IP6K structure and the molecular determinants of catalytic specificity in an inositol phosphate kinase family

Wang, Huanchen; DeRose, Eugene F.; London, Robert E.; Shears, Stephen B.

doi:10.1038/ncomms5178

Article
Published: 24 June 2014

IP6K structure and the molecular determinants of catalytic specificity in an inositol phosphate kinase family

Huanchen Wang¹,
Eugene F. DeRose²,
Robert E. London² &
…
Stephen B. Shears¹

Nature Communications volume 5, Article number: 4178 (2014) Cite this article

4771 Accesses
47 Citations
Metrics details

Subjects

Abstract

Inositol trisphosphate kinases (IP3Ks) and inositol hexakisphosphate kinases (IP6Ks) each regulate specialized signalling activities by phosphorylating either InsP₃ or InsP₆ respectively. The molecular basis for these different kinase activities can be illuminated by a structural description of IP6K. Here we describe the crystal structure of an Entamoeba histolytica hybrid IP6K/IP3K, an enzymatic parallel to a ‘living fossil’. Through molecular modelling and mutagenesis, we extrapolated our findings to human IP6K2, which retains vestigial IP3K activity. Two structural elements, an α-helical pair and a rare, two-turn 3₁₀ helix, together forge a substrate-binding pocket with an open clamshell geometry. InsP₆ forms substantial contacts with both structural elements. Relative to InsP₆, enzyme-bound InsP₃ rotates 55° closer to the α-helices, which provide most of the protein’s interactions with InsP₃. These data reveal the molecular determinants of IP6K activity, and suggest an unusual evolutionary trajectory for a primordial kinase that could have favored efficient bifunctionality, before propagation of separate IP3Ks and IP6Ks.

You have full access to this article via your institution.

Download PDF

Substrate promiscuity of inositol 1,4,5-trisphosphate kinase driven by structurally-modified ligands and active site plasticity

Article Open access 19 February 2024

Kinase-independent synthesis of 3-phosphorylated phosphoinositides by a phosphotransferase

Article 28 April 2022

The structural basis of PTEN regulation by multi-site phosphorylation

Article 08 October 2021

Introduction

Phosphate is a universal device for imposing specificity in cell signalling. The phosphate group’s very bulk establishes geometric constraints on ligand–protein and protein–protein interactions. In addition, the phosphate’s negative charge at physiological pH bestows specificity through ionic and hydrogen bonding to only certain amino-acid residues. Signalling specificity is further enhanced through interactions that utilize multiple phosphates, such as those that are placed in various combinations around the six carbon inositol ring. Each of the resulting molecules—inositol phosphates (InsPs)—have a distinct three-dimensional phosphate pattern that can encode unique signalling properties. Within this family of signalling molecules, there is a subgroup that possess functionally significant, ‘high-energy’ diphosphate groups: the inositol pyrophosphates (also known as diphosphoinositol polyphosphates)^1,2. These molecules, particularly InsP₇ and InsP₈, are now viewed as being of fundamental importance in all eukaryotes². Inositol pyrophosphates play pivotal roles in several aspects of cellular and organismic metabolic homeostasis^1,3,4,5,6,7, and they regulate interferon transcription in response to viral infection⁸. Indeed, cell signalling by the inositol pyrophosphates is considered to be among the most evolutionarily ancient functions of the entire inositol phosphate family⁹. Thus, there is considerable interest in the kinases that synthesize InsP₇ and InsP₈.

For example, mammals express three isoforms of inositol hexakisphosphate kinases (IP6Ks)^10,11 that each add a second phosphate group to a preexisting phosphate at the 5-position of the inositol ring. These kinases thereby convert InsP₆ to 5-PP-Ins(1,2,3,4,6)P₅ (5-InsP₇)^12,13. The type 1 and type 2 isoforms (IP6K1 and IP6K2, respectively) have been the subject of a number of genetic studies with startling phenotypes. Silencing of IP6K1 in pancreatic β-cells inhibits insulin secretion⁴. Gene disruption of murine IP6K1 increases the insulin sensitivity of target tissues¹⁴, reduces spermatogenesis¹⁴ and compromises haemostasis¹⁵. Furthermore, in MEFs prepared from IP6K1^−/− mice, DNA repair by homologous recombination is impaired¹⁶, the epigenetic program is altered¹⁷ and mitochondria are defective³. A reduction in IP6K2 expression through an antisense strategy reduces apoptosis¹⁸, while IP6K2^−/− mice show increased susceptibility to carcinogen-induced squamous cell carcinoma¹⁹. As IP6Ks have so many important functions, the determination of their structures is a key research goal: such information illuminates catalytic mechanisms, regulatory processes and evolutionary relationships with other kinases, while also offering templates for the rational design of selective inhibitors as research tools or for therapeutic applications. However, IP6Ks have been stubbornly resistant to structural analysis for many years. Our goal has been to fill this significant void in our structural and molecular understanding, so as to further our insight into the entire inositol phosphate kinase family.

Entamoeba histolytica express an intriguing IP6K homologue (Genbank: XP_648490.2) that, secondary to its InsP₆ kinase activity, also phosphorylates the 6-OH of Ins(1,4,5)P₃ (ref. 20)—an inositol phosphate multikinase (IPMK)-like activity^10,21,22. IPMK itself is positionally promiscuous in that it is a 3-, 5- and 6-kinase²³. Another nonspecific inositol phosphate kinase is ITPK1, which phosphorylates the 1-, 5- and 6-positions around the inositol ring²⁴. Within the active sites of IPMK and ITPK1, the plane of the inositol rings in all of the alternate substrates are proposed to occupy the same spatial orientation, enabling each substrate to interact with a common set of protein contacts^25,26,27,28. However, there has not previously been any direct structural confirmation of that hypothesis, because the published crystal structures of IPMK^26,28 and ITPK1^27,29 lack bound substrate. We therefore considered that structural analysis of the IP6K from E. histolytica could generate new ideas concerning specificity determinants of the positional promiscuity of inositol phosphate kinases.

IP6Ks are members of a wider inositol phosphate kinase family (Pfam PF03770) that includes IPMKs and inositol trisphosphate kinases (IP3Ks); these enzymes all share a PxxxDxKxG (‘PDKG’) catalytic motif^10,21. Phylogenetic analysis⁹ has led to the hypothesis that this kinase family arose from a primordial IP6K precursor. However, such an evolutionary pathway would be highly unusual, at least according to current thinking³⁰. The issue of concern is that the original substrate (InsP₆) for the putative progenitor kinase is both larger and substantially more polar than the substrates for the descendant kinases: the InsP₃ and InsP₄ that are phosphorylated by IPMKs^26,28 and the InsP₃ that is specifically phosphorylated at the 3-OH by IP3Ks^31,32. The traditional viewpoint is that improvements in the efficiency of catalysis of the smaller substrates (InsP₃/InsP₄) would evolve through the compression of the active site³⁰. However, that would generally be expected to reduce activity against the larger InsP₆ molecule—a ‘negative trade-off’—that would impede organismic fitness and thereby select against the emergence of the independent InsP₃/InsP₄ kinase activities³⁰. Such restrictions would seem inevitable if all substrates interacted with common structural elements. Nevertheless, the significant InsP₃ kinase activity of E. histolytica IP6K²⁰ suggests it has somewhat overcome the constraints of negative trade-off; structural analysis could reveal how this was accomplished. We now describe several crystal complexes of the IP6K from E. histolytica, including those that contain either large (Ins(1,3,4,5,6)P₅/InsP₆) or small (Ins(1,4,5)P₃) substrates. Furthermore, we extrapolate our findings to mammalian IP6Ks by site-directed mutagenesis of the human IP6K2. We describe two structural elements, an α-helical pair and a rare, two-turn 3₁₀ helix, that together form a substrate-binding pocket with an open clamshell geometry. InsP₆ has substantial contacts with both structural elements. Relative to InsP₆, enzyme-bound InsP₃ rotates 55° closer to the α-helices, which provide most of the protein’s interactions with InsP₃. These data provide insight into the molecular determinants of both IP3Ks and IP6Ks, and suggest an unusual evolutionary trajectory for propagation of these separate kinases.

Results

Ins(1,4,5)P₃, InsP₅ and InsP₆ phosphorylation by EhIP6KA

In our study, a recently characterized IP6K expressed by E. histolytica²⁰ (Genbank: XP_648490.2) is referred to as EhIP6KA, in order to distinguish it from two other gene products of E. histolytica that are currently also annotated as IP6Ks in Genbank. High-performance liquid chromatography (HPLC) of the InsP₇ synthesized by EhIP6KA (solid line, Fig. 1a) found it to co-elute with the 5-InsP₇ produced by HsIP6K2 (ref. 12)¹² (dotted line, Fig. 1a). A previous study²⁰ also concluded from HPLC that EhIP6KA synthesizes 5-InsP₇. Nevertheless, current HPLC methodology alone does not completely resolve all possible InsP₇ isomers^33,34. Furthermore, there have been reports that amoeba contain atypical isomers of inositol pyrophosphates³⁵. Considering that positional specificity is such a central feature of our study (see the Introduction), we employed nuclear magnetic resonance (NMR) for definitive characterization of the InsP₇ product^12,13.

**Figure 1: HPLC and NMR analysis of the products of Ins(1,4,5)P₃ and InsP₆ phosphorylation by EhIP6KA.**

To prepare sufficient quantities of pure InsP₇ for NMR analysis, we adopted a strategy that has proved useful in the past¹², namely, to analyse reaction mixtures (Fig. 1b). The ¹H chemical shifts of the unreacted InsP₆ and the product InsP₇ were assigned by comparison with reported InsP₆ chemical shifts¹³ and from an analysis of the 2D ¹H–¹H COSY spectrum of the reaction mixture (Supplementary Table 1). The proton resonances from InsP₆ and InsP₇ are labelled in the 1D ¹H spectrum (Fig. 1b). The integral from the InsP₆ protons in the 4/6 positions is approximately three times larger than the corresponding integral arising from the PPInsP₅ product, indicating that about 25% of the InsP₆ was phosphorylated. To verify the assignments and differentiate the InsP₆ and InsP₇ resonances, the 1D ¹H and ³¹P spectra were reacquired after spiking the sample with an additional 100 μl of 5 mM InsP₆. The major difference between the InsP₆ and InsP₇ in the new ¹H spectrum is that the resonance from H-5 is shifted to higher chemical shift and no longer overlaps the H-1,3 resonances as it does in InsP₆ (see also Supplementary Table 1). The remainder of the ¹H resonances exhibit less dramatic changes relative to the corresponding resonances in InsP₆. The H-1,3 and H-4,6 resonances of InsP₇ are equivalent due to the symmetry of molecule. These data are consistent with the site of phosphorylation being at the 5-position. With the ¹H chemical shift assignments in hand, the ³¹P chemical shifts of InsP₇ were assigned from a combined analysis of 2D ¹H–³¹P HSQC and ³¹P–³¹P COSY spectra (Supplementary Table 1). The HSQC spectrum correlates the ¹H shifts at each site to the ³¹P shifts of the phosphate on the same carbon, and the COSY spectrum correlates the ³¹P shifts of the two ³¹P nuclei in the diphosphate moiety. The H-2, H-1,3 and H-4,6 proton chemical shifts correlate to ³¹P chemical shifts from the monophosphate groups in InsP₇, and the H-5 proton shift correlates to the ³¹P chemical shift of the α-phosphate of the only diphosphate group (Fig. 1b), so we conclude that the site of phosphorylation is the 5-position. Note the two other α-phosphate resonances arise from the ADP product and from unreacted ATP (Fig. 1b). The β-phosphate chemical shift of InsP₇ is assigned from its correlation to the α-phosphate chemical shift in the ³¹P–³¹P COSY spectrum. Thus, our NMR data reinforce the conclusion reached by HPLC that EhIP6KA, like mammalian IP6Ks, converts InsP₆ to 5-InsP₇.

Mammalian IP6Ks also phosphorylate Ins(1,3,4,5,6)P₅, yielding PP-InsP₄^12,36. We found that EhIP6KA likewise phosphorylates Ins(1,3,4,5,6)P₅, and the major product co-elutes with a PP-[³H]InsP₄ standard^12,36; no InsP₆ was formed (Fig. 1c). A small amount of [PP]₂-InsP₃^12,36 also accumulated (Fig. 1c). The first order rate constant for Ins(1,3,4,5,6)P₅ phosphorylation (mean±s.e.; 0.15±0.006 s⁻¹ mg⁻¹, n=3) is 40-fold lower than that for InsP₆ (6.1±0.64 s⁻¹ mg⁻¹, n=3). The rate of phosphorylation of Ins(1,4,5)P₃, another EhIP6K substrate²⁰, was 0.028±0.005 s⁻¹ mg⁻¹ (n=3), which is 220-fold slower than that for InsP₆. HPLC indicates that Ins(1,4,5,6)P₄ is the major InsP₄ product formed from Ins(1,4,5)P₃ (Fig. 1d,e)²⁰. We also observed the accumulation of an additional InsP₄ isomer that co-elutes with a standard of Ins(1,2,4,5)P₄ (Fig. 1d). The phosphorylation of an inositol phosphate at the 2-position has only previously been observed for IP5K^26,37. We also confirmed that there were no pyrophosphorylated molecules associated with the InsP₄ products, because these were not dephosphorylated upon their incubation with DIPP1 (Supplementary Fig. 1), an inositol pyrophosphate phosphatase that removes the β-phosphate from the diphosphate group^36,38.

Overall structure of EhIP6KA

The structure of EhIP6KA (Fig. 2a–c; Table 1) was determined through two approaches. First, the structure of the fusion protein MBP-EhIP6KA (apo-enzyme; residues 32–270, space group P2₁2₁2₁) was determined by a molecular replacement approach using MBP (1ez9) and IP3K (1w2c) as search models. That information was then used for further molecular replacement in order to solve the structures of crystal complexes that bound ATP plus either Ins(1,4,5)P₃, Ins(1,3,4,5,6)P₅ or InsP₆ (residues 27–270, space group I4₁22), and a crystal of the apo-enzyme (residues 20–270, space group P2₁). In the latter, the amino-terminal residues 20–29 were disordered.

Table 1 Data collection and structure refinement statistics.

Full size table

For each asymmetric unit, our data are consistent with one molecule of MBP-EhIP6KA in space group P2₁2₁2₁, one molecule of substrate-bound EhIP6KA in space group I4₁22 and two molecules of apo-EhIP6KA in space group P2₁. The latter crystal structure was analysed with the protein interfaces, surfaces and assemblies service ( https://www.ebi.ac.uk/pdbe/pisa/), which estimated an interface area of 814.7 Å² and total gained free energy upon interface formation of −10.8 kcal mol⁻¹. It was also assigned a complexation significance score of zero, indicating that the apo structure is a monomer. Furthermore, gel filtration indicates that apo-EhIP6KA is a monomer in solution.

Analysis of the overall fold of EhIP6KA (Fig. 2a,b) offers a description of some architectural elements that are shared with IPMKs and IP3Ks, while also revealing some molecular differences that may contribute to individual catalytic preferences. Among conserved elements, we identified domains in EhIP6KA that are similar to the so-called N- and C-domains that comprise the ATP-binding sites in both IPMK^26,28 and HsIP3KA^31,32. First, an N-terminal lobe in EhIP6KA can be designated from residues 28–91, which consist of three antiparallel β-strands; the β1 and β2 strands are connected by two short helices α1 and α2. Second, we can designate a C-terminal lobe (residues 92–102 and 132–270), which is an α+β fold with five, central antiparallel β-strands including β4–6, as well as β8 and β9 (connected by a 3-residue 3₁₀ helix), a pair of small antiparallel β-strands (β7 and β10), and three α-helices (α5–α7). Also in the C-lobe of EhIP6KA, between the β6 strand and the α5 helix, is an unusually long (6-residue), two-turn 3₁₀ helix (3₁₀A; Fig. 2a) that is not present in either IPMK^26,28 or HsIP3KA^31,32. A 3₁₀ helix of this length occurs relatively rarely because, being thinner and more tightly wound than classical α-helices, it would usually be too unstable^39,40. However, as we describe below, the highly specialized nature and orientation of the amino-acid side chains in this 3₁₀ helix not only stabilize this structural element, but also make it functionally integral to substrate binding by EhIP6KA.

Description of the nucleotide-binding region of EhIP6KA

We observed that ATP is sandwiched between the N- and C-lobes of EhIP6KA (Fig. 2a); nucleotide binding did not alter protein conformation. Within a conserved IDF tripeptide (Fig. 2c) is Asp231, which coordinates with two Mg ions and makes polar contacts with the nucleotide phosphates (Fig. 3a,b). The orientation of the nucleotide in EhIP6KA is superimposable upon its position in the other kinases that share the PDKG motif, except for the more flexible γ-phosphate of ATP (Fig. 3c; Supplementary Fig. 2), which may contribute to the unusually low affinity of IP6Ks for this nucleotide⁴¹. The adenosine moiety of ATP is docked in a hydrophobic pocket in EhIP6KA that is surrounded by residues Leu36, Pro65, Met85, Asn87, Met89 from the N-lobe and Leu211 and Ile230 from the C-lobe (Figs 3a and 4a). The N¹ and N⁶ atoms of adenine are hydrogen bonded with the amide nitrogen and carbonyl oxygen of Leu88 and Glu86 respectively, which anchors the adenosine in the hydrophobic pocket (Figs 3a and 4a). The ATP-ribose group is loosely confined by several Van der Waals contacts with Val97, Asp99, Leu211 and Ile230. Lys38 forms two hydrogen bonds with oxygen atoms from the α- and β-phosphates (Figs 3a and 4a).

**Figure 3: Nucleotide binding by EhIP6KA.**

**Figure 4: Ligplots showing interactions of EhIP6KA with ATP and InsPs.**

The molecular determinants of inositol phosphate binding

We have obtained crystal structures of EhIP6KA in complex with three different substrates: Ins(1,4,5)P₃, Ins(1,3,4,5,6)P₅ and InsP₆ (Figs 4a,b and 5a–d, Supplementary Fig. 3). Simulated annealing omit-maps and 2Fo−Fc maps show clear density of the substrate’s inositol ring; the individual phosphate groups and their specific positions can each be identified (Supplementary Fig. 3).

**Figure 5: Inositol phosphate-binding site for EhIP6KA.**

The binding site for InsP₆, which lies in a shallow depression in the enzyme’s surface, can be likened to an ‘open clamshell’. One jaw is represented by the IP helices, the other jaw comprises the 3₁₀A helix; note that neither HsIP3KA nor IPMK possess an equivalent to the 3₁₀A helix (Fig. 5e). The IP helices and the 3₁₀ helix are not directly connected, but they approach within a sufficient proximity of each other to provide a metaphorical ‘hinge’ to the clamshell. Here, the 1- and 6-phosphates of InsP₆ make contacts with Lys115, Lys118 and Arg119 in the α-3/α-4 helical pair (Figs 4b and 5d). Nevertheless, the plane of the inositol ring of InsP₆ runs parallel to the contour of the 3₁₀A helix (Fig. 5e), enabling the 4- and 6-phosphates to interact with Arg152 and Tyr153 (Figs 4b and 5d). These contacts appear to be stabilized by cation–pi interactions between Arg152 and Tyr153, which in turn are facilitated by the specific architecture of the 3₁₀ helix (Supplementary Fig. 4).

Ins(1,3,4,5,6)P₅ is also a substrate for EhIP6K (Fig. 1c,d). Indeed, Ins(1,3,4,5,6)P₅ and InsP₆ occupy a similar orientation within the active site (Fig. 5c), indicating how both can be phosphorylated at the same position. IP6Ks can also phosphorylate 1-InsP₇ (ref. 13). Assuming that InsP₆ and 1-InsP₇ also occupy similar orientations within the active site, molecular modelling indicates that the latter’s β-phosphate projects into the bulk phase and should not greatly influence substrate binding.

While it is the 5-phosphate group on InsP₆ that is diphosphorylated by EhIP6KA (Fig. 1b), it is either the 2- or the 6-OH of Ins(1,4,5)P₃ that is phosphorylated (Fig. 1d,e). Positional promiscuity in other inositol phosphate kinases has been rationalized by proposing alternative substrate-binding modes, in which the plane of the inositol ring occupies the same spatial orientation relative to the active site, enabling each substrate to share the same protein-contact points^25,26,27,28. This is not the case for EhIP6KA. Instead, a unique adaptation of EhIP6KA lies in the nature of its contacts with Ins(1,4,5)P₃ that tilt the plane of the inositol ring by 55° relative to that of InsP₆ (Fig. 5b). Thus, near the clamshell hinge, the 5-phosphate of Ins(1,4,5)P₃ somewhat overlaps the space that would be occupied by the 1-phosphate of InsP₆ (Fig. 5b). However, at the open end of the clamshell, the 1-phosphate of Ins(1,4,5)P₃ is positioned 7.5 Å away from the location of the 3-phosphate of InsP₆ (Fig. 5b). In fact, steric restrictions prevent InsP₆ from occupying the same space as Ins(1,4,5)P₃ in the substrate-binding pocket.

The 3₁₀ helix makes only limited contact with Ins(1,4,5)P₃: the 4-phosphate has just one hydrogen bond with Arg152 and there are weak Van der Waals interactions with Tyr153 (Figs 4a, 5a). Instead, the plane of the inositol ring in Ins(1,4,5)P₃ is tilted closer to the IP helices, which are what this substrate mainly interacts with. Lys118 and Arg119 make contacts with the 4- and 5-phosphates of Ins(1,4,5)P₃ (Figs 4a and 5a). The 1-phosphate, 6-hydroxyl and 5-phosphate of Ins(1,4,5)P₃ also have Van der Waals interactions with Lys115 (Fig. 4a). The 2-OH of Ins(1,4,5)P₃ is positioned 3.7 Å from the γ-phosphate of ATP (Supplementary Fig. 5), which is close enough to permit an in-line phosphoryl-transfer reaction⁴². Indeed, our HPLC analysis revealed Ins(1,2,4,5)P₄ to be a product of Ins(1,4,5)P₃ phosphorylation (Fig. 1d,e).

Furthermore, we remodelled the orientation of the inositol ring in enzyme-bound Ins(1,4,5)P₃, by flipping it 180° across its 1/4 axis, whereupon the 6-OH of Ins(1,4,5)P₃ was then positioned 2.9 Å from the γ-phosphate of ATP (Supplementary Fig. 5). This rationalizes the 6-kinase activity against Ins(1,4,5)P₃ by EhIP6KA (Fig. 1d,e). Thus, Ins(1,4,5)P₃ can be held in the active site of EhIP6KA in two alternative, productive orientations, yielding either Ins(1,2,4,5)P₄ or Ins(1,4,5,6)P₄ as products.

Another interesting observation is that, within the ligand-binding pocket of EhIP6KA, the orientation of the plane of the inositol ring of Ins(1,4,5)P₃ shows a remarkable degree of spatial conservation with that for HsIP3KA (Fig. 5a,e, Supplementary Fig. 5);³² one inositol ring is simply flipped 180° across its 2,3/5,6 axis relative to the other so that, in HsIP3KA, the 3-OH that is phosphorylated lies 4.6 Å from the γ-phosphate of ATP (Supplementary Fig. 5), which is within the distance that permits an in-line, phospho-transfer reaction⁴². Thus, our data suggest that EhIP6KA be considered an enzymatic parallel to a ‘living fossil’ that illuminates the potential nature of a primordial InsP₆/InsP₃ kinase. In this putative protein, the open clamshell topology of the active site provides a partial diversification of specificity determinants for Ins(1,4,5)P₃ and InsP₆, prior to its propagation into separate enzymes that could specialize in either of the two catalytic activities. We used mutagenesis to pursue this idea (see below).

Molecular modelling and mutagenesis of human IP6K2

So as to consolidate our structural work with EhIP6KA, and also to extrapolate it to mammalian IP6Ks, we turned to HsIP6K2 as a model for mutagenic studies. Interestingly, we found that HsIP6K2 harbours a vestigial Ins(1,4,5)P₃ kinase activity, some five orders of magnitude weaker than the InsP₆ activity (Fig. 6a). The products of Ins(1,4,5)P₃ phosphorylation are Ins(1,3,4,5)P₄ and Ins(1,4,5,6)P₄ (Fig. 6b). Although the Ins(1,4,5)P₃ kinase activity was relatively low, it was sufficient to permit us to pursue the specificity determinants for each substrate.

**Figure 6: HPLC analysis of the kinase activities of wild-type and mutant IP6Ks.**

For a positive control in the mutagenic experiments, we prepared a Lys222Ala mutant of HsIP6K2. This residue (equivalent to Lys101 in EhIP6KA; Figs 2c, 4b and 5a,d), lies within the conserved PxxxDxKxG catalytic center (Fig. 2c). A HsIP6K2 construct in which this residue was mutated to Ala has previously been used as a kinase-impaired control when studying the effects of overexpression of wild-type enzyme in intact cells⁴³. Nevertheless, to our knowledge, the degree to which this mutation inhibits recombinant enzyme activity has not previously been published. We found that the K222A mutant of HsIP6K2 exhibits negligible catalytic activity (Fig. 6a).

Our structural analysis of EhIP6KA indicates that Lys115 in the IP helices of EhIP6KA has multiple interactions with both substrates (Figs 4 and 5). We mutated the corresponding Lys236 in HsIP6K2 (Fig. 2c) to Ala; catalytic activity against both substrates was strongly reduced (Fig. 6a). Lys118 and Arg119 are two other residues in the IP helices of EhIP6KA that make contact with both substrates (Figs 4 and 5). These residues are not precisely replicated in HsIP6K2, according to both our sequence alignments (Fig. 2c) and our molecular model of the mammalian kinase (Supplementary Fig. 6A). Instead, our modelling indicates that Lys243 in HsIP6K2 has functionally significant interactions with the 6-phosphate of InsP₆ (Supplementary Fig. 6A). Indeed, an Lys243Ala mutation in HsIP6K2 decreased InsP₆ kinase activity 600-fold (Fig. 6a) without affecting Ins(1,4,5)P₃ phosphorylation. These data speak to the specialization of the InsP₆ kinase activity of HsIP6K2.

We next used mutagenesis to test our hypothesis drawn from structural data that the 3₁₀A helix in IP6Ks is particularly important for binding InsP₆. Arg152 and Tyr153 in the 3₁₀A helix of EhIP6KA align with Lys274 and Tyr275 in the equivalent region of HsIP6K2 (Fig. 2c). We found that Lys274Ala and Tyr275Ala mutants of HsIP6K2 exhibited a decrease in InsP₆ kinase activities of 55- and 8-fold, respectively; the fact that these two mutations did not affect Ins(1,4,5)P₃ kinase activities (Fig. 6a) confirms our conclusion that they play only a minor role in binding Ins(1,4,5)P₃. Interestingly, the 3₁₀A helix of HsIP6K2 contains an Arg residue at position 278 for which there is no equivalent in EhIP6KA (Fig. 2c). Molecular modelling of HsIP6K2 suggests Arg278 might contribute positive charge to the substrate-binding pocket, and/or stabilize the 3₁₀ helix through cation–pi interactions with Tyr274 (Supplementary Fig. 6B). Consistent with these ideas, an Arg278Ala mutant of HsIP6K2 exhibited a ninefold reduction in InsP₆ kinase activity compared with wild-type enzyme (Fig. 6a). Interestingly, the Arg278Ala mutant also showed a dramatic increase in Ins(1,4,5)P₃ kinase activity (Fig. 6a). It is possible Arg278 has a negative impact on Ins(1,4,5)P₃ phosphorylation by attracting it into a nonproductive orientation.

The electronegative Glu333 in the C-lobe of HsIP3KA³² (Supplementary Fig. 6C) is replaced by Ser136 in EhIP6KA and Cys257 in HsIP6K2 (Fig. 2c). Structural modelling of this region of HsIP6K2 (Supplementary Fig. 6B,C) indicates a Cys257Glu replacement in HsIP6K2 would cause electrostatic repulsion of InsP₆ but not Ins(1,4,5)P₃. Indeed, we prepared a Cys257Glu mutant of HsIP6K2 and it showed 14-fold lower InsP₆ kinase activity than wild-type enzyme (Fig. 6a). Moreover, this mutant showed a 33-fold increase in the rate of phosphorylation of Ins(1,4,5)P₃ (Fig. 6a), specifically at the 3-OH group (Fig. 6c,d). These results indicate the importance of Glu333 in the evolution of catalytic specificity of HsIP3KA.

Finally, a hydrophobic patch in the IP helices in HsIP3KA and ScIPMK (Tyr315/Met316 in HsIP3KA, Met151 in ScIPMK; Fig. 2c), against which the inositol ring is proposed to rest, is hypothesized to enhance Ins(1,4,5)P₃ binding³². This hydrophobic patch is missing from both EhIP6KA and HsIP6K2 (Fig. 2c). We introduced HsIP3KA-like hydrophobic residues into the corresponding region of the IP helices of HsIP6K2 by preparing a single Gln240Met mutant and a tandem Asn239Tyr/Gln240Met mutant. These two mutant enzymes both exhibited a 50-fold increase in the rate of Ins(1,4,5)P₃ phosphorylation (Fig. 6a). Moreover, the variety of products that were formed was significantly increased (compare Fig. 6b and e), perhaps by favoring multiple ligand-binding modes. Arg242Ala is another mutation that increases the hydrophobicity of the IP helices; this elicited a threefold increase in Ins(1,4,5)P₃ phosphorylation (Fig. 6a). Significantly, InsP₆ kinase activity of HsIP6K2 was not substantially affected by these mutations to Asn239, Gln240 or Arg242 (Fig. 6a). These mutagenic data confirm the structural information that indicate InsP₆ and Ins(1,4,5)P₃ have non-overlapping orientations in the substrate-binding site. InsP₆ cannot interact with the synthetic hydrophobic patch since the plane of its inositol ring is tilted away from the plane of the IP helices, unlike that of Ins(1,4,5)P₃ (Fig. 5b,e). These mutagenic experiments also offer evolutionary insight by providing proof-of-principle of the nature of mutations to a progenitor kinase that could have increased Ins(1,4,5)P₃ kinase activity without negative trade-off from a compromised InsP₆ kinase activity.

Discussion

In this study, we describe the crystal structure of a bifunctional IP6K/IP3K from E. histoloytica (EhIP6KA), and we extrapolate our findings to a human IP6K with mutagenic and biochemical experiments. The most important new ideas that we draw from this information are as follows: first, the geometry of the substrate-binding site is revealed to exhibit a relatively spacious, open clamshell geometry; one jaw is represented by a pair of α-helices, the other jaw is an unusually long 3₁₀ helix. Second, we show that InsP₃ and InsP₆ have non-overlapping orientations within the substrate pocket. Thus, relatively large InsPs (Ins(1,3,4,5,6)P₅/InsP₆) form contacts with both the α-helices and the 3₁₀ helix. In contrast, the smaller InsP₃ molecule is rotated 55° closer to the α-helices; the latter provide most of the protein’s interactions with InsP₃. Third, we describe an unusual evolutionary trajectory that could have favored efficient bifunctionality in a primordial kinase, prior to propagation of separate, dedicated IP3Ks and IP6Ks.

Previous ideas concerning how specialized enzymes diverged from promiscuous progenitors are based on the paradigm that the native catalytic activity should generally involve a substrate that is smaller than the emerging substrate, without a change in its degree of polarity³⁰. For the putative primordial IP6K⁹, the original, preferred substrate (InsP₆) would have been both larger and substantially more polar than the InsP₃ substrates for the emerging kinases (IPMK and IP3K). Usually, the evolution of increased catalytic activity against smaller substrates depends upon compression of the active site³⁰. That development would be expected to reduce activity against the larger InsP₆ molecule—a ‘negative trade-off’—that would impede organismic fitness and thereby select against the emergence of the InsP₃/InsP₄ kinase activities³⁰. However, our substrate-bound structures of EhIP6KA uncover a partial separation of the binding sites for Ins(1,4,5)P₃ and InsP₆. It is because of these non-overlapping substrate orientations that the insertion of a hydrophobic patch into the α-helices can enhance IP3K activity without affecting IP6K activity: an avoidance of negative trade-off that would have favored efficient bifunctionality. It appears that E. histolytica may be a particularly appropriate model for gaining insight into evolution of a hybrid IP6K/IP3K, since current annotations of this organism’s genome indicate that it does not encode a specialized Ins(1,4,5)P₃ 3-kinase. Thus, we conclude that EhIP6KA is the enzymatic equivalent of a ‘living fossil’ that is suggestive of the nature of a primordial IP6K prior to gene duplication. After the latter event had occurred, it would appear that evolutionary gain of function of Ins(1,4,5)P₃ phosphorylation would then have involved atrophy of the 3₁₀ helix and consolidation of the role of the IP helices in substrate binding (Fig. 5e). In HsIP3KA, the IP helices have been replaced with a distinct, highly structured 63-residue inositol–phosphate-binding domain: four helices with greater structural constraints that limit substrate selectivity to Ins(1,4,5)P₃ alone^31,32. The 3₁₀ helix has also been lost from IPMK (Fig. 5e), but the substrate-binding pocket remains relatively spacious, thereby retaining a degree of positional promiscuity.

Each of the inositol phosphate kinases that share the PDKG motif—IP6Ks, IPMKs and IP3Ks—are specialized to synthesize unique InsPs with differing biological actions. Our molecular understanding of these catalytic specializations has been incomplete, since among these proteins, only HsIP3KA has previously been co-crystallized with substrate³². In contrast, the published crystal structures of IPMK^26,28 lacked bound substrate. Thus, our atomic level description of a substrate-bound IP6K fills a significant void in our structural and molecular understanding of the determinants of catalytic activity in the entire PDKG motif kinase family. This information is also relevant to IP5K—previously thought to be the only inositol phosphate kinase capable of phosphorylating the 2-OH. Nevertheless, in crystals of substrate-bound IP5K, the orientation of the axial 2-OH of Ins(1,3,4,5,6)P₅, relative to ATP, is very similar to the orientation of the equatorial 3-OH of Ins(1,4,5)P₃, relative to ATP, in crystals of HsIP3KA⁴⁴. Furthermore, the current study shows that the inositol ring of Ins(1,4,5)P₃ occupies very similar relative positions in the active sites of EhIP6KA and HsIP3KA (Fig. 5; Supplementary Fig. 5). This spatial conservation of substrate binding between these different inositol phosphate kinases is also matched by spatial conservation of some key active-site residues⁴⁵. Such observations help to rationalize our observation that EhIP6KA phosphorylates Ins(1,4,5)P₃ at the 2-position (Fig. 1d,e; Supplementary Fig. 5). Finally, our IP6K structure provides the missing template necessary for the rational design of inhibitors that might selectively target each of the different kinases that contain the PDKG motif, both for research tools and therapeutic applications.

Methods

Protein expression and purification

In this study, we use EhIP6KA as an abbreviation for the E. histolytica IP6K with Genbank accession number XP_648490.2, so as to distinguish it from two other gene products of that are also annotated as IP6Ks. A previous study²⁰ named this enzyme as EhIPK1. A codon-optimized cDNA for expression in Escherichia coli of EhIP6KA was synthesized by Genscript 5′-ATGAACACGAAAATCAAACGCGAACACATGAGTACGAAGAAAAGCCAATGGGTCCAAGCAGGTGGTCACGGTGGTCCGCAACAACTGCATCCGGATGGCCAGTACCTGCTGAAACCGTGCCTGTCCCATCGTGAACGCGACTTTTATCTGCACATTAAAGATGACAAGGAATGGACCGGCACGGGTATTATCCCGAAATTCTACGGCGTCGAACTGCACGAATTTGGCTTCGGTGAACTGGAATTTATCCGTATGGAAAACCTGATGTACAAATACAAGCGCCCGTTCGTTCTGGATCTGAAAATCGGCACCCAAACGTGGGACCCGGAAACCGCGAGCAGCAAAATGAAAAAGCGTCTGGTGGTTGATTCGACCAGCACCACGACCTCTCTGGGCGTGCGTTTTAGTGGTATGGAACGCAATATTGGCGAAGAAAAACCGATCCTGTATTCGCGTTACCTGTGTACCCATGAAGTTAACACGCGCGATAGCCTGAAGGAATACATCAAGCTGTTTTTCAACGACGGTAAAAAGTACCGTAAGGAACTGGTTCCGTACTTTATTAGCCAGCTGGATAAAATGATCGAAGTCATGAAAAAGCGCGAATATAAGATGTTTAGTTCCTCAGTCCTGTTCGTGTACGATTCTACGACCACGCTGGAAGACAAGAAGTACAACTGCAAGATGATCGATTTCGCCCACAATTGGATTCTGTCAGAAGAAGAATGTACCGTGGAAGATGGCTTTCTGTTCGGTCTGAACAATCTGAAATCCATTCTGGAAGACATCGAAAACGAATTTAAGTCACTGTAA-3′.

The Gateway Expression System (Invitrogen) was used to subclone EhIP6KA into the pDest-566 vector. This vector encodes a 6 × His tag, a maltose-binding protein tag and TEV protease cleavage site at the N terminus. ArcticExpress (DE3)-competent cells (Stratagene) were transformed with the resultant plasmid. An overnight culture of E. coli cells carrying the pDest-566-EhIP6KA was inoculated into 2 × yeast extract tryptone medium at pH 7.5 and grown at 37 °C to A₅₉₅=0.7. Isopropyl β-D-thiogalactopyranoside (0.1 mM) was then added and cultures were continued at 15 °C for 1 day. The cells were disrupted (Constant Systems) at 20 kPsi. Recombinant EhIP6KA proteins were purified with a Ni-NTA agarose column (Qiagen) followed by a HiTrap Q FF column (GE Healthcare). The bound proteins were released by TEV protease in the presence of 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1.5 mM DTT, 10 mM ATP, 20 mM MgCl₂, then applied to a HiTrap Q FF column. In the case of the MBP fusion protein, this TEV cleavage step was omitted. As a final step, a Superdex 200 gel filtration column (GE Healthcare) was used with a running buffer of 50 mM NaCl and 20 mM Tris-HCl, pH 7.5.

Human IP6K2 cDNA was ordered from American Type Culture Collection (I.M.A.G.E. Clone ID 6162048, ATCC number 10437631). The Gateway expression system (Invitrogen) was used to subclone the kinase into the pDest-566 vector. Lemo21(DE3)-competent E. coli cells (New England Biolabs) were transformed with the resultant plasmid. An overnight culture of E. coli cells carrying the pDest-566-HsIP6K2 was inoculated into 2 × yeast extract tryptone medium supplemented with 0.6 mM L-rhamnose at pH 7.5 and grown at 37 °C to A₅₉₅=0.7. Isopropyl β-D-thiogalactopyranoside (0.1 mM) was then added and cultures were continued at 14 °C for 2 days. The cells were disrupted using a constant cell disruption system (Constant Systems) under 20 kPsi. Recombinant HsIP6K2 was purified with a Ni-NTA agarose column (Qiagen) followed by a HiTrap Heparin HP column (GE Healthcare), TEV protease cleavage and a HiTrap Q FF column (GE Healthcare). As a final step, a Superdex 200 gel filtration column (GE Healthcare) was used with a running buffer of 150 mM NaCl and 20 mM Tris-HCl, pH 7.5. Mutant proteins were purified similarly. For site-directed mutagenesis, the 5′ version of the complementary primers was as follows (mutagenic nucleotides are emphasized):

K222A, 5′-GGTGCCTTGTGTCCTTGACCTCGCGATGGGCACACGACAACATGGTG-3′

K236A, 5′-CAACATGGTGATGATGCTTCAGAGGAGGCGGCAGCCAACCAGATCCGAAAATG-3′

Q240M, 5′-CTTCAGAGGAGAAGGCAGCCAACATGATCCGAAAATGTCAGCAGAGCACATC-3′

N239YQ240M, 5′-GCTTCAGAGGAGAAGGCAGCCTACATGATCCGAAAATGTCAGCAGAGCACATC-3′

R242A, 5′-GGAGAAGGCAGCCAACCAGATCGCAAAATGTCAGCAGAGCACATCTGCAG-3′

K243A, 5′-GAAGGCAGCCAACCAGATCCGAGCATGTCAGCAGAGCACATCTGCAGTC-3′

K273A, 5′-GTGGGCAGCTCATGTTCATGAACGCGTACCATGGACGGAAGCTATCGG-3′

Y274A, 5′-GGGCAGCTCATGTTCATGAACAAGGCCCATGGACGGAAGCTATCGGTG-3′

C257E, 5′-GTCATTGGTGTGCGTGTGGAGGGCATGCAGGTGTACCAAG-3′

R278A, 5′-GTTCATGAACAAGTACCATGGAGCGAAGCTATCGGTGCAG-3′

Recombinant DIPP1 was expressed and purified as previously described⁴⁶ with an additional, heparin-affinity purification step. The purity of all proteins was estimated to be >95% as judged by SDS–polyacrylamide gel electrophoresis. The purified proteins were concentrated and stored at −80 °C.

Sample preparation for NMR analysis

Full length EhIP6KA (1–3 mg) was incubated in 3 ml medium containing 150 mM NaCl, 20 mM Tris-HCl (pH 7.0), 2 mM MgCl₂, 3 mM ATP and 3 mM InsP₆ at 37 °C for 1 day and then 25 °C for 3 days. The reaction sample was centrifuged and filtered to remove protein, and then vacuum dried at 45 °C for 30 min.

The sample was prepared by taking up the reaction mixture in D₂O to a volume of 600 μl and adjusting the pH to 6.2 using NaOH and HCl. In addition, sodium CDTA was added to a concentration of 20 mM to alleviate broadening of the ³¹P resonances due to chemical exchange of the phosphate groups with the high concentration of Mg²⁺ in the sample. All ¹H and ³¹P chemical shifts were referenced to ~\n5 μM internal DSS or to external 85% phosphoric acid, respectively. All NMR experiments were carried out at 25 °C using a Varian Inova 600 MHz NMR spectrometers, equipped with either a 5 mm broad band NMR probe tuned to ³¹P on the observe channel and ¹H on the decoupler channel, or a Varian 5 mm ¹H{¹⁵N,¹³C} Cold Probe (Agilent, Santa Clara CA). The 1D ¹H spectra were acquired with sweep widths of 12 p.p.m., with an acquisition time of 1 s, using a 1-s relaxation delay and with presaturation of the residual water resonance during the relaxation delay. The 1D ³¹P spectrum was obtained using a 50 p.p.m. sweep width, with an acquisition time of 1.6 s, using a 1-s relaxation delay and with ¹H decoupling during acquisition. The 2D ¹H–³¹P HSQC spectrum was acquired with sweep widths of 12 p.p.m. and 25 p.p.m. in the ¹H and ³¹P dimensions, respectively, with 142.3 ms and 42 ms acquisition times in these dimensions and with ¹H decoupling during the acquisition. The 1/4J delay in the HSQC experiment was set to 31.25 ms, corresponding to a ¹H–³¹P scalar coupling of 8 Hz. The ¹H–¹H and ³¹P–³¹P COSY spectra were acquired using gradient-selected absolute value mode COSY experiments. The proton COSY experiment was acquired using 12 p.p.m. sweep widths in both dimensions, with acquisition times of 342 ms and 71 ms in the directly and indirectly detected dimensions, respectively, and with a 1-s relaxation delay, during which time, presaturation of the residual water signal was applied. The phosphorus COSY experiment was acquired using 25 p.p.m. sweep widths in both dimensions, with acquisition times of 512 ms and 32 ms in the directly and indirectly detected dimensions, respectively, and with a 1-s relaxation delay. The ³¹P–³¹P COSY spectrum was also acquired with ¹H decoupling in both dimensions. All spectra were processed using Varian VnmrJ 2.2D software (Agilent) on the Varian Inova spectrometer.

Enzyme assays and HPLC analysis

Kinase assays were performed by incubating enzyme preparations with either [³H]Ins(1,4,5)P₃ (American Radiolabeled Chemicals, Saint Louis, MO), [¹⁴C]-Ins(1,3,4,5,6)P₅ (isolated from [¹⁴C]-labelled parotid acinar cells⁴⁷) or [³H]InsP₆ (Perkin-Elmer Waltham MA) at 37 °C in buffer containing 150 mM KCl, 20 mM HEPES pH 7.0, 12 mM MgSO₄, 10 mM ATP, 1 mM EDTA. After either 20 min (InsP₆ phosphorylation) or 0.5–7 h (Ins(1,4,5)P₃ phosphorylation) reactions were acid quenched and neutralized⁴⁸, and analysed by HPLC using either a 4.6 × 125 mm Partisphere 5 μm SAX column or a Q100 SAX column. The Partisphere column was eluted with one of two ammonium phosphate elution protocols: Gradient 1 (ref. 48)⁴⁸ or Gradient 2 (ref. 49)⁴⁹. The Q100 column was eluted with a gradient generated from Buffer A (1 mM Na2EDTA) and Buffer B (Buffer A plus 2 M NH₄H₂PO₄ pH 3.9 with H₃PO₄) in the following manner: 0–5 min, 0% B; 5–100 min, 0–42% B, 110–140 min, 42–70% B (Gradient 3). Radioactivity was measured either with an in-line counter, or after collecting 1 ml or 0.5 ml fractions. Other radiolabelled InsPs used for HPLC standards included [³H]Ins(1,2,4,5)P₄ (prepared by heating [³H]Ins(1,3,4,5)P₄ in 0.5 ml 1 M HCl at 90 °C for 20 min⁵⁰), [¹⁴C]-Ins(1,3,4,5)P₄ and [¹⁴C]-Ins(1,4,5,6)P₄ (isolated from carbachol-stimulated, [¹⁴C]-labelled parotid acinar cells⁴⁷), PP-[³H]InsP₄ and [PP]₂-[³H]InsP₃ (both prepared by hIP6K2-mediated phosphorylation of [³H]-Ins(1,3,4,5,6)P₅³⁶). Data for the kinase assays are presented as mean values±s.e.

Crystallization

The MBP fusion protein of EhIP6KA (residues 32–270) was crystallized by hanging drop vapour diffusion against a well buffer of 12% (w/v) PEG 3350, 50 mM NaH₂PO₄, pH 5.5 at 18 °C. The protein concentration was >60 mg ml⁻¹. The core catalytic domain of EhIP6KA (residues 20–270) was crystallized by hanging drop vapour diffusion for 1 week against a well buffer of 8% (w/v) PEG 3350, 100 mM Na₃Citrate, pH 5.2 at 25 °C, followed by dilution microseeding (Seed Bead kit, Hampton Research) for 2 weeks with a well buffer of 8% (w/v) PEG 3,350, 100 mM Na₃Citrate, pH 5.2, 8% ethylene glycol at 25 °C. The crystals were displayed as a thin plate and were anisotropic. Crystals of EhIP6KA (residues 27–270) emerged under 0.4 M NaH₂PO₄ in the presence of 10 mM ATP, plus either 10 mM InsP₆, 5 mM Ins(1,3,4,5,6)P₅ or 5 mM Ins(1,4,5)P₃/20 mM MgCl₂. To increase occupancy of InsPs and remove the effect of phosphate ions, the crystals were further soaked under 22% (w/v) PEG 3350, 10 mM MgCl₂, 10 mM ATP, 0.1 M sodium acetate, pH 5.2 and 20 mM InsP₆, 10 mM Ins(1,3,4,5,6)P₅ or 10 mM Ins(1,4,5)P₃ for 3 days. Cryosolvent was prepared by adding 33% ethylene glycol into the soaking buffer.

Data collection and structure determination

Diffraction data were collected using APS beamlines 22-ID and 22-BM. All data were processed with the programme HKL2000 (ref. 51)⁵¹. Initial phases for the structure of MBP-EhIPK1 were determined by molecular replacement using MBP (1ez9) and HsIP3KA (1w2c) as searching models. Then the first structure was manually rebuilt with COOT⁵² and refined with REFMAC from the CCP4 package⁵³. The other crystal structures were determined either by molecular replacement if the space group was different, or by using rigid body and direct Fourier synthesis, and refined with the equivalent and expanded test sets. A Cartesian-simulated annealing protocol was performed in the first round of refinement. Ligand topology and parameter files were prepared using the incorporated PRODRG programme from the CCP4 package⁵³. The molecular graphics representations were prepared with the programme PyMol (Schrödinger, LLC).

Additional information

Accession codes: Atomic coordinates and structure factors have been deposited in the Protein Data Bank with accession codes: 4O4B, EhIP6KA (residues 32–270) tagged with maltose-binding protein at the N terminus; 4O4C, apo-EhIP6KA (residues 20–270); 4O4D, EhIP6KA (residues 27–270) in complex with ATP and Ins(1,4,5)P₃; 4O4E, EhIP6KA (residues 27–270) in complex with ATP and Ins(1,3,4,5,6)P₅; 4O4F, EhIP6KA (residues 27–270) in complex with ATP and InsP₆.

How to cite this article: Wang, H. et al. IP6K structure and the molecular determinants of catalytic specificity in an inositol phosphate kinase family. Nat. Commun. 5:4178 doi: 10.1038/ncomms5178 (2014).

Accession codes

Accessions

Protein Data Bank

References

Shears, S. B. Diphosphoinositol polyphosphates: metabolic messengers? Mol. Pharmacol. 76, 236–252 (2009).
Article CAS Google Scholar
Wilson, M. S., Livermore, T. M. & Saiardi, A. Inositol pyrophosphates: between signalling and metabolism. Biochem. J. 452, 369–379 (2013).
Article CAS Google Scholar
Szijgyarto, Z., Garedew, A., Azevedo, C. & Saiardi, A. Influence of inositol pyrophosphates on cellular energy dynamics. Science 334, 802–805 (2011).
Article CAS ADS Google Scholar
Illies, C. et al. Inositol pyrophosphates determine exocytic capacity. Science 318, 1299–1302 (2007).
Article CAS ADS Google Scholar
Chakraborty, A. et al. Inositol pyrophosphates inhibit AKT signaling, thereby regulating insulin sensitivity and weight gain. Cell 143, 897–910 (2010).
Article CAS Google Scholar
Lee, Y. S., Mulugu, S., York, J. D. & O’Shea, E. K. Regulation of a cyclin-CDK-CDK inhibitor complex by inositol pyrophosphates. Science 316, 109–112 (2007).
Article CAS ADS Google Scholar
Gokhale, N. A., Zaremba, A., Janoshazi, A. K., Weaver, J. D. & Shears, S. B. PPIP5K1 modulates ligand competition between diphosphoinositol polyphosphates and PtdIns(3,4,5)P3 for polyphosphoinositide-binding domains. Biochem. J. 453, 413–426 (2013).
Article CAS Google Scholar
Pulloor, N. K. et al. Human genome-wide RNAi screen identifies an essential role for inositol pyrophosphates in type-I interferon response. PLoS Pathog. 10, e1003981 (2014).
Article Google Scholar
Bennett, M., Onnebo, S. M., Azevedo, C. & Saiardi, A. Inositol pyrophosphates: metabolism and signaling. Cell. Mol. Life Sci. 63, 552–564 (2006).
Article CAS Google Scholar
Saiardi, A., Erdjument-Bromage, H., Snowman, A., Tempst, P. & Snyder, S. H. Synthesis of diphosphoinositol pentakisphosphate by a newly identified family of higher inositol polyphosphate kinases. Curr. Biol. 9, 1323–1326 (1999).
Article CAS Google Scholar
Saiardi, A., Nagata, E., Luo, H. R., Snowman, A. M. & Snyder, S. H. Identification and characterization of a novel inositol hexakisphosphate kinase. J. Biol. Chem. 276, 39179–39185 (2001).
Article CAS Google Scholar
Draskovic, P. et al. Inositol hexakisphosphate kinase products contain diphosphate and triphosphate groups. Chem. Biol. 15, 274–286 (2008).
Article CAS Google Scholar
Lin, H. et al. Structural analysis and detection of biological inositol pyrophosphates reveals that the VIP/PPIP5K family are 1/3-kinases. J. Biol. Chem. 284, 1863–1872 (2009).
Article CAS Google Scholar
Bhandari, R., Juluri, K. R., Resnick, A. C. & Snyder, S. H. Gene deletion of inositol hexakisphosphate kinase 1 reveals inositol pyrophosphate regulation of insulin secretion, growth, and spermiogenesis. Proc. Natl Acad. Sci. USA 105, 2349–2353 (2008).
Article CAS ADS Google Scholar
Ghosh, S. et al. Inositol hexakisphosphate kinase 1 maintains hemostasis in mice by regulating platelet polyphosphate levels. Blood 122, 1478–1486 (2013).
Article CAS Google Scholar
Jadav, R. S., Chanduri, M. V., Sengupta, S. & Bhandari, R. Inositol pyrophosphate synthesis by inositol hexakisphosphate kinase 1 is required for homologous recombination repair. J. Biol. Chem. 288, 3312–3321 (2012).
Article Google Scholar
Burton, A., Azevedo, C., Andreassi, C., Riccio, A. & Saiardi, A. Inositol pyrophosphates regulate JMJD2C-dependent histone demethylation. Proc. Natl Acad. Sci. USA 110, 18970–18975 (2013).
Article CAS ADS Google Scholar
Morrison, B. H., Bauer, J. A., Kalvakolanu, D. V. & Lindner, D. J. Inositol hexakisphosphate kinase 2 mediates growth suppressive and apoptotic effects of interferon-b in ovarian carcinoma cells. J. Biol. Chem. 276, 24965–24970 (2001).
Article CAS Google Scholar
Morrison, B. H. et al. Gene deletion of inositol hexakisphosphate kinase 2 predisposes to aerodigestive tract carcinoma. Oncogene 28, 2383–2392 (2009).
Article CAS Google Scholar
Loser, B. et al. A novel Entamoeba histolytica inositol phosphate kinase catalyzes the formation of 5PP-Ins(1,2,3,4,6)P(5). Mol. Biochem. Parasitol. 181, 49–52 (2012).
Article Google Scholar
Odom, A. R., Stahlberg, A., Wente, S. R. & York, J. D. A role for nuclear inositol 1,4,5-trisphosphate kinase in transcriptional control. Science 287, 2026–2029 (2000).
Article CAS ADS Google Scholar
Saiardi, A., Caffrey, J. J., Snyder, S. H. & Shears, S. B. Inositol polyphosphate multikinase (ArgRIII) determines nuclear mRNA export in Saccharomyces cerevisiae. FEBS Lett. 468, 28–32 (2000).
Article CAS Google Scholar
Chang, S.-C., Miller, A. L., Feng, Y., Wente, S. R. & Majerus, P. W. The human homologue of the rat inositol phosphate multikinase is an inositol 1,3,4,6-tetrakisphosphate 5-kinase. J. Biol. Chem. 277, 43836–43843 (2002).
Article CAS Google Scholar
Yang, X. & Shears, S. B. Multitasking in signal transduction by a promiscuous human Ins(3,4,5,6)P4 1-Kinase/Ins(1,3,4)P3 5/6-Kinase. Biochem. J. 351, 551–555 (2000).
Article CAS Google Scholar
Shears, S. B. How versatile are inositol phosphate kinases? Biochem. J. 377, 265–280 (2004).
Article CAS Google Scholar
Holmes, W. & Jogl, G. Crystal structure of inositol phosphate multikinase 2 and implications for substrate specificity. J. Biol. Chem. 281, 38109–38116 (2006).
Article CAS Google Scholar
Miller, G. J., Wilson, M. P., Majerus, P. W. & Hurley, J. H. Specificity determinants in inositol polyphosphate synthesis: crystal structure of inositol 1,3,4-trisphosphate 5/6-kinase. Mol. Cell 18, 201–212 (2005).
Article CAS Google Scholar
Endo-Streeter, S., Tsui, M. K., Odom, A. R., Block, J. & York, J. D. Structural studies and protein engineering of inositol phosphate multikinase. J. Biol. Chem. 287, 35360–35369 (2012).
Article CAS Google Scholar
Chamberlain, P. P. et al. Integration of inositol phosphate signaling pathways via human ITPK1. J. Biol. Chem. 282, 28117–28125 (2007).
Article CAS Google Scholar
Khersonsky, O. & Tawfik, D. S. Enzyme promiscuity: a mechanistic and evolutionary perspective. Annu. Rev. Biochem. 79, 471–505 (2010).
Article CAS Google Scholar
Miller, G. J. & Hurley, J. H. Crystal structure of the catalytic core of inositol 1,4,5-trisphosphate 3-kinase. Mol. Cell. 15, 703–711 (2004).
Article CAS Google Scholar
Gonzalez, B. et al. Structure of a human inositol 1,4,5-trisphosphate 3-kinase; substrate binding reveals why it is not a phosphoinositide 3-kinase. Mol. Cell 15, 689–701 (2004).
Article CAS Google Scholar
Albert, C. et al. Biological variability in the structures of diphosphoinositol polyphosphates in Dictyostelium discoideum and mammalian cells. Biochem. J. 327, 553–560 (1997).
Article CAS Google Scholar
Kilari, R. S., Weaver, J. D., Shears, S. B. & Safrany, S. T. Understanding inositol pyrophosphate metabolism and function: kinetic characterization of the DIPPs. FEBS Lett. 587, 3464–3470 (2013).
Article CAS Google Scholar
Barker, C. J., Illies, C., Gaboardi, G. C. & Berggren, P. O. Inositol pyrophosphates: structure, enzymology and function. Cell. Mol. Life Sci. 66, 3851–3871 (2009).
Article CAS Google Scholar
Saiardi, A., Caffrey, J. J., Snyder, S. H. & Shears, S. B. The inositol hexakisphosphate kinase family: catalytic flexibility, and function in yeast vacuole biogenesis. J. Biol. Chem. 275, 24686–24692 (2000).
Article CAS Google Scholar
Verbsky, J. W., Wilson, M. P., Kisseleva, M. V., Majerus, P. W. & Wente, S. R. The synthesis of inositol hexakisphosphate: characterization of human inositol 1,3,4,5,6-pentakisphosphate 2-kinase. J. Biol. Chem. 277, 31857–31862 (2002).
Article CAS Google Scholar
Safrany, S. T. et al. A novel context for the ‘MutT’ module, a guardian of cell integrity, in a diphosphoinositol polyphosphate phosphohydrolase. EMBO J. 17, 6599–6607 (1998).
Article CAS Google Scholar
Vieira-Pires, R. S. & Morais-Cabral, J. H. 3(10) helices in channels and other membrane proteins. J. Gen. Physiol. 136, 585–592 (2010).
Article CAS Google Scholar
Pal, L. & Basu, G. Novel protein structural motifs containing two-turn and longer 3(10)-helices. Protein Eng. 12, 811–814 (1999).
Article CAS Google Scholar
Padmanabhan, U., Dollins, D. E., Fridy, P. C., York, J. D. & Downes, C. P. Characterization of a selective inhibitor of inositol hexakisphosphate kinases: Use in defining biological roles and metabolic relationships of inositol pyrophosphates. J. Biol. Chem. 284, 10571–10582 (2009).
Article CAS Google Scholar
Mildvan, A. S. Mechanisms of signaling and related enzymes. Proteins 29, 401–416 (1997).
Article CAS Google Scholar
Nagata, E. et al. Inositol hexakisphosphate kinase-2, a physiologic mediator of cell death. J. Biol. Chem. 280, 1634–1640 (2005).
Article CAS Google Scholar
Gonzalez, B., Banos-Sanz, J. I., Villate, M., Brearley, C. A. & Sanz-Aparicio, J. Inositol 1,3,4,5,6-pentakisphosphate 2-kinase is a distant IPK member with a singular inositide binding site for axial 2-OH recognition. Proc. Natl Acad. Sci. USA 107, 9608–9613 (2010).
Article CAS ADS Google Scholar
Wang, H., Falck, J. R., Hall, T. M. & Shears, S. B. Structural basis for an inositol pyrophosphate kinase surmounting phosphate crowding. Nat. Chem. Biol. 8, 111–116 (2012).
Article CAS Google Scholar
Yang, X., Safrany, S. T. & Shears, S. B. Site-directed mutagenesis of DIPP, a dual specificity MutT/Nudix-type hydrolase that attacks diadenosine polyphosphates and diphosphoinositol polyphosphates. J. Biol. Chem. 274, 35434–35440 (1999).
Article CAS Google Scholar
McConnell, F. M., Stephens, L. R. & Shears, S. B. Multiple isomers of inositol pentakisphosphate in Epstein-Barr-virus-transformed (T5-1) B-lymphocytes. Identification of inositol 1,3,4,5,6-pentakisphosphate, D-inositol 1,2,4,5,6-pentakisphosphate and L-inositol 1,2,4,5,6-pentakisphosphate. Biochem. J. 280, 323–329 (1991).
Article CAS Google Scholar
Weaver, J. D., Wang, H. & Shears, S. B. The kinetic properties of a human PPIP5K reveal that its kinase activities are protected against the consequences of a deteriorating cellular bioenergetic environment. Biosci. Rep. 33, 228–241 (2013).
Article Google Scholar
Safrany, S. T. & Shears, S. B. Turnover of bis-diphosphoinositol tetrakisphosphate in a smooth muscle cell line is regulated by b2- adrenergic receptors through a cAMP-mediated, A-kinase-independent mechanism. EMBO J. 17, 1710–1716 (1998).
Article CAS Google Scholar
Brearley, C. A. & Hanke, D. E. Metabolic evidence for the order of addition of individual phosphate esters to the myo-inositol moiety of inositol hexakisphosphate in the duckweed Spirodela polrhiza L. Biochem. J. 314, 227–233 (1996).
Article CAS Google Scholar
Otwinowski, Z. & Minor, W. Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol. 276, 307–326 (1997).
Article CAS Google Scholar
Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallogr. D Biol. Crystallogr. 60, 2126–2132 (2004).
Article Google Scholar
Winn, M. D., Murshudov, G. N. & Papiz, M. Z. Macromolecular TLS refinement in REFMAC at moderate resolutions. Methods Enzymol. 374, 300–321 (2003).
Article CAS Google Scholar
Chakraborty, A. et al. HSP90 regulates cell survival via inositol hexakisphosphate kinase-2. Proc. Natl Acad. Sci. USA 105, 1134–1139 (2008).
Article CAS ADS Google Scholar
Chakraborty, A. et al. Casein kinase-2 mediates cell survival through phosphorylation and degradation of inositol hexakisphosphate kinase-2. Proc. Natl Acad. Sci. USA 108, 2205–2209 (2011).
Article CAS ADS Google Scholar

Download references

Acknowledgements

This research was supported by the Intramural Research Programme of the NIH, National Institute of Environmental Health Sciences. We thank T.M. Hall and L.C. Pedersen for discussions and critical reading of the manuscript, the NIEHS Collaborative crystallography group, the Advanced Photon Source (APS) Southeast Regional Collaborative Access Team (SER-CAT) 22-ID and 22-BM beam lines for assistance with crystallographic data collection.

Author information

Authors and Affiliations

Inositol Signaling Group, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC 27709, North Carolina, USA
Huanchen Wang & Stephen B. Shears
Nuclear Magnetic Resonance Group, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC 27709, North Carolina, USA
Eugene F. DeRose & Robert E. London

Authors

Huanchen Wang
View author publications
You can also search for this author in PubMed Google Scholar
Eugene F. DeRose
View author publications
You can also search for this author in PubMed Google Scholar
Robert E. London
View author publications
You can also search for this author in PubMed Google Scholar
Stephen B. Shears
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

H.W., E.F.D. and S.B.S. performed experiments. All authors designed experiments and wrote the paper.

Corresponding author

Correspondence to Stephen B. Shears.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Supplementary information

Supplementary Information

Supplementary Figures 1-6 and Supplementary Table 1 (PDF 545 kb)

Rights and permissions

Reprints and permissions

About this article

Cite this article

Wang, H., DeRose, E., London, R. et al. IP6K structure and the molecular determinants of catalytic specificity in an inositol phosphate kinase family. Nat Commun 5, 4178 (2014). https://doi.org/10.1038/ncomms5178

Download citation

Received: 27 January 2014
Accepted: 21 May 2014
Published: 24 June 2014
DOI: https://doi.org/10.1038/ncomms5178

This article is cited by

Origin, evolution, and diversification of inositol 1,4,5-trisphosphate 3-kinases in plants and animals
- Tao Xiong
- Zaibao Zhang
- Ziyi Ye
BMC Genomics (2024)
Biochemical and structural characterization of an inositol pyrophosphate kinase from a giant virus
- Guangning Zong
- Yann Desfougères
- Huanchen Wang
The EMBO Journal (2024)
Plant phosphate nutrition: sensing the stress
- Viswanathan Satheesh
- Ayesha Tahir
- Mingguang Lei
Stress Biology (2022)
The living fossil concept: reply to Turner
- Scott Lidgard
- Alan C. Love
Biology & Philosophy (2021)
Crystallographic and kinetic analyses of human IPMK reveal disordered domains modulate ATP binding and kinase activity
- Corey D. Seacrist
- Raymond D. Blind
Scientific Reports (2018)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.