenesis during postnatal myelination in vivo. We found that selective depletion of CB₁ receptor signaling in OPCs, by altering the RhoA/ROCK signaling pathway, prevents cell differentiation, perturbs oligodendrogenesis and postnatal myelination, and causes hypomyelination as well as motor and cognitive defects at young adult ages. Moreover, pharmacological inactivation of ROCK in vivo overcomes the defects in oligodendrogenesis and functional CNS myelination of CB₁ receptor deficient OPCs. This study supports an essential role for CB₁ receptors in modulating OPC functions and CNS myelination, which may contribute to understanding the complex molecular network that controls CNS myelination.

Results

Selective CB₁ receptor gene inactivation in OPCs in vivo

To interrogate a cell-autonomous role for CB₁ receptors in the modulation of oligodendrogenesis and CNS myelination in vivo, we generated a new mouse line by crossing the CB₁^f/f [17] mouse line with the Ng2-CreERT2 [18] and Rosa-stop-Ai6 [19] mouse lines. This would conceivably deplete CB₁ receptors gene (Cnr₁) expression selectively in OPCs upon tamoxifen (TAM) administration, and ZsGreen1 fluorescently label OPCs to track OL differentiation along the process of CNS myelination (Fig. S1A). We found approximately 77.7% of recombination efficiency in Ng2/Ai6-CB₁KO and Ng2/Ai6-CB₁HET mice by quantifying the percentage of oligodendroglial-lineage Olig2⁺ cells that expressed the Ai6 recombinant transgene by immunofluorescence analysis in the developing corpus callosum (CC) (Fig. S1B). We verified the recombination in the CB₁ receptor locus by genomic DNA analysis of Ng2/Ai6-CB₁KO and Ng2/Ai6-CB₁HET CC FAC-sorted cells at postnatal day 10 (P10) (Fig. S1C, D) [20]. We also confirmed CB₁ protein depletion in Ng2/Ai6-CB₁KO CC isolated cells at P10 by immunofluorescence (Fig. S1E).

CB₁ receptor gene inactivation in OPCs disrupts postnatal oligodendrogenesis

To study the role for CB₁ receptors in oligodendrogenesis, we induced TAM-driven recombination in Ng2/Ai6-CB₁KO and Ng2/Ai6-CB₁HET mice at P6 and P7 and performed a differentiation-state analysis of the OL-lineage populations by immunofluorescence in the CC at P15 and at a young adult age (P60) (Fig. 1A). Analysis revealed a higher proportion of NG2⁺ OPCs and a reduced proportion of CC1⁺ OLs within the recombinant Ai6⁺ population in the CC of Ng2/Ai6-CB₁KO mice compared to their controls (Ng2/Ai6-CB₁HET), thus pointing to a blockade of OPC differentiation (Fig. 1B and Fig. S2A). Similar data were obtained when analyzing the Olig2⁺ cell population in the Ng2-CB₁KO mouse line at P15 (Fig. 1C and Fig. S2B). Ng2-CB₁KO mice also showed a reduced density of CC1⁺ OLs compared to their respective controls (Ng2-CB₁WT mice) at both ages (Fig. 1C). We did not find differences in Olig2⁺ cell densities between Ng2-CB₁KO mice and their control Ng2-CB₁WT littermates at both ages (Fig. 1C), indicating that CB₁ receptor gene inactivation in OPCs disrupts cell differentiation without affecting OPC cell survival. We provided further support of these data by generating another OPC-specific mouse line upon crossing Pdgfrα-Cre [21] and CB₁^f/f animals. Pdgfrα-CB₁KO mice also showed a reduced CC1⁺ OL cell density as well as a reduced proportion of CC1⁺ cells among Olig2⁺ cells in the developing CC compared to their control Pdgfrα-CB₁WT mice at P15 (Fig. 1D and Fig. S2C). Taken together, these results indicate that CB₁ receptors regulate OPC differentiation during postnatal development in a cell autonomous manner.

Next, we studied the maturation state of the OL population in the CC of OPC-CB₁ receptor-deficient mice. Immunofluorescence analysis of OL (CC1) and mature myelinating OL markers (glutathione S-transferase P, GSTπ; myelin-associated glycoprotein MAG) showed a reduced density of GSTπ⁺CC1⁺ or MAG⁺ mature myelinating OLs (Fig. S3A, B), together with a reduced proportion of myelinating GSTπ⁺ OLs within CC1⁺ OLs cells, in Ng2-CB₁KO mice compared to their Ng2-CB₁WT control mice at P15 and P60 (Fig. 1E). We also found a reduced proportion of CC1⁺GSTπ⁺ cells within the Ai6⁺ population in the CC of Ng2/Ai6-CB₁KO mice compared to their Ng2/Ai6-CB₁HET controls (Fig. 1B and Fig. S3C), thus suggesting that CB₁ receptors modulate not only OPC differentiation but also OL maturation. Altogether, these findings indicate that CB₁ receptor ablation in OPCs prevents cell differentiation and disrupts oligodendrogenesis during the critical period of postnatal myelination.

CB₁ receptor gene inactivation in OPCs disrupts postnatal CNS myelination

To address whether the observed defects in oligodendrogenesis shown by Ng2-CB₁KO and Pdgfrα-CB₁KO mice impact the myelination process, we analyzed myelination in the CC of these mice and their respective controls at P15. Western blot analysis of dissected CC extracts revealed reduced levels of myelin-associated proteins, such as MAG, myelin oligodendrocyte glycoprotein (MOG), and myelin basic protein (MBP) from Ng2-CB₁KO and Pdgfrα-CB₁KO mice compared to their controls (Ng2-CB₁WT and Pdgfrα-CB₁WT mice respectively) (Fig. 2A). Fluoromyelin staining, as well as MBP and proteolipid protein (PLP) immunofluorescence analysis in the developing CC, supported the hypomyelinated phenotype of Ng2-CB₁KO mice compared to their respective controls (Fig. 2B, C). Moreover, ultrastructural analysis by electron microscopy showed a reduced density of myelinated axons in CC of Ng2-CB₁KO mice compared to their controls (Fig. 2D). These results indicate that CB₁ receptor deficiency in OPCs at early postnatal ages disrupts developmental CNS myelination.

**Fig. 2: Genetic inactivation of CB₁ receptor in OPCs disrupts developmental myelination.**

CB₁ receptor gene inactivation in OPCs causes hypomyelination in young adult mice

We next studied whether CB₁ receptor deficiency in OPCs at early postnatal ages leads to alterations of myelin levels at P60. Tamoxifen-driven recombination was induced at P6 in Ng2-CB₁KO and their controls, and myelination was evaluated in the CC at P60. Sudan black staining unveiled a hypomyelinated CC in adult Ng2-CB₁KO mice compared to controls (Fig. 2E and Fig. S4B). Western blot and real time-PCR analyses revealed reduced protein and mRNA levels of myelin-associated proteins, such as MAG, MOG and MBP, in CC extracts from Ng2-CB₁KO mice compared to their controls (Fig. 2F and Fig. S4A). Furthermore, we also found reduced myelin-related protein levels in other CNS areas of Ng2-CB₁KO mice, such as the cerebellum, the hippocampus, and the medial prefrontal cortex, compared to Ng2-CB₁WT mice (Fig. 2F). Then, we analyzed whether the hypomyelinated phenotype observed upon OPC-CB₁ receptor depletion impacts node/paranode density or structure. Immunofluorescence analysis of nodal (Nav1.6) and paranodal (Caspr) markers in the CC at P60 revealed an altered nodal and paranodal length, with equal node density in Ng2-CB₁KO mice compared to their controls (Fig. 2G), confirming a defect in myelination in Ng2-CB₁KO mice.

CB₁ receptor gene inactivation in OPCs leads to motor and cognitive defects in young adult mice

To address whether the hypomyelinated phenotype observed in Ng2-CB₁KO mice is associated with behavioral alterations, we performed a battery of tests at P60. Ng2-CB₁KO mice showed reduced motor activity and coordination in the open field (Fig. 3A), beam walking (Fig. 3B), and Actitrack (Fig. 3C) tests compared to Ng2-CB₁WT mice. Ng2-CB₁KO also showed an anxiety-like behavior in the open field and elevated plus-maze (EPM) (Fig. 3A, D) tests, and memory deficits in the novel object recognition (NOR, Fig. 3E) and y-maze (Fig. 3F) tests. Altogether, these observations show that CB₁ receptor deficiency in OPCs at early postnatal ages causes hypomyelination at young adult ages, which is translated into impaired motor and memory functions, and anxiety-like behaviors.

**Fig. 3: Genetic inactivation of CB₁ receptor in OPCs causes motor and cognitive defects in young adult mice.**

CB₁ receptors modulate OPC differentiation through the RhoA/ROCK signaling axis

The Ras homolog family member A (RhoA) is a multifunctional small GTPase protein that has recently emerged as a central control point of OPC differentiation and OL maturation [22, 23]. RhoA, by stabilizing actin fibers, regulates cytoskeletal reorganization, thereby modulating the morphological changes necessary for OPC differentiation and OL maturation. Thus, activation of the RhoA/Rho-associated protein kinase (ROCK) signaling axis impedes OPC differentiation, and RhoA/ROCK inactivation promotes OPC differentiation in vitro [22, 24, 25], or under inhibitory conditions, such as in the presence of myelin [26], or following spinal cord injury [27] or hypoxia [28] in mice. Thus, we studied whether the aforementioned deficits in cell differentiation of CB₁ receptor deficiency in OPCs may be caused by an altered RhoA signaling. Western blot analysis revealed increased RhoA protein levels and increased activation of the RhoA downstream target ROCK, paralleled by a reduced activation of cofilin, in CC extracts from Ng2-CB₁KO mice (Fig. 4A). Immunofluorescence analysis in the developing CC corroborated the increased RhoA protein levels in Ng2/Ai6-CB₁KO OPCs compared to their Ng2/Ai6-CB₁HET controls (Fig. 4B). In line with these observations, acute THC administration (3 mg/kg, i.p.) to Ng2-CB₁WT mice reduced RhoA protein and ROCK activation levels, and increased cofilin activation levels, in CC extracts (Fig. 4C). Immunofluorescence analysis in the developing CC of Ng2-dsRed mice confirmed the reduced RhoA protein levels in THC-treated Ng2-dsRed⁺ OPCs compared to Veh-treated mice (Fig. 4D).

**Fig. 4: CB₁ receptor modulates the RhoA/ROCK₂ signaling in OPCs.**

To address the cell-autonomous action of THC in targeting RhoA selectively in OPCs through CB₁ receptors activation to drive oligodendrogenesis, we administered THC or Veh to Ng2-CB₁KO mice. THC failed to alter RhoA protein levels and activation of its downstream targets in CC extracts from Ng2-CB₁KO mice compared to Veh-treated animals (Fig. 4C). Similarly, immunofluorescence (Fig. 4E, G) and western blot (Fig. 4F) analyses revealed that THC enhanced OL differentiation and increased myelin-associated protein levels in the CC of Ng2-CB₁WT or Ng2/Ai6-CB₁HET control mice, but not in their Ng2-CB₁KO or Ng2/Ai6-CB₁KO littermates. These results indicate a cell-autonomous action of THC in inducing OPC differentiation and myelination in vivo through CB₁ receptors activation, at least in part, by targeting RhoA protein levels.

Modulation of protein stability by proteasomal degradation plays an important role in RhoA biological functions [29]. To explore the possibility that CB₁ receptors target proteasomal degradation to modulate RhoA protein levels we used a reversible proteasome inhibitor, MG-132. Thus, pretreatment with MG-132 prevented the THC-induced reduction in RhoA protein levels in CC extracts (Fig. 5A), as well as the THC-induced OL differentiation determined by immunofluorescence analysis in the CC of Ng2/Ai6-CB₁WT mice (Fig. 5B). We excluded the transcriptional modulation of RhoA by CB₁ receptors in OPCs, as we did not find differences in RhoA mRNA levels in CC extracts from acutely THC-treated mice compared to Veh-treated controls (Fig. 5C). THC-treated mice also exhibited a reduction in RhoA activity in CC extracts compared to Veh-treated controls (Fig. 5C), in line with the differences observed at RhoA protein levels. These results indicate that CB₁ receptors modulate OPC differentiation, at least in part, by regulating RhoA proteasomal degradation.

**Fig. 5: CB₁ receptor modulates OPC differentiation through RhoA proteasomal degradation.**

To further study the molecular mechanism of CB₁ receptor-mediated RhoA proteasomal degradation, we performed electroporation experiments in P2 pups from THC or Veh-treated mothers by using siRNAs against the three main E3 ubiquitin-protein ligases reported so far to target RhoA for proteasomal degradation, namely Smurf-1, Cullin-3 (CUL-3), and SCF^FBXL19 [30,31,32,33]. First, we observed that maternal THC administration during the early postnatal period indirectly induced OPC differentiation in pups´ CC (Fig. 5D). Then, we electroporated a control GFP reporter plasmid and quantified by immunofluorescence the percentage of CC1⁺ OLs within GFP⁺Olig2⁺ cells. This analysis revealed an enhanced oligodendrogenesis in siC-electroporated pups of THC-treated mothers compared to SiC-electroporated pups from Veh-treated mothers (Fig. 5E), confirming that maternal THC administration induced OPC differentiation in control pups. Moreover, we found that Smurf-1 and CUL-3 silencing prevented the THC-induced OPC differentiation in the developing CC (Fig. 5E), indicating that CB₁ receptor-mediated modulation of OPC differentiation requires E3 ubiquitin ligase-mediated RhoA proteasomal degradation.

ROCK inactivation overcomes the defects in oligodendrogenesis and functional myelination of CB₁ receptor deficient OPCs

To confirm the involvement of the RhoA/ROCK axis in the CB₁ receptor-mediated modulation of OPC differentiation, we analyzed the effect of inhibiting ROCK pharmacologically in vivo by administering the selective inhibitor Y-27632. CB₁ receptor deficiency was induced in Ng2-CB₁KO and Ng2/Ai6-CB₁KO and control mice, followed by Y-27632 or Veh administration (Fig. 6A). Immunofluorescence analysis in the developing CC confirmed a reduced proportion of CC1⁺ OLs within the Ai6⁺ population in Veh-treated Ng2/Ai6-CB₁KO mice compared to Veh-treated Ng2/Ai6-CB₁HET animals (Fig. 6B). Importantly, ROCK inhibition induced OPC differentiation in Ng2/Ai6-CB₁KO mice, rescuing CB₁ receptor-null OPC deficiency up to the levels found in Veh or Y-27632-treated Ng2/Ai6-CB₁HET littermates (Fig. 6B). Immunofluorescence (Fig. S5) and western blot (Fig. 6C) analysis of myelin-associated proteins evidenced that ROCK blockade also restored Ng2-CB₁KO myelin protein levels up to the levels of Ng2-CB₁WT-Veh or Y-27632-treated mice at both, postnatal and adult ages. Notably, we also found that ROCK pharmacological blockade overcame the motor and cognitive deficits observed in Ng2-CB₁KO mice at adult ages in the open field (Fig. 6D), beam walking (Fig. 6E), elevated plus-maze (EPM, Fig. 6F) and novel object recognition (NOR, Fig. 6G) tests. Altogether, these findings show that ROCK pharmacological inactivation overcomes the defects in oligodendrogenesis and functional CNS myelination of CB₁ receptor deficient OPCs during postnatal development in mice.

**Fig. 6: Pharmacological inactivation of ROCK overcomes the defects in oligodendrogenesis and myelination of CB₁ deficient OPC.**

Discussion

CB₁ receptors modulate OPC differentiation cell-autonomously

Here, by using new conditional mouse models, we provide the first evidence for a cell-autonomous role of CB₁ receptors in modulating OPC differentiation and OL development during postnatal myelination in mice. Our observations support the relevance of eCB signaling in the control of postnatal myelination through the activation of CB₁ receptors located on OPCs. However, mouse OPCs express CB₁ and CB₂ receptors at developmental stages [9], respond to THC administration in vivo (present study), and pharmacologically blocking either of the two receptors prevents THC effects [9]. Moreover, we show that THC administration to Ng2-CB₁KO mice fails to modulate oligodendrogenesis and postnatal myelination in the CC, addressing that CB₁ receptor expression in OPCs is strictly required for cannabinoid modulation of developmental oligodendrogenesis. Thus, the involvement of CB₂ receptors may be substantiated by the existence of a functional interaction between both receptors in OPCs, such as the CB₁-CB₂ heteromers observed in neuronal cells [34], or the non-cell autonomous modulation of oligodendrogenesis by CB₂ receptors. Therefore, our study also provides evidence for a cell-autonomous action of THC administration in modulating OPC differentiation and OL development in the CC during postnatal myelination in mice, and suggests that previous pharmacological studies based on the use of synthetic cannabinoids [8], phytocannabinoids [14] or eCBs [10] may have also involved the targeting of OPCs cell-autonomously to enhance OL development during postnatal myelination.

Our results show that genetic inactivation of CB₁ receptors in OPCs not only blocks cell differentiation, but also affects OL maturation and CNS myelination in the CC. These data are in line with previous findings in which administration of cannabinoid agonists induce OPC differentiation and enhance OL maturation and CNS myelination [8, 10, 15]. As premature and mature OLs derived from CB₁ receptor deficient OPCs shall inherit genetic depletion of CB₁ receptor, we cannot exclude the possibility that some of the observed maturation defects arise from an altered OPC differentiation. Thus, assessing the selective action of CB₁ receptors in modulating OL maturation and myelin formation would require the generation of selective premature/mature OL Cre-dependent mouse models.

CB₁ receptor-mediated RhoA proteasomal degradation in OPCs

The CB₁ receptor is one of the most abundant G protein-coupled receptors (GPCRs) in the mammalian brain. To date, other GPCRs, such as GPR17 [35], GPR37 [36], GPR56 [37], and GPR126 [38] have been shown to modulate OL development and/or CNS myelination. Thus, our present study adds evidence for GPCRs in modulating oligodendrogenesis and myelination. Mechanistically, GPR37 regulates OPC differentiation and CNS myelination via cAMP-dependent Ras-ERK1/2 activation [39], while GPR56 modulates OPC proliferation via Gα12/13-RhoA, without affecting OL differentiation. Here, we observed that the CB₁ receptor-mediated modulation of OPC differentiation occurs by inducing Smurf-1/CUL-3-mediated RhoA proteasomal degradation. Thus, CB₁ receptors may modulate RhoA proteasomal degradation by targeting both, the inactive (GDP-bound) and the active (GTP-bound) forms of RhoA by CUL₃ and Smurf-1 respectively [29]. Indeed, pharmacological activation of CB₁ receptor has been shown to induce RhoA proteasomal degradation in migrating pyramidal neurons during mouse corticogenesis [40]. Therefore, it is plausible to speculate that CB₁ receptor-mediated RhoA degradation under those settings may involve Smurf-1 or CUL-3 actions (Fig. S6). Moreover, CB₁ receptors may exert opposing effects regarding RhoA activation. CB₁ receptors activation promote bone marrow-derived macrophage migration or phagocytosis [41,42,43] by increasing RhoA activity and subsequent ROCK activation via Gαi/o, but also via Gα12/13, in neurons [44] or platelets [45]. Conversely, CB₁ receptors also inhibit carcinoma cell migration [46] by reducing RhoA activity, indicating that the differential CB₁ receptor-modulation of RhoA signaling may depend on factors such as the cell type and the pathophysiological context.

CB₁ receptors in OPCs and motor and cognitive development

Here, we also reveal that CB₁ receptor deficiency in OPCs at early postnatal ages affects the number and maturation state of the OL population in the CC in young adult mice, which is also associated with hypomyelination in several CNS regions and important behavioral deficits. In line with these results, increasing evidence has linked deregulated developmental myelination to impaired functional performance or neuropsychiatric alterations in adult mice [3, 47], such as those related with motor function [48, 49], memory [50], and anxiety-like behaviors [51,52,53]. Thus, it is plausible that the altered behavioral traits found in Ng2-CB₁KO mice is due to a reduced number of myelinating OLs, and, thereby, to reduced myelin levels in CNS regions responsible for motor, memory, anxiety-like behaviors, which, in turn, would impact neuronal and whole-body functionality. In fact, alterations of the eCNB system during embryonic, postnatal, or adolescent ages evokes multiple long-lasting behavioral alterations in mice that persist in adulthood [54, 55]. Moreover, THC exposure during embryonic or postnatal development has been linked to psychiatric disorders, such as depression and anxiety [56, 57], spontaneous behavior, or habituation [58, 59], thus suggesting that, in addition to the neuronal component, at least part of these behavioral defects are mediated by the restricted OPC CB₁ receptor population.

Conversely, on top of the observed behavioral alterations in complete CB₁ receptor-deficient mice [54], the development of mouse models with CB₁ receptors selectively deleted in dorsal telencephalic glutamatergic neurons or forebrain GABAergic neurons have contributed to dissect the populations of neuronal CB₁ receptors responsible for the modulation of motor, memory, anxiety-like behaviors [60,61,62]. To sum up, this is the first study that supports the necessary role for CB₁ receptors located on OPCs in the modulation of motor and cognitive development in mice, therefore contributing to understand the complex control of motor and cognitive development exerted by the eCB system.

The therapeutic potential of targeting OPC CB₁ receptors in demyelinating disorders

A number of studies have pointed out important similarities in the effects of molecules that modulate OPC differentiation during postnatal myelination and during remyelination [63, 64]. Specifically, cannabinoids modulate oligodendrogenesis under demyelinating conditions, enhancing OL regeneration, and functional CNS remyelination following cuprizone-induced demyelination [14], or in the TMEV animal model of progressive MS [12, 13], thus suggesting that CB₁ receptors also modulate OPC differentiation under demyelinating conditions. In MS, there is a failure in OPC differentiation, which limits their remyelinating potential. Although the cause of this failure is not completely known, several studies have denoted the presence of inhibitory signals in the demyelinated CNS that prevent OPC to become mature myelinating cells. Indeed, inhibition of OPC differentiation or OL maturation by myelin debris [26], or by astrocytic chondroitin sulfate proteoglycans [27, 65], are mediated by RhoA/ROCK axis modulation [23]. Moreover, elevated levels of the eCB 2-AG upon pharmacological inhibition of MAGL reduces astrocytic chondroitin sulfate proteoglycan production and enhances OL differentiation under inhibitory conditions [12]. Thus, it is plausible that, following demyelination, CB₁ receptor-mediated modulation of RhoA signaling controls OPC differentiation and functional remyelination in a cell-autonomous manner though OPC CB₁ receptors, but also non-cell-autonomously through astroglial CB₁ receptors. In any event, the CB₁ receptor-evoked control of RhoA signaling could be potentially targeted to promote functional recovery, which would open new avenues to the therapeutic manipulation of currently intractable demyelinating diseases.

Materials and methods

Animal procedures

Experimental designs and procedures were approved by the Complutense University Animal Research Committee and Comunidad de Madrid, in accordance with the European Commission regulations (Directive 2010/63/EU), and addressing the issues raised in ‘Implementing guidelines on reporting research using animals (ARRIVE) guidelines. All animals used were bred into C57BL/6 J background. Animals were housed, three in a cage, in temperature-controlled rooms on an artificial 12-h light/dark cycle at 22–24 °C and relative humidity of 50–60%, with water, food availability ad libitum and sterile cardboard tubes as a housing refinement. All mice were pathogen free. Jackson Laboratories (Bar Harbor, ME, USA) mouse lines used: Ng2-dsRed (Cspg4-DsRed.T1 1Akik/J Cat# RRID:IMSR_JAX:008241) [18], Ng2-CreERT2 [18], Pdgfrα-creERT2 (RRID:IMSR_JAX:018280 [21], Rosa-Stop-Ai6, RRID:IMSR_JAX:007906) [19], CB₁^ff (IMSR Cat# JAX:036107, RRID:IMSR_JAX:036107 [17] and CD1 mice. Mice were bred to finally generate Ng2-CB₁KO mice (containing homozygous CB₁-floxed/floxed alleles and heterozygous Ng2-CreERT2 allele), Ng2-CB₁WT (containing homozygous CB₁-floxed/floxed alleles and negative for Ng2-CreERT2 allele), Pdgfrα-CB₁KO mice (containing homozygous CB₁-floxed/floxed alleles and heterozygous Pdgfrα-CreERT2 allele), Pdgfrα-CB₁WT mice (containing homozygous CB₁-floxed/floxed alleles and negative for Pdgfrα-CreERT2 allele), Ng2/Ai6-CB₁KO mice (containing homozygous CB₁-floxed/floxed alleles, homozygous ROSA-stop-Ai6 alleles and heterozygous Ng2-CreERT2 allele), Ng2/Ai6-CB₁HET mice (containing heterozygous CB₁-floxed alleles, homozygous ROSA-stop-Ai6 alleles and heterozygous Ng2-CreERT2 allele), and Ng2/Ai6-CB₁WT mice (containing homozygous CB₁-WT alleles, homozygous ROSA-stop-Ai6 alleles and heterozygous Ng2-CreERT2 allele) (in C57BL/6 N background). Of note, Ng2/Ai6-CB₁HET mice were used as controls for Ng2/Ai6-CB₁KO mice, by crossing CB₁HET x CB₁KO mice, to obtain a higher number of littermates of the same litter, as the dynamics of oligodendrogenesis in Ng2/Ai6-CB₁HET mice were similar to Ng2/Ai6-CB₁WT mice in immunofluorescence studies (not shown). Delta-9-tetrahydrocannabinol (THC, 3 mg/kg), MG-132 (5 mg/kg, Medchem, NJ, USA), or vehicle, were dissolved in 100 μL Tween-80/NaCl (1:18, v/v) and 1% (v/v) of dimethyl sulfoxide [9]. MG-132 was administered intraperitoneally 30 min before THC. In maternal THC administration experiments, we confirmed CB₁ receptors activation in the CNS of pups at 4 h after administering THC or Veh to mothers by analyzing pS6 and cFos levels (not shown). Y27632 (10 mg/kg, Medchem, Monmouth Junction, NJ, USA) was dissolved in saline and administered intraperitoneally. Recombination was induced by tamoxifen (Tam; 24 h apart; 37.5 mg/kg i.p. dissolved in Ethanol-sunflower oil 1:9). Experiments included male and female mice.

Fluorescent-activated cell sorting

Rosa-Ai6⁺ cells were isolated from Ng2/Ai6-CB1KO and Ng2/Ai6-CB1HET at postnatal day 10, after two tamoxifen injections (37.5 mg/kg), at P6 and p7, as previously described [20]. Briefly, CC was dissected following a second step of dissociation using papain (30 μg/ml in DMEM-Glutamax, with 0.24 μg/ml L-cystein and 40 μg/ml DNase I) and cells were put on a preformed 30% Percoll density gradient before centrifugation for 15 min. Rosa-Ai6⁺ cells were FACS sorted on an FACS Aria II (BD Biosciences). Propidium iodide (PI) was used to exclude dead cells. For genomic analysis, cells were washed twice in PBS 1×, then the dry cell pellets were frozen at −80 °C.

Electroporation experiments

siRNAs purchased from Santa Cruz (Dallas, TX, USA), siC (SC-37007) siSmurf-1 (ref: sc-41674), siCUL-3 (ref: sc-35131), SCF^FBXL19 (39393) were electroporated into postnatal day 2 (P2) CD1 pups. Vectors were diluted at 1 μg/μl in PBS with 2.5 mg/ml fast green (Sigma, St Louis, MO, USA) and injected, together with a constitutive GFP overexpression plasmid (pCAG-GFP), in the lumen of the diencephalic ventricle. Electroporation was performed with a BTX electroporator (Holliston, MA, USA) with these parameters: 5 pulses, intensity = 95 V, pulse length = 50 ms, inter-pulse interval = 50 ms. The same day of electroporation, mothers received THC (3 mg/kg) or Veh administrations, once a day for 14 days. Efficient silencing of ubiquitin ligases was confirmed by immunofluorescence analysis at 4 days after electroporation, by using anti-Smurf-1, anti-CUL-3 and anti-SCF^FBXL19 antibodies for each experimental condition (not shown).

Immunofluorescence

Brain tissue was processed as previously described [66]. Briefly, mice were perfused transcardially with 4% paraformaldehyde (PFA), and brains postfixed overnight in 4% PFA and treated with 30% sucrose before freezing. 30-μm-thick coronal free-floating brain cryosections were washed in PBS, blocked with 10% goat serum, and incubated with the indicated primary antibodies (overnight at 4 °C). When needed, antigen retrieval immunostaining was performed with citric acid (10 mM, pH 6, 65 °C for 30 min) or with retrieve-all antigen unmasking system 3. Acidic (Biolegend) at 92 °C for 10 min. For immunofluorescence analysis in vitro, CC extracts from P10 Ng2/Ai6-CB₁KO and Ng2/Ai6-CB₁WT mice administered with tamoxifen (37.5 mg/kg) at P6 and P7, was dissociated, and individual cells were attached to glass slides by cytospin. After air-drying, slides were treated with 4% PFA for 10 minutes. The primary antibodies used are as follows, anti-CB1R (1:500, Frontier Institute, CB₁-GP-Af530), anti-CC1 (1:400, Millipore, Cat#OP80, RRID:AB_2057371), anti‐Olig2 (1:250, Millipore Burlington, MA, USA) Cat# AB9610, RRID:AB_570666), anti‐GSTπ (1:200, MBL International Cat# 312, RRID:AB_591792, Wobrun, MA, USA), anti-MBP (1:200, BioLegend, (San Diego, CA, USA) Cat# 836504, RRID:AB_2616694), anti-NG2, (1:200, MBL International, Cat# AB5320, RRID:AB_11213678), anti‐PLP (1:500, Abcam (Waltham, MA, USA), Cat#ab28486, RRID:AB_776593), RhoA (1:500, Cytosqueleton (Denver, CO, USA) Cat# ARH03, RRID:AB_10708069), Nav1.6 (1:300, Alobome labs (Jerusalem, Israel), Cat# ASC-009, RRID:AB_2040202), Caspr (1:300, Millipore, Cat# MABN69, RRID:AB_10806491) FluoroMyelin (1:300, Thermo Fisher Scientific (Waltham, MA, USA) Cat# F34652, RRID:AB_2572213). Nuclei were visualized with DAPI. The appropriate mouse, rabbit or guinea pig highly cross-adsorbed Alexa Fluor 488, 594, and 647 secondary antibodies (1:1000, Invitrogen, Waltham, MA, USA) were used.

Confocal microscopy

Optical sections (z = 0.5 µm) of confocal epifluorescence images were sequentially acquired using a confocal laser-scanning microscope TCS-SP8 (20×, 40× and 63×, Leica DMI6000 B instrument) and Leica Application Suite X (LAS X) software. Images were acquired in the CC of each animal, a minimum of six correlative slices from a 1-in-10 series located between +0.7 and −0.5 mm from bregma were analysed. Cell counts were performed blindly using ImageJ software (NIH) in the corpus callosum (CC) and data are presented as the mean cell number per mm² or as a percentage of positive cells. For CB₁ inmunostaining of cytospined cells, the microscope was configured to capture 16 images following the z axis, which resulted in 8 µm thick stacks.

Electron microscopy

Mice were transcardially perfused with PBS followed by a fixative solution containing 4% PFA, 2.5% glutaraldehyde, and 0.5% NaCl in 0.1 M PB, as described [67]. Brains were postfixed overnight at 4 °C and stored in 1% paraformaldehyde. Vibratome sections (100 µm) containing the CC were cut in the coronal plane on a vibratome (VT1000S, Leica (Wetzlar, Germany) and incubated in 1% OsO4, then embedded in epoxy resin overnight to polymerize at 60˚C, and then trimmed and glued onto epoxy resin capsules. Semi‐thin sections (500 nm) were cut using a Power Tome ultramicrotome (RMC Boeckeler) and stained with 1% toluidine blue. Ultrathin (60 nm) sections were cut with a diamond knife (Diatome), collected on nickel mesh grids, and stained with 4% uranyl acetate and 2.5% lead citrate for electron microscope visualization. Electron microscopy images of the rostral CC were taken from randomly selected fields with a Jeol JEM Plus electron microscope at the Service of Analytical and High-Resolution Microscopy in Biomedicine of University of the Basque Country UPV/EHU. The mean number of myelinated axons was analyzed in 10 non-serial electron micrographs per animal taken systematically at a magnification of 5,000×.

Sudan black

Floating sections were mounted on to TESPA-coated glass slides, dehydrated in 70% ethanol and stained with 0.5% Sudan Black in 70% ethanol for 20 min. Excess staining was removed by washing the slides in 70% ethanol and finally rinsed with water. Samples were observed under light microscopy in a Zeiss Axioplan2 microscope.

Western blot

CC tissue was microdissected from 500-μm-thick coronal sections and proteins were extracted using RIPA buffer (SDS 0.1%, Sodium deoxycholate 0.5%, NP40 1%, NaCl 150 mM, Tris-HCl 50 mM pH8 in PBS) containing PMSF, protease inhibitors, and sodium orthovanadate. Protein samples were separated on 12% acrylamide (Bio-Rad) gels and transferred to polyvinylidene difluoride (PVDF membranes (Millipore). Membranes were placed in blocking buffer (5% w/v BSA in TBS-T + Azida 0.02%) and probed with primary antibodies overnight at 4 °C. The primary antibodies used are as follows: anti-MAG (1:1000, Abcam, Cat#ab89780, RRID:AB_2042411), anti-MOG (1:2000, Abcam Cat#ab32760, RRID:AB_2145529), anti-MBP (1:1000, BioLegend, Cat#836504, RRID:AB_2616694), RhoA (1:500, Cytosqueleton Cat# ARH03, RRID:AB_10708069), pROCK₂ (1:750, Genetex, Hsinchu City, Taiwan Cat# GTX122651, RRID:AB_2560946), pCofilin (1:500, Cell Signaling Technology Cat# 3313, RRID:AB_2080597) and anti-α-tubulin (1:5000, Sigma-Aldrich, Cat#T9026, RRID:AB_477593). After incubation with corresponding HRP-conjugated secondary antibody proteins were visualized using an enhanced chemiluminescence substrate mixture (ECL Plus; GE Healthcare; Santa Cruz Biotechnology; 1:5000). Band intensity of films was quantified using Adobe Photoshop software. Protein levels were normalized to the internal control α-tubulin. See full length uncropped original western blots in supplemental material.

Quantitative PCR

RNA was isolated using RNeasy Plus kit (Quiagen). cDNA was obtained with Transcriptor (Roche). Real-time quantitative PCR (qPCR) assays were performed using the FastStart Master Mix with Rox (Roche, Basel, Switzerland) and probes were obtained from the Universal Probe Library Set (Roche). Amplifications were run in a 7900 HT-Fast Real-Time PCR System (Applied Biosystems). The sequence of primers used are as follows: F-β-ACTIN: AAGGCCAACCGTGAAAAGAT; R-β-ACTIN: GTGGTACGACCAGAGGCATAC; F-MAG: GGTGTTGAGGGAGGCAGTTG; R-MAG: CGTTGTCTGCTAGGCAAGCA; F-MBP: GGAAGGCAGGTGATGGTTGA; R-MBP: ACACTGGAGGGCAAACACTC; F-MOG: TCCATCGGACTTTTGATCCTCA; R-MOG: GCTCCAGGAAGACACAACCA; F-RhoA: GAATGACGAGCACACGAGAC; R-RhoA: AAAAGCGCCAATCCTGTTT; F-TBP: GGGGAGCTGTGATGTGAAGT; R-TBP: CCAGGAAATAATTCTGGCTCA Each value was adjusted by using β-actin and TBP mRNA levels as reference.

Genomic recombination analysis

Recombination was tested by PCR with genomic DNA isolated from sorted Rosa-Ai6 cells by the use of the GenElute mammalian genomic DNA Miniprep Kit (Sigma-Aldrich), as previously described [68]. PCR was performed using Taq DNA polymerase (Thermo Fisher Scientific, Inc.) For the recombined CB1 allele we used the forward primer 5′-GCTGTCTCTGGTCCTCTTAAA-3′ (G50) and the reverse primer 5′-CTCCTGTATGCCATAGCTCTT-3′ (G53) resulting in a 600 bp fragment.

RhoA activity essay

Dissected corpus callosum extracts were processed for active RhoA quantification with the G-LISA kit (Cytoskeleton, Cat#BK124) following manufacturer’s guide.

Behavioral assessments

All tests were conducted during the light cycle, with uniform lighting conditions and white noise in an isolated room. Animals were acclimated to the room for 45–60 min before testing. Beam walking test: To evaluate fine motor coordination, mice were trained to cross a narrow wood beam (100 cm length, 10 and 7 mm width) [69]. Open-field test: Mice were placed in the center of an open-field arena (70 × 70 × 40 cm) and allowed to freely explore it for 5 min. Behavior was recorded with a video camera placed above and the video tracking software SMART 3.0 (Panlab, Spain) was used for analysis [70]. Novel Object Recognition test (NOR): The day before the test, mice were habituated to an empty open-field arena for 10 min. The day of the test, mice were allowed to freely explore the arena with two identical objects for 10 min and, after 2 hours, mice could explore the arena containing a familiar object and a novel object. Discrimination index was calculated as the difference in exploration time between the novel and familiar object divided from the total exploration time and expressed as a percentage. Preference Index was calculated as the percentage of exploration time spent examining the novel object over the total exploration time. Modified Y-Maze test: Mice were allowed to explore the maze with one of the three arms closed for 3 min. After an inter-trial interval of 5 min, mice could freely explore all three arms of the maze for 3 min, and the time spent in each arm was registered. Actimeter/ Locomotor activity test: Spontaneous motor activity was evaluated using an automated actimeter (Acti-Track; Panlab, Barcelona, Spain). This consisted of a 22.5 × 22.5 cm area with 16 surrounding infrared beams coupled to a computerized control unit. After 1 min of habituation, activity was recorded for a period of 5 min and data were collected with Acti-Track v2.7 software (Panlab, Barcelona, Spain). Elevated plus-maze test (EPM): Mice were placed in the center of the maze (two open arms and two closed arms of 30 ×7 cm arranged orthogonally 60 cm above the floor) and allowed to explore it for 5 min. The test was conducted under red light conditions.

Statistics

The n number of animals per group or experiments per condition is indicated in every case. The declared group size is the number of independent data points, and that statistical analysis was done using these independent data points. Studies were designed to generate groups of equal size, using randomisation and blinded analysis. The numbers illustrated represent the animals used in each of the experiments, after considering any unexpected loss of data or exclusion criterion. In some cases, experimental losses may be determined by animals receiving the wrong treatment, infections unrelated to the experiment, sampling errors (e.g., inadequate calibration of equipment, software error during acquisition), or other human error (e.g., forgetting to switch on equipment). Power analysis was conducted with IBM SPSS software (IBM France, Bois-Colombes, France). Sample sizes were based on our prior studies where similar sample sizes were adequately powered to detect significant differences. All variables were first tested for both, normality (Shapiro test or D’Agostino & Pearson normality test with p > 0.05) and homogeneity of variances (Brown-Forsythe test with p > 0.05). When comparing two groups we use unpaired two-tailed t-test for normal distribution (unpaired t-tests were Welch-corrected if needed) or Mann-Whitney test when they did not distribute normally. For comparisons of more than two groups, if data were found to be normally distributed, one-way ANOVA followed by Tukey’s post hoc test was carried out. The post hoc tests were conducted only if F in ANOVA achieved P < 0.05 and there was no significant variance in homogeneity. If data were found to not be normally distributed, then a Kruskal–Wallis one-way ANOVA with uncorrected Dunn’s post hoc test was carried out. For data from Figs. 4E and 6, two-way ANOVA followed by Tukey’s post hoc test was carried out. Differences with p < 0.05 between group means were considered statistically significant. All data analyses were done using GraphPad Prism 7.00.

Data availability

All data generated or analyzed during this study are available in the supporting information.

References

Bercury KK, Macklin WB. Dynamics and mechanisms of CNS myelination. Dev Cell. 2015;32:447–58.
Article CAS PubMed PubMed Central Google Scholar
Fields RD. Oligodendrocytes changing the rules: action potentials in glia and oligodendrocytes controlling action potentials. Neuroscientist 2008;14:540–3.
Article PubMed PubMed Central Google Scholar
Nave KA, Ehrenreich H. Myelination and oligodendrocyte functions in psychiatric diseases. JAMA Psychiatry. 2014;71:582–4.
Article PubMed Google Scholar
Haroutunian V, Katsel P, Roussos P, Davis KL, Altshuler LL, Bartzokis G. Myelination, oligodendrocytes, and serious mental illness. Glia 2014;62:1856–77.
Article CAS PubMed Google Scholar
Elbaz B, Popko B. Molecular control of oligodendrocyte development. Trends Neurosci. 2019;42:263–77.
Article CAS PubMed PubMed Central Google Scholar
Molina-Holgado E, Vela JM, Arevalo-Martin A, Almazan G, Molina-Holgado F, Borrell J, et al. Cannabinoids promote oligodendrocyte progenitor survival: involvement of cannabinoid receptors and phosphatidylinositol-3 kinase/Akt signaling. J Neurosci. 2002;22:9742–53.
Article CAS PubMed PubMed Central Google Scholar
Ilyasov AA, Milligan CE, Pharr EP, Howlett AC. The endocannabinoid system and oligodendrocytes in health and disease. Front Neurosci. 2018;12:733.
Article PubMed PubMed Central Google Scholar
Arevalo-Martin A, Garcia-Ovejero D, Rubio-Araiz A, Gomez O, Molina-Holgado F, Molina-Holgado E. Cannabinoids modulate Olig2 and polysialylated neural cell adhesion molecule expression in the subventricular zone of post-natal rats through cannabinoid receptor 1 and cannabinoid receptor 2. Eur J Neurosci. 2007;26:1548–59.
Article PubMed Google Scholar
Huerga-Gomez A, Aguado T, Sanchez-de la Torre A, Bernal-Chico A, Matute C, Mato S, et al. Delta(9) -Tetrahydrocannabinol promotes oligodendrocyte development and CNS myelination in vivo. Glia. 2020.
Alpar A, Tortoriello G, Calvigioni D, Niphakis MJ, Milenkovic I, Bakker J, et al. Endocannabinoids modulate cortical development by configuring Slit2/Robo1 signalling. Nat Commun. 2014;5:4421.
Article CAS PubMed Google Scholar
Gomez O, Arevalo-Martin A, Garcia-Ovejero D, Ortega-Gutierrez S, Cisneros JA, Almazan G, et al. The constitutive production of the endocannabinoid 2-arachidonoylglycerol participates in oligodendrocyte differentiation. Glia 2010;58:1913–27.
Article PubMed Google Scholar
Feliu A, Mestre L, Carrillo-Salinas FJ, Yong VW, Mecha M, Guaza C. 2-arachidonoylglycerol reduces chondroitin sulphate proteoglycan production by astrocytes and enhances oligodendrocyte differentiation under inhibitory conditions. Glia 2020;68:1255–73.
Article PubMed Google Scholar
Feliu A, Bonilla Del Rio I, Carrillo-Salinas FJ, Hernandez-Torres G, Mestre L, Puente N, et al. 2-Arachidonoylglycerol reduces proteoglycans and enhances remyelination in a progressive model of demyelination. J Neurosci. 2017;37:8385–98.
Article CAS PubMed PubMed Central Google Scholar
Aguado T, Huerga-Gomez A, Sanchez-de la Torre A, Resel E, Chara JC, Matute C, et al. Delta(9) -Tetrahydrocannabinol promotes functional remyelination in the mouse brain. Br J Pharm. 2021;178:4176–92.
Article CAS Google Scholar
Ceprian M, Vargas C, Garcia-Toscano L, Penna F, Jimenez-Sanchez L, Achicallende S, et al. Cannabidiol administration prevents hypoxia-ischemia-induced hypomyelination in newborn rats. Front Pharm. 2019;10:1131.
Article CAS Google Scholar
Di Marzo V, Stella N, Zimmer A. Endocannabinoid signalling and the deteriorating brain. Nat Rev Neurosci. 2015;16:30–42.
Article PubMed PubMed Central CAS Google Scholar
Marsicano G, Goodenough S, Monory K, Hermann H, Eder M, Cannich A, et al. CB1 cannabinoid receptors and on-demand defense against excitotoxicity. Science 2003;302:84–8.
Article CAS PubMed Google Scholar
Zhu X, Bergles DE, Nishiyama A. NG2 cells generate both oligodendrocytes and gray matter astrocytes. Development 2008;135:145–57.
Article CAS PubMed Google Scholar
Madisen L, Zwingman TA, Sunkin SM, Oh SW, Zariwala HA, Gu H, et al. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat Neurosci. 2010;13:133–40.
Article CAS PubMed Google Scholar
Zimmermann T, Maroso M, Beer A, Baddenhausen S, Ludewig S, Fan W, et al. Neural stem cell lineage-specific cannabinoid type-1 receptor regulates neurogenesis and plasticity in the adult mouse hippocampus. Cereb Cortex. 2018;28:4454–71.
Article PubMed PubMed Central Google Scholar
Rivers LE, Young KM, Rizzi M, Jamen F, Psachoulia K, Wade A, et al. PDGFRA/NG2 glia generate myelinating oligodendrocytes and piriform projection neurons in adult mice. Nat Neurosci. 2008;11:1392–401.
Article CAS PubMed Google Scholar
Liang X, Draghi NA, Resh MD. Signaling from integrins to Fyn to Rho family GTPases regulates morphologic differentiation of oligodendrocytes. J Neurosci. 2004;24:7140–9.
Article CAS PubMed PubMed Central Google Scholar
Harlow DE, Macklin WB. Inhibitors of myelination: ECM changes, CSPGs and PTPs. Exp Neurol. 2014;251:39–46.
Article CAS PubMed Google Scholar
Zhao CF, Liu Y, Que HP, Yang SG, Liu T, Liu ZQ, et al. Rnh1 promotes differentiation and myelination via RhoA in oligodendrocytes. Cell Tissue Res. 2013;353:381–9.
Article CAS PubMed Google Scholar
Pedraza CE, Taylor C, Pereira A, Seng M, Tham CS, Izrael M, et al. Induction of oligodendrocyte differentiation and in vitro myelination by inhibition of rho-associated kinase. ASN Neuro. 2014;6.
Baer AS, Syed YA, Kang SU, Mitteregger D, Vig R, Ffrench-Constant C, et al. Myelin-mediated inhibition of oligodendrocyte precursor differentiation can be overcome by pharmacological modulation of Fyn-RhoA and protein kinase C signalling. Brain 2009;132:465–81.
Article PubMed PubMed Central Google Scholar
Dyck SM, Alizadeh A, Santhosh KT, Proulx EH, Wu CL, Karimi-Abdolrezaee S. Chondroitin sulfate proteoglycans negatively modulate spinal cord neural precursor cells by signaling through LAR and RPTPsigma and modulation of the Rho/ROCK pathway. Stem Cells. 2015;33:2550–63.
Article CAS PubMed Google Scholar
Wang F, Yang YJ, Yang N, Chen XJ, Huang NX, Zhang J, et al. Enhancing oligodendrocyte myelination rescues synaptic loss and improves functional recovery after chronic hypoxia. Neuron 2018;99:689–701 e5.
Article CAS PubMed PubMed Central Google Scholar
Nethe M, Hordijk PL. The role of ubiquitylation and degradation in RhoGTPase signalling. J Cell Sci. 2010;123:4011–8.
Article CAS PubMed Google Scholar
Petroski MD, Deshaies RJ. Function and regulation of cullin-RING ubiquitin ligases. Nat Rev Mol Cell Biol. 2005;6:9–20.
Article CAS PubMed Google Scholar
Ding F, Yin Z, Wang HR. Ubiquitination in Rho signaling. Curr Top Med Chem. 2011;11:2879–87.
Article CAS PubMed Google Scholar
Wei J, Mialki RK, Dong S, Khoo A, Mallampalli RK, Zhao Y, et al. A new mechanism of RhoA ubiquitination and degradation: roles of SCF(FBXL19) E3 ligase and Erk2. Biochim Biophys Acta. 2013;1833:2757–64.
Article CAS PubMed Google Scholar
Wang HR, Ogunjimi AA, Zhang Y, Ozdamar B, Bose R, Wrana JL. Degradation of RhoA by Smurf1 ubiquitin ligase. Methods Enzymol. 2006;406:437–47.
Article CAS PubMed Google Scholar
Callen L, Moreno E, Barroso-Chinea P, Moreno-Delgado D, Cortes A, Mallol J, et al. Cannabinoid receptors CB1 and CB2 form functional heteromers in brain. J Biol Chem. 2012;287:20851–65.
Article CAS PubMed PubMed Central Google Scholar
Lecca D, Raffaele S, Abbracchio MP, Fumagalli M. Regulation and signaling of the GPR17 receptor in oligodendroglial cells. Glia. 2020;68:1957–67.
Article PubMed Google Scholar
Smith BM, Giddens MM, Neil J, Owino S, Nguyen TT, Duong D, et al. Mice lacking Gpr37 exhibit decreased expression of the myelin-associated glycoprotein MAG and increased susceptibility to demyelination. Neuroscience 2017;358:49–57.
Article CAS PubMed Google Scholar
Ackerman SD, Garcia C, Piao X, Gutmann DH, Monk KR. The adhesion GPCR Gpr56 regulates oligodendrocyte development via interactions with Galpha12/13 and RhoA. Nat Commun. 2015;6:6122.
Article CAS PubMed Google Scholar
Lyons DA, Talbot WS. Glial cell development and function in zebrafish. Cold Spring Harb Perspect Biol. 2014;7:a020586.
Article PubMed Google Scholar
Yang HJ, Vainshtein A, Maik-Rachline G, Peles E. G protein-coupled receptor 37 is a negative regulator of oligodendrocyte differentiation and myelination. Nat Commun. 2016;7:10884.
Article CAS PubMed PubMed Central Google Scholar
Diaz-Alonso J, de Salas-Quiroga A, Paraiso-Luna J, Garcia-Rincon D, Garcez PP, Parsons M, et al. Loss of cannabinoid CB1 receptors induces cortical migration malformations and increases seizure susceptibility. Cereb Cortex. 2017;27:5303–17.
PubMed Google Scholar
Mai P, Tian L, Yang L, Wang L, Yang L, Li L. Cannabinoid receptor 1 but not 2 mediates macrophage phagocytosis by G(alpha)i/o /RhoA/ROCK signaling pathway. J Cell Physiol. 2015;230:1640–50.
Article CAS PubMed Google Scholar
Mai P, Yang L, Tian L, Wang L, Jia S, Zhang Y, et al. Endocannabinoid system contributes to liver injury and inflammation by activation of bone marrow-derived monocytes/macrophages in a CB1-dependent manner. J Immunol. 2015;195:3390–401.
Article CAS PubMed Google Scholar
Wang L, Yang L, Tian L, Mai P, Jia S, Yang L, et al. Cannabinoid receptor 1 mediates homing of bone marrow-derived mesenchymal stem cells triggered by chronic liver injury. J Cell Physiol. 2017;232:110–21.
Article CAS PubMed Google Scholar
Dalton GD, Peterson LJ, Howlett AC. CB(1) cannabinoid receptors promote maximal FAK catalytic activity by stimulating cooperative signaling between receptor tyrosine kinases and integrins in neuronal cells. Cell Signal. 2013;25:1665–77.
Article CAS PubMed PubMed Central Google Scholar
Signorello MG, Giacobbe E, Passalacqua M, Leoncini G. The 2-arachidonoylglycerol effect on myosin light chain phosphorylation in human platelets. Biochimie 2013;95:1620–8.
Article CAS PubMed Google Scholar
Nithipatikom K, Gomez-Granados AD, Tang AT, Pfeiffer AW, Williams CL, Campbell WB. Cannabinoid receptor type 1 (CB1) activation inhibits small GTPase RhoA activity and regulates motility of prostate carcinoma cells. Endocrinology 2012;153:29–41.
Article CAS PubMed Google Scholar
Fields RD. White matter in learning, cognition and psychiatric disorders. Trends Neurosci. 2008;31:361–70.
Article CAS PubMed PubMed Central Google Scholar
Ishii A, Furusho M, Dupree JL, Bansal R. Role of ERK1/2 MAPK signaling in the maintenance of myelin and axonal integrity in the adult CNS. J Neurosci. 2014;34:16031–45.
Article PubMed PubMed Central CAS Google Scholar
Schneider S, Gruart A, Grade S, Zhang Y, Kroger S, Kirchhoff F, et al. Decrease in newly generated oligodendrocytes leads to motor dysfunctions and changed myelin structures that can be rescued by transplanted cells. Glia 2016;64:2201–18.
Article PubMed Google Scholar
Poggi G, Boretius S, Mobius W, Moschny N, Baudewig J, Ruhwedel T, et al. Cortical network dysfunction caused by a subtle defect of myelination. Glia 2016;64:2025–40.
Article PubMed PubMed Central Google Scholar
Carson RP, Kelm ND, West KL, Does MD, Fu C, Weaver G, et al. Hypomyelination following deletion of Tsc2 in oligodendrocyte precursors. Ann Clin Transl Neurol. 2015;2:1041–54.
Article CAS PubMed PubMed Central Google Scholar
Chen X, Zhang W, Li T, Guo Y, Tian Y, Wang F, et al. Impairment of oligodendroglia maturation leads to aberrantly increased cortical glutamate and anxiety-like behaviors in juvenile mice. Front Cell Neurosci. 2015;9:467.
Article PubMed PubMed Central Google Scholar
Roy K, Murtie JC, El-Khodor BF, Edgar N, Sardi SP, Hooks BM, et al. Loss of erbB signaling in oligodendrocytes alters myelin and dopaminergic function, a potential mechanism for neuropsychiatric disorders. Proc Natl Acad Sci USA. 2007;104:8131–6.
Article CAS PubMed PubMed Central Google Scholar
Martinez LR, Black KC, Webb BT, Bell A, Baygani SK, Mier TJ, et al. Components of endocannabinoid signaling system are expressed in the perinatal mouse cerebellum and required for its normal development. eNeuro. 2020;7.
Diaz-Alonso J, Aguado T, Wu CS, Palazuelos J, Hofmann C, Garcez P, et al. The CB(1) cannabinoid receptor drives corticospinal motor neuron differentiation through the Ctip2/Satb2 transcriptional regulation axis. J Neurosci. 2012;32:16651–65.
Article CAS PubMed PubMed Central Google Scholar
Volkow ND, Baler RD, Compton WM, Weiss SR. Adverse health effects of marijuana use. N Engl J Med. 2014;370:2219–27.
Article PubMed PubMed Central CAS Google Scholar
Fried PA, Smith AM. A literature review of the consequences of prenatal marihuana exposure. An emerging theme of a deficiency in aspects of executive function. Neurotoxicol Teratol. 2001;23:1–11.
Article CAS PubMed Google Scholar
Trezza V, Campolongo P, Cassano T, Macheda T, Dipasquale P, Carratu MR, et al. Effects of perinatal exposure to delta-9-tetrahydrocannabinol on the emotional reactivity of the offspring: a longitudinal behavioral study in Wistar rats. Psychopharmacol (Berl). 2008;198:529–37.
Article CAS Google Scholar
Philippot G, Nyberg F, Gordh T, Fredriksson A, Viberg H. Short-term exposure and long-term consequences of neonatal exposure to Delta(9)-tetrahydrocannabinol (THC) and ibuprofen in mice. Behav Brain Res. 2016;307:137–44.
Article CAS PubMed Google Scholar
Busquets-Garcia A, Desprez T, Metna-Laurent M, Bellocchio L, Marsicano G, Soria-Gomez E. Dissecting the cannabinergic control of behavior: The where matters. Bioessays 2015;37:1215–25.
Article CAS PubMed Google Scholar
Ruehle S, Rey AA, Remmers F, Lutz B. The endocannabinoid system in anxiety, fear memory and habituation. J Psychopharmacol. 2012;26:23–39.
Article CAS PubMed PubMed Central Google Scholar
de Salas-Quiroga A, Diaz-Alonso J, Garcia-Rincon D, Remmers F, Vega D, Gomez-Canas M, et al. Prenatal exposure to cannabinoids evokes long-lasting functional alterations by targeting CB1 receptors on developing cortical neurons. Proc Natl Acad Sci USA. 2015;112:13693–8.
Article PubMed PubMed Central CAS Google Scholar
Patel JR, Klein RS. Mediators of oligodendrocyte differentiation during remyelination. FEBS Lett. 2011;585:3730–7.
Article CAS PubMed PubMed Central Google Scholar
Itoh K, Maki T, Lok J, Arai K. Mechanisms of cell-cell interaction in oligodendrogenesis and remyelination after stroke. Brain Res. 2015;1623:135–49.
Article CAS PubMed PubMed Central Google Scholar
Pendleton JC, Shamblott MJ, Gary DS, Belegu V, Hurtado A, Malone ML, et al. Chondroitin sulfate proteoglycans inhibit oligodendrocyte myelination through PTPsigma. Exp Neurol. 2013;247:113–21.
Article CAS PubMed Google Scholar
Palazuelos J, Klingener M, Raines EW, Crawford HC, Aguirre A. Oligodendrocyte Regeneration and CNS Remyelination Require TACE/ADAM17. J Neurosci. 2015;35:12241–7.
Article CAS PubMed PubMed Central Google Scholar
Mobius W, Cooper B, Kaufmann WA, Imig C, Ruhwedel T, Snaidero N, et al. Electron microscopy of the mouse central nervous system. Methods Cell Biol. 2010;96:475–512.
Article PubMed Google Scholar
Moyon S, Dubessy AL, Aigrot MS, Trotter M, Huang JK, Dauphinot L, et al. Demyelination causes adult CNS progenitors to revert to an immature state and express immune cues that support their migration. J Neurosci. 2015;35:4–20.
Article PubMed PubMed Central CAS Google Scholar
Skripuletz T, Miller E, Moharregh-Khiabani D, Blank A, Pul R, Gudi V, et al. Beneficial effects of minocycline on cuprizone induced cortical demyelination. Neurochem Res. 2010;35:1422–33.
Article CAS PubMed Google Scholar
Prut L, Belzung C. The open field as a paradigm to measure the effects of drugs on anxiety-like behaviors: a review. Eur J Pharm. 2003;463:3–33.
Article CAS Google Scholar

Download references

Acknowledgements

We acknowledge the animal and microscopy facility cores at Complutense University.

Funding

This work was supported by the MINECO grants SAF2017–83516 and PID2020–112640RB-I00, and the Comunidad de Madrid grants 2016-T1/BMD-1060 and 2020–5 A/BMD-19728, Atracción del Talento Investigador Program, to JP. AHG and TA. AHG was also supported by the Comunidad de Madrid contract PEJD-2017-PRE/BMD-3703, and A.S.T by Fundación Tatiana Pérez de Guzmán el Bueno. Support was also provided by MINECO (grants RTI2018–095311-B-I00 to MG. and SAF2016–75292-R to CM), CIBERNED (grants CB06/05/0005 to M.G. and CB06/0005/0076 to C.M.), FEDER and ISCIII (AES 2018 grants PI18–00941 to IG-R and PI18/00513 to SM), Basque Government (grants IT1203–19 to C.M. and PIBA19–0059 to SM), and ARSEP Foundation (grant to SM).

Author information

These authors contributed equally: Aníbal Sánchez-de la Torre, Tania Aguado.

Authors and Affiliations

Instituto Ramón y Cajal de Investigación Sanitaria (IRYCIS), Madrid, Spain
Aníbal Sánchez-de la Torre, Tania Aguado, Alba Huerga-Gómez, Silvia Santamaría, Manuel Guzmán, Ismael Galve-Roperh & Javier Palazuelos
Centro de Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas (CIBERNED), Madrid, Spain
Aníbal Sánchez-de la Torre, Tania Aguado, Alba Huerga-Gómez, Silvia Santamaría, Juan Carlos Chara, Carlos Matute, Susana Mato, Manuel Guzmán, Ismael Galve-Roperh & Javier Palazuelos
Department of Biochemistry and Molecular Biology, Complutense University, Instituto Universitario de Investigación en Neuroquímica (IUIN), Madrid, Spain
Aníbal Sánchez-de la Torre, Tania Aguado, Alba Huerga-Gómez, Silvia Santamaría, Manuel Guzmán, Ismael Galve-Roperh & Javier Palazuelos
Department of Biomedicine and Prevention, Tor Vergata University, Rome, Italy
Antonietta Gentile
University Medical Center, Institute of Physiological Chemistry, Mainz, Germany
Antonietta Gentile, Krisztina Monory & Beat Lutz
Department of Neurosciences, University of the Basque Country UPV/EHU, Leioa, Spain
Juan Carlos Chara, Carlos Matute & Susana Mato
Achucarro Basque Center for Neuroscience, Leioa, Spain
Juan Carlos Chara, Carlos Matute & Susana Mato
Biocruces, Bizkaia, Spain
Susana Mato

Authors

Aníbal Sánchez-de la Torre
View author publications
You can also search for this author in PubMed Google Scholar
Tania Aguado
View author publications
You can also search for this author in PubMed Google Scholar
Alba Huerga-Gómez
View author publications
You can also search for this author in PubMed Google Scholar
Silvia Santamaría
View author publications
You can also search for this author in PubMed Google Scholar
Antonietta Gentile
View author publications
You can also search for this author in PubMed Google Scholar
Juan Carlos Chara
View author publications
You can also search for this author in PubMed Google Scholar
Carlos Matute
View author publications
You can also search for this author in PubMed Google Scholar
Krisztina Monory
View author publications
You can also search for this author in PubMed Google Scholar
Susana Mato
View author publications
You can also search for this author in PubMed Google Scholar
Manuel Guzmán
View author publications
You can also search for this author in PubMed Google Scholar
Beat Lutz
View author publications
You can also search for this author in PubMed Google Scholar
Ismael Galve-Roperh
View author publications
You can also search for this author in PubMed Google Scholar
Javier Palazuelos
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

TA and JP designed research, analyzed data, and wrote the manuscript. AST, TA, AH, SS, AG and JCC performed research. MG, IGR, SM, CM, KM and BL contributed to write the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Javier Palazuelos.

Ethics declarations

Ethics statement

All the experimental procedures used were ethically reviewed and approved and were performed under the guidelines and with the approval of the Animal Welfare Committee of Universidad Complutense de Madrid and Comunidad de Madrid and under the directives of the European Commission (Directive 2010/63/EU).

Conflict of interest

The authors declare no competing interests.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Edited by Alexei Verkhratsky

Supplementary information

Supplementary information- Supplementary figures

Supplemental information original western blot scans

Data sets

Check list

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Sánchez-de la Torre, A., Aguado, T., Huerga-Gómez, A. et al. Cannabinoid CB₁ receptor gene inactivation in oligodendrocyte precursors disrupts oligodendrogenesis and myelination in mice. Cell Death Dis 13, 585 (2022). https://doi.org/10.1038/s41419-022-05032-z

Download citation

Received: 23 February 2022
Revised: 14 June 2022
Accepted: 17 June 2022
Published: 07 July 2022
DOI: https://doi.org/10.1038/s41419-022-05032-z

This article is cited by

Interactions Between the Ubiquitin–Proteasome System, Nrf2, and the Cannabinoidome as Protective Strategies to Combat Neurodegeneration: Review on Experimental Evidence
- Luis Angel Monsalvo-Maraver
- Enid A. Ovalle-Noguez
- Karen Rentería-Pérez
Neurotoxicity Research (2024)