Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Article
  • Published:

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping

Acta Pharmacologica Sinica volume 44, pages 2307–2321 (2023)Cite this article

Abstract

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the “AG”-rich sequence “caggauggaggccccccgugccgag” on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Fig. 1: hnRNP A1 is highly expressed in MDA-MB-231 cells.
Fig. 2: hnRNP A1 promoted the migration and invasion of breast cancer cells via the ERK pathway.
Fig. 3: hnRNP A1 binds Intron 15 of SCRIB pre-mRNA to inhibit Exon 16 splicing.
Fig. 4: SCRIB-S promotes the migration and invasion of breast cancer cells.
Fig. 5: hnRNP A1 promotes the migration of breast cancer cells partially by regulating SCRIB.
Fig. 6: ASOs inhibit the migration of breast cancer cells by inhibiting the binding of hnRNP A1 to SCRIB pre-mRNA.
Fig. 7: ASOs inhibit the migration and invasion of breast cancer cells by inhibiting the binding of hnRNP A1 to SCRIB pre-mRNA.
Fig. 8: hnRNP A1 regulates the SCRIB Exon 16 skipping to promote breast cancer metastasis.

Similar content being viewed by others

References

  1. Gupta GP, Massagué J. Cancer metastasis: building a framework. Cell. 2006;127:679–95.

    Article  CAS  PubMed  Google Scholar 

  2. Li J, Choi PS, Chaffer CL, Labella K, Hwang JH, Giacomelli AO, et al. An alternative splicing switch in FLNB promotes the mesenchymal cell state in human breast cancer. Elife. 2018;7:e37184.

  3. Tyson-Capper A, Gautrey H. Regulation of Mcl-1 alternative splicing by hnRNP F, H1 and K in breast cancer cells. RNA Biol. 2018;15:1448–57.

    Article  PubMed  PubMed Central  Google Scholar 

  4. Liu J, Li J, Li P, Wang Y, Liang Z, Jiang Y, et al. Loss of DLG5 promotes breast cancer malignancy by inhibiting the Hippo signaling pathway. Sci Rep. 2017;7:42125.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Yamanaka T, Ohno S. Role of Lgl/Dlg/Scribble in the regulation of epithelial junction, polarity and growth. Front Biosci. 2008;13:6693–707.

    Article  CAS  PubMed  Google Scholar 

  6. Nagasaka K, Nakagawa S, Yano T, Takizawa S, Matsumoto Y, Tsuruga T, et al. Human homolog of drosophila tumor suppressor scribble negatively regulates cell-cycle progression from G1 to S phase by localizing at the basolateral membrane in epithelial cells. Cancer Sci. 2006;97:1217–25.

    Article  CAS  PubMed  Google Scholar 

  7. Nola S, Sebbagh M, Marchetto S, Osmani N, Nourry C, Audebert S, et al. Scrib regulates PAK activity during the cell migration process. Hum Mol Genet. 2008;17:3552–65.

    Article  CAS  PubMed  Google Scholar 

  8. Qin Y, Capaldo C, Gumbiner BM, Macara IG. The mammalian scribble polarity protein regulates epithelial cell adhesion and migration through e-cadherin. J Cell Biol. 2005;171:1061–71.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Jønson L, Vikesaa J, Krogh A, Nielsen LK, Hansen T, Borup R, et al. Molecular composition of IMP1 ribonucleoprotein granules. Mol Cell Proteom. 2007;6:798–811.

    Article  Google Scholar 

  10. Shamoo Y, Krueger U, Rice LM, Williams KR, Steitz TA. Crystal structure of the two RNA binding domains of human hnRNP A1 at 1.75 A resolution. Nat Struct Biol. 1997;4:215–22.

    Article  CAS  PubMed  Google Scholar 

  11. Xu RM, Jokhan L, Cheng X, Mayeda A, Krainer AR. Crystal structure of human UP1, the domain of hnRNP A1 that contains two RNA-recognition motifs. Structure. 1997;5:559–70.

    Article  CAS  PubMed  Google Scholar 

  12. Ghosh M, Singh M. RGG-box in hnRNPA1 specifically recognizes the telomere G-quadruplex DNA and enhances the G-quadruplex unfolding ability of UP1 domain. Nucleic Acids Res. 2018;46:10246–61.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Jean-Philippe J, Paz S, Caputi M. hnRNP A1: the Swiss army knife of gene expression. Int J Mol Sci. 2013;14:18999–9024.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Beusch I, Barraud P, Moursy A, Cléry A, Allain FH. Tandem hnRNP A1 RNA recognition motifs act in concert to repress the splicing of survival motor neuron Exon 7. Elife. 2017;6:e25736.

  15. Loh TJ, Moon H, Cho S, Jang H, Liu YC, Tai H, et al. Cd44 alternative splicing and hnRNP A1 expression are associated with the metastasis of breast cancer. Oncol Rep. 2015;34:1231–8.

    Article  CAS  PubMed  Google Scholar 

  16. Chen Y, Liu J, Wang W, Xiang L, Wang J, Liu S, et al. High expression of hnRNP A1 promotes cell invasion by inducing EMT in gastric cancer. Oncol Rep. 2018;39:1693–701.

    CAS  PubMed  PubMed Central  Google Scholar 

  17. Liu X, Zhou Y, Lou Y, Zhong H. Knockdown of hnRNP A1 inhibits lung adenocarcinoma cell proliferation through cell cycle arrest at G0/G1 phase. Gene. 2016;576:791–7.

    Article  CAS  PubMed  Google Scholar 

  18. Groen EJN, Talbot K, Gillingwater TH. Advances in therapy for spinal muscular atrophy: promises and challenges. Nat Rev Neurol. 2018;14:214–24.

    Article  PubMed  Google Scholar 

  19. Shimojo M, Kasahara Y, Inoue M, Tsunoda SI, Shudo Y, Kurata T, et al. A gapmer antisense oligonucleotide targeting SRRM4 is a novel therapeutic medicine for lung cancer. Sci Rep. 2019;9:7618.

    Article  PubMed  PubMed Central  Google Scholar 

  20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25:402–8.

    Article  CAS  PubMed  Google Scholar 

  21. Lei S, Zhang B, Huang L, Zheng Z, Xie S, Shen L, et al. SRSF1 promotes the inclusion of Exon 3 of SRA1 and the invasion of hepatocellular carcinoma cells by interacting with Exon 3 of SRA1pre-mRNA. Cell Death Discov. 2021;7:117.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  22. Li S, Shen L, Huang L, Lei S, Cai X, Breitzig M, et al. PTBP1 enhances Exon11a skipping in Mena pre-mRNA to promote migration and invasion in lung carcinoma cells. Biochim Biophys Acta Gene Regul Mech. 2019;1862:858–69.

    Article  CAS  PubMed  Google Scholar 

  23. Zhou X, Li X, Cheng Y, Wu W, Xie Z, Xi Q, et al. BCLAF1 and its splicing regulator SRSF10 regulate the tumorigenic potential of colon cancer cells. Nat Commun. 2014;5:4581.

    Article  CAS  PubMed  Google Scholar 

  24. Shen L, Lei S, Zhang B, Li S, Huang L, Czachor A, et al. Skipping of Exon 10 in Axl pre-mRNA regulated by PTBP1 mediates invasion and metastasis process of liver cancer cells. Theranostics. 2020;10:5719–35.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Erdem M, Ozgul İ, Dioken DN, Gurcuoglu I, Guntekin Ergun S, Cetin-Atalay R, et al. Identification of an mRNA isoform switch for HNRNPA1 in breast cancers. Sci Rep. 2021;11:24444.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Young LC, Hartig N, Muñoz-Alegre M, Oses-Prieto JA, Durdu S, Bender S, et al. An MRAS, SHOC2, and SCRIB complex coordinates ERK pathway activation with polarity and tumorigenic growth. Mol Cell. 2013;52:679–92.

    Article  CAS  PubMed  Google Scholar 

  27. Elsum IA, Martin C, Humbert PO. Scribble regulates an EMT polarity pathway through modulation of MAPK-ERK signaling to mediate junction formation. J Cell Sci. 2013;126:3990–9.

    CAS  PubMed  Google Scholar 

  28. von Kriegsheim A, Pitt A, Grindlay GJ, Kolch W, Dhillon AS. Regulation of the RAF-MEK-ERK pathway by protein phosphatase 5. Nat Cell Biol. 2006;8:1011–6.

    Article  Google Scholar 

  29. Hua Y, Vickers TA, Baker BF, Bennett CF, Krainer AR. Enhancement of SMN2 Exon 7 inclusion by antisense oligonucleotides targeting the exon. PLoS Biol. 2007;5:e73.

    Article  PubMed  PubMed Central  Google Scholar 

  30. Lim KH, Han Z, Jeon HY, Kach J, Jing E, Weyn-Vanhentenryck S, et al. Antisense oligonucleotide modulation of non-productive alternative splicing upregulates gene expression. Nat Commun. 2020;11:3501.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Zhang Q, Chen J, Yu X, Cai G, Yang Z, Cao L, et al. Survival benefit of anti-HER2 therapy after whole-brain radiotherapy in HER2-positive breast cancer patients with brain metastasis. Breast Cancer. 2016;23:732–9.

    Article  PubMed  Google Scholar 

  32. Oostra DR, Macrae ER. Role of trastuzumab emtansine in the treatment of HER2-positive breast cancer. Breast Cancer. 2014;6:103–13.

    PubMed  PubMed Central  Google Scholar 

  33. Baretta Z, Mocellin S, Goldin E, Olopade OI, Huo D. Effect of BRCA germline mutations on breast cancer prognosis: a systematic review and meta-analysis. Medicine. 2016;95:e4975.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Balmaña J, Díez O, Rubio IT, Cardoso F. BRCA in breast cancer: ESMO clinical practice guidelines. Ann Oncol. 2011;22:vi31–34.

    Article  PubMed  Google Scholar 

  35. Tung NM, Garber JE. BRCA1/2 testing: therapeutic implications for breast cancer management. Br J Cancer. 2018;119:141–52.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Smith CW, Valcárcel J. Alternative pre-mRNA splicing: the logic of combinatorial control. Trends Biochem Sci. 2000;25:381–8.

    Article  CAS  PubMed  Google Scholar 

  37. Del Gatto-Konczak F, Olive M, Gesnel MC, Breathnach R. hnRNP A1 recruited to an exon in vivo can function as an exon splicing silencer. Mol Cell Biol. 1999;19:251–60.

    Article  PubMed  PubMed Central  Google Scholar 

  38. Blanchette M, Chabot B. Modulation of exon skipping by high-affinity hnRNP A1-binding sites and by intron elements that repress splice site utilization. EMBO J. 1999;18:1939–52.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Chan JH, Lim S, Wong WS. Antisense oligonucleotides: from design to therapeutic application. Clin Exp Pharmacol Physiol. 2006;33:533–40.

    Article  CAS  PubMed  Google Scholar 

  40. Prakash TP, Mullick AE, Lee RG, Yu J, Yeh ST, Low A, et al. Fatty acid conjugation enhances potency of antisense oligonucleotides in muscle. Nucleic Acids Res. 2019;47:6029–44.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Crooke ST. Progress in antisense technology. Annu Rev Med. 2004;55:61–95.

    Article  CAS  PubMed  Google Scholar 

  42. Miyake H, Hara I, Fujisaw M, Gleave ME. Antisense oligodeoxynucleotide therapy for bladder cancer: recent advances and future prospects. Expert Rev Anticancer Ther. 2005;5:1001–9.

    Article  CAS  PubMed  Google Scholar 

  43. Shimo T, Tachibana K, Saito K, Yoshida T, Tomita E, Waki R, et al. Design and evaluation of locked nucleic acid-based splice-switching oligonucleotides in vitro. Nucleic Acids Res. 2014;42:8174–87.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Touznik A, Maruyama R, Hosoki K, Echigoya Y, Yokota T. LNA/DNA mixmer-based antisense oligonucleotides correct alternative splicing of the SMN2 gene and restore smn protein expression in type 1 SMA fibroblasts. Sci Rep. 2017;7:3672.

    Article  PubMed  PubMed Central  Google Scholar 

  45. Kapil S, Sharma BK, Patil M, Elattar S, Yuan J, Hou SX, et al. The cell polarity protein scrib functions as a tumor suppressor in liver cancer. Oncotarget. 2017;8:26515–31.

    Article  PubMed  PubMed Central  Google Scholar 

  46. Humbert P, Russell S, Richardson H. Dlg, Scribble and Lgl in cell polarity, cell proliferation and cancer. Bioessays. 2003;25:542–53.

    Article  CAS  PubMed  Google Scholar 

  47. Pearson HB, Perez-Mancera PA, Dow LE, Ryan A, Tennstedt P, Bogani D, et al. Scrib expression is deregulated in human prostate cancer, and its deficiency in mice promotes prostate neoplasia. J Clin Invest. 2011;121:4257–67.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. Zhan L, Rosenberg A, Bergami KC, Yu M, Xuan Z, Jaffe AB, et al. Deregulation of scribble promotes mammary tumorigenesis and reveals a role for cell polarity in carcinoma. Cell. 2008;135:865–78.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

This work was supported by the Guangzhou Basic and Applied Basic Research Project (to FW), Natural Science Foundation of Guangdong Province (NO. 2022A1515012636), and High-level University Construction Project and 2019 Ministry of Education “Chunhui Plan” Cooperative Scientific Research Project (NO. 131). We thank Dr. Marco Pistolozzi, International School, Jinan University, for editing the manuscript.

Author information

Author notes

  1. These authors contributed equally: Bin Zhang, Shao-han Xie, Jun-yi Hu

Authors and Affiliations

  1. Institute of Genomic Medicine, College of Pharmacy, Jinan University, Guangzhou, 510632, China

    Bin Zhang, Shao-han Xie, Si-jia Lei, Liang-hua Shen, Qing Zheng & Feng Wang

  2. State Key Laboratory of Bioactive Molecules and Druggability Assessment, Jinan University, Guangzhou, 510632, China

    Bin Zhang, Shao-han Xie, Jun-yi Hu, Si-jia Lei, Liang-hua Shen, Qing Zheng, Zhi-ming Zhang & Feng Wang

  3. International Cooperative Laboratory of Traditional Chinese Medicine Modernization and Innovative Drug Development of Chinese Ministry of Education (MOE), College of Pharmacy, Jinan University, Guangzhou, 510632, China

    Bin Zhang, Shao-han Xie, Jun-yi Hu & Feng Wang

  4. College of Life Sciences, Zhengzhou University, No. 100 Kexue Avenue, Zhengzhou, 450001, China

    Hong-tao Liu

  5. Key Laboratory of Southwest China Wildlife Resources Conservation (China West Normal University), Ministry of Education, Nanchong, 637009, China

    Chun-lian Wu

  6. Department of General Surgery, The First Affiliated Hospital, Jinan University, Guangzhou, 510630, China

    Qiang Li

  7. Department of General Surgery, Chaoshan Hospital, The First Affiliated Hospital of Jinan University, Chaozhou City, 515600, China

    Qiang Li

Authors
  1. Bin Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Shao-han Xie
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Jun-yi Hu
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Si-jia Lei
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Liang-hua Shen
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Hong-tao Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Qing Zheng
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Zhi-ming Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Chun-lian Wu
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Qiang Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Feng Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

BZ performed experiments and analyzed the data. BZ and SHX wrote the manuscript and prepared the figures; SHX, and JYH revised the paper. HTL, SJL, LHS, and QZ discussed the results and revised the manuscript extensively. ZMZ, QL, CLW and FW conceived of and oversaw the project.

Corresponding authors

Correspondence to Zhi-ming Zhang, Chun-lian Wu, Qiang Li or Feng Wang.

Ethics declarations

Competing interests

The authors declare no competing interests.

Supplementary information

Rights and permissions

Springer Nature or its licensor (e.g. a society or other partner) holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Zhang, B., Xie, Sh., Hu, Jy. et al. Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping. Acta Pharmacol Sin 44, 2307–2321 (2023). https://doi.org/10.1038/s41401-023-01116-4

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/s41401-023-01116-4

Keywords

This article is cited by

Search

Advanced search

Quick links