Missing sequence information for the RNAi probes used in the letter by Wang et al. (Nature Cell Biol. 9, 470–478; 2007) is shown below:

ERα validated Stealth RNAi targeted the sequences GCTACTGTGCAGTGTGCAATGACTA and GCTTAATTCTGGAGTGTACACATTT and Stealth RNAi negative controls contained a comparable amount of GC, low GC and medium GC, respectively (#12935-200 and #12935-300, Invitrogen).