Abstract
High humidity has a strong influence on the development of numerous diseases affecting the above-ground parts of plants (the phyllosphere) in crop fields and natural ecosystems, but the molecular basis of this humidity effect is not understood. Previous studies have emphasized immune suppression as a key step in bacterial pathogenesis. Here we show that humidity-dependent, pathogen-driven establishment of an aqueous intercellular space (apoplast) is another important step in bacterial infection of the phyllosphere. Bacterial effectors, such as Pseudomonas syringae HopM1, induce establishment of the aqueous apoplast and are sufficient to transform non-pathogenic P. syringae strains into virulent pathogens in immunodeficient Arabidopsis thaliana under high humidity. Arabidopsis quadruple mutants simultaneously defective in a host target (AtMIN7) of HopM1 and in pattern-triggered immunity could not only be used to reconstitute the basic features of bacterial infection, but also exhibited humidity-dependent dyshomeostasis of the endophytic commensal bacterial community in the phyllosphere. These results highlight a new conceptual framework for understanding diverse phyllosphere–bacterial interactions.
This is a preview of subscription content, access via your institution
Access options
Subscribe to this journal
Receive 51 print issues and online access
$199.00 per year
only $3.90 per issue
Buy this article
- Purchase on Springer Link
- Instant access to full article PDF
Prices may be subject to local taxes which are calculated during checkout
Similar content being viewed by others
References
Miller, S., Rowe, R. & Riedel, R. Bacterial spot, speck, and canker of tomatoes. Ohio State University Extension Fact Sheet HYG-3120–96 (1996)
Pernezny, K. & Zhang, S. Bacterial speck of tomato. University of Florida IFAS Extension PP-10 (2005)
Schwartz, H. F. Bacterial diseases of beans. Colorado State University Extension. Fact Sheet No: 2.913. (2011)
Stevens, R. B. Plant Pathology, an Advanced Treatise. Vol. 3, 357–429 (Academic, 1960)
Büttner, D. & He, S. Y. Type III protein secretion in plant pathogenic bacteria. Plant Physiol. 150, 1656–1664 (2009)
Galán, J. E. & Collmer, A. Type III secretion machines: bacterial devices for protein delivery into host cells. Science 284, 1322–1328 (1999)
Asai, S. & Shirasu, K. Plant cells under siege: plant immune system versus pathogen effectors. Curr. Opin. Plant Biol. 28, 1–8 (2015)
Dou, D. & Zhou, J. M. Phytopathogen effectors subverting host immunity: different foes, similar battleground. Cell Host Microbe 12, 484–495 (2012)
Macho, A. P. & Zipfel, C. Targeting of plant pattern recognition receptor-triggered immunity by bacterial type-III secretion system effectors. Curr. Opin. Microbiol. 23, 14–22 (2015)
Asrat, S., Davis, K. M. & Isberg, R. R. Modulation of the host innate immune and inflammatory response by translocated bacterial proteins. Cell. Microbiol. 17, 785–795 (2015)
Sperandio, B., Fischer, N. & Sansonetti, P. J. Mucosal physical and chemical innate barriers: lessons from microbial evasion strategies. Semin. Immunol. 27, 111–118 (2015)
Gimenez-Ibanez, S., Ntoukakis, V. & Rathjen, J. P. The LysM receptor kinase CERK1 mediates bacterial perception in Arabidopsis. Plant Signal. Behav. 4, 539–541 (2009)
Macho, A. P. & Zipfel, C. Plant PRRs and the activation of innate immune signaling. Mol. Cell 54, 263–272 (2014)
Schwessinger, B. et al. Phosphorylation-dependent differential regulation of plant growth, cell death, and innate immunity by the regulatory receptor-like kinase BAK1. PLoS Genet. 7, e1002046 (2011)
Tsuda, K., Sato, M., Stoddard, T., Glazebrook, J. & Katagiri, F. Network properties of robust immunity in plants. PLoS Genet. 5, e1000772 (2009)
Yuan, J. & He, S. Y. The Pseudomonas syringae Hrp regulation and secretion system controls the production and secretion of multiple extracellular proteins. J. Bacteriol. 178, 6399–6402 (1996)
Cunnac, S. et al. Genetic disassembly and combinatorial reassembly identify a minimal functional repertoire of type III effectors in Pseudomonas syringae. Proc. Natl Acad. Sci. USA 108, 2975–2980 (2011)
Hirano, S. S. & Upper, C. D. Population biology and epidemiology of Pseudomonas syringae. Annu. Rev. Phytopathol. 28, 155–177 (1990)
Fan, J., Crooks, C. & Lamb, C. High-throughput quantitative luminescence assay of the growth in planta of Pseudomonas syringae chromosomally tagged with Photorhabdus luminescens luxCDABE. Plant J. 53, 393–399 (2008)
Badel, J. L., Shimizu, R., Oh, H. S. & Collmer, A. A Pseudomonas syringae pv. tomato avrE1/hopM1 mutant is severely reduced in growth and lesion formation in tomato. Mol. Plant Microbe Interact. 19, 99–111 (2006)
DebRoy, S., Thilmony, R., Kwack, Y. B., Nomura, K. & He, S. Y. A family of conserved bacterial effectors inhibits salicylic acid-mediated basal immunity and promotes disease necrosis in plants. Proc. Natl Acad. Sci. USA 101, 9927–9932 (2004)
Nomura, K. et al. A bacterial virulence protein suppresses host innate immunity to cause plant disease. Science 313, 220–223 (2006)
Xin, X. F. et al. Pseudomonas syringae effector Avirulence protein E localizes to the host plasma membrane and down-regulates the expression of the NONRACE-SPECIFIC DISEASE RESISTANCE1/HARPIN-INDUCED1-LIKE13 gene required for antibacterial immunity in Arabidopsis. Plant Physiol. 169, 793–802 (2015)
Wei, C. F. et al. A Pseudomonas syringae pv. tomato DC3000 mutant lacking the type III effector HopQ1-1 is able to cause disease in the model plant Nicotiana benthamiana. Plant J. 51, 32–46 (2007)
Nomura, K. et al. Effector-triggered immunity blocks pathogen degradation of an immunity-associated vesicle traffic regulator in Arabidopsis. Proc. Natl Acad. Sci. USA 108, 10774–10779 (2011)
Tanaka, H., Kitakura, S., De Rycke, R., De Groodt, R. & Friml, J. Fluorescence imaging-based screen identifies ARF GEF component of early endosomal trafficking. Curr. Biol. 19, 391–397 (2009)
Whalen, M., C., Innes, R. W., Bent, A. F. & Staskawicz, B. J. Identification of Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean. Plant Cell 3, 49–59 (1991)
Hiruma, K. et al. Root endophyte Colletotrichum tofieldiae confers plant fitness benefits that are phosphate status dependent. Cell 165, 464–474 (2016)
Hauck, P., Thilmony, R. & He, S. Y. A Pseudomonas syringae type III effector suppresses cell wall-based extracellular defense in susceptible Arabidopsis plants. Proc. Natl Acad. Sci. USA 100, 8577–8582 (2003)
Miya, A. et al. CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proc. Natl Acad. Sci. USA 104, 19613–19618 (2007)
Feng, Z. et al. Multigeneration analysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc. Natl Acad. Sci. USA 111, 4632–4637 (2014)
Bai, Y. et al. Functional overlap of the Arabidopsis leaf and root microbiota. Nature 528, 364–369 (2015)
Wang, Q., Garrity, G. M., Tiedje, J. M. & Cole, J. R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 73, 5261–5267 (2007)
Acknowledgements
We thank He laboratory members for insightful discussions and constructive suggestions. We thank J. Kremer for help with setting up real-time disease imaging experiments and advice on 16S rRNA amplicon sequencing, K. Sugimoto for providing tomato plants (cv. Castlemart), and C. Thireault for technical help. This project was supported by funding from Gordon and Betty Moore Foundation (GBMF3037), National Institutes of Health (GM109928) and the Department of Energy (the Chemical Sciences, Geosciences, and Biosciences Division, Office of Basic Energy Sciences, Office of Science; DE–FG02–91ER20021 for infrastructural support). C.Z. acknowledges support from The Gatsby Charitable Foundation.
Author information
Authors and Affiliations
Contributions
X.-F.X., K.N. and S.Y.H. designed the experiments. K.A. performed the Pst-DC3000–lux imaging experiment. A.C.V. performed biological repeats of bacterial infection experiments shown in Fig. 1a. J.Y. characterized an unpublished plant mutant line. X.-F.X. and K.N. performed all other experiments, including bacterial infections, protein blotting and generation of Arabidopsis mfec and mbbc mutant lines. F.B. and C.Z. contributed unpublished plant mutant materials. J.H.C. contributed unpublished Pst-DC3000 effector constructs. X.-F.X. and S.Y.H. wrote the manuscript with input from all co-authors.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing financial interests.
Additional information
Reviewer Information
Nature thanks G. Beattie, S. Lindow, J.-M. Zhou and the other anonymous reviewer(s) for their contribution to the peer review of this work.
Extended data figures and tables
Extended Data Figure 1 Water soaking does not affect luminescence signal.
Col-0 plants were dip-inoculated with bacteria at 2 × 108 cfu ml−1 and kept under high humidity (approximately 95%) for 2 days. Imaging was performed in the same way as in Fig. 1g. Water-soaked leaves were air-dried for about 2 h and imaged again (right panel). Images are representative of leaves from more than four plants.
Extended Data Figure 2 Humidity dependence of HopM1/AvrE1 function and restoration of the virulence of the avrE1−/hopM1− mutant in 6×His:HopM1 transgenic plants.
a, b, The virulence of the avrE1−/hopM1− mutant is insensitive to humidity settings. a, Col-0 plants were syringe-infiltrated with indicated bacteria at 2 × 105 cfu ml−1. Inoculated plants were kept under high (approximately 95%) humidity, and images were taken 24 h after infiltration. b, Col-0 plants were syringe-infiltrated with Pst-DC3000, the avrE1− mutant, the hopM1− mutant or the avrE1−/hopM1− mutant at 2 × 105 cfu ml−1. Inoculated plants were kept under high (approximately 95%) or low (20–40%) humidity. Images were taken 3 days after inoculation. Images are representative of leaves from more than four plants. c, d, The 6×His:HopM1 transgenic plants22 were infiltrated with 0.1 nM dexamesathone (DEX), the avrE1−/hopM1− mutant (at 1 × 105 cfu ml−1) or both. H2O was infiltrated as control. Infiltrated plants were kept at high humidity (approximately 95%). Leaf images were taken 24 h after infiltration (c) and bacterial populations were determined 3 days after infiltration (d). Significant difference was determined by Student’s t-test; (two-tailed); ***P = 1.03 × 10−5. n = 6 technical replicates from three independent experiments (n = 2 in each experiment); data are shown as mean ± s.d.
Extended Data Figure 3 Bacterial multiplication and water soaking in Col-0 and the atmin7 mutant.
a, The Col-0 and atmin7 plants were dip-inoculated with Pst-DC3000, the avrE1/hopM1− mutant or the hrcC− mutant at 1 × 108 cfu ml−1. Bacterial populations were determined 4 days after inoculation. Significant difference between Col-0 and atmin7 plants was determined by Student’s t-test (two-tailed); *P = 1.61 × 10−2 and 3.12 × 10−2 for DC3000 and hrcC−, respectively; ***P = 1.41 × 10−4 for avrE1−/hopM1−. n = 4 technical replicates; data are shown as mean ± s.d. Experiments were repeated three times. b, c, The Col-0 and atmin7 plants were syringe-infiltrated with Pst-DC3000, the avrE1−/hopM1− mutant or the hrcC− mutant at 1 × 106 cfu ml−1. Bacterial populations were determined 3 days after inoculation (b) and leaf images were taken 38 h after infiltration with the averE−/hopM1− mutant strain to show water soaking in atmin7 leaves (c). Significant difference between Col-0 and atmin7 plants was determined by Student’s t-test (two-tailed); **P = 1.63 × 10−3 for avrE1−/hopM1−; NS, not significant (P = 0.72 and 0.14 for DC3000 and hrcC−, respectively). n = 3 technical replicates; data are shown as mean ± s.d. Experiments were repeated three times. Images are representative of leaves from more than four plants.
Extended Data Figure 4 A working model showing the function of HopM1 and AvrE1 in creating aqueous apoplasts.
Pst-DC3000 delivers a total of 36 effectors into the plant cell. Many effectors, including AvrPto, appear to suppress pattern-triggered immunity (PTI). AvrPto inhibits pattern recognition receptor (PRR) function8. Two conserved effectors, HopM1 and AvrE1, create an aqueous apoplast in the presence of bacterial infection in a humidity-dependent manner. AvrE1 is localized to the host plasma membrane23. HopM1 targets AtMIN7 (an ARF–GEF protein) in the TGN/EE, which is involved in recycling of plasma membrane proteins26.
Extended Data Figure 5 Water-soaking is blocked during ETI.
a, Col-0 leaves were syringe-infiltrated with Pst-DC3000 (1 × 106 cfu ml−1) or Pst-DC3000(avrRpt2) (1 × 107 cfu ml−1). Plants were kept under high humidity (approximately 95%) for 24 h to observe water soaking and then shifted to low humidity (approximately 25%) for 2 h to observe ETI-associated tissue collapse. Images were taken before and after low humidity exposure (a) and bacterial populations were determined 24 h after infiltration to show similar population levels (b). Significant difference in bacterial population was determined by Student’s t-test (two-tailed); *P = 0.033. n = 3 technical replicates; data are shown as mean ± s.d. Experiments were repeated three times. This is an experimental replicate of Fig. 3b, c (without rps2 mutant plants).
Extended Data Figure 6 Characterization of the npr1-6 mutant.
a, A diagram showing the T-DNA insertion site in the npr1-6 mutant. Blue boxes indicate exons in the NPR1 gene. b, RT–PCR results showing that the npr1-6 line cannot produce the full-length NPR1 transcript. Primers used (NPR1 sequence is underlined): NPR1-F: agaattcATGGACACCACCATTGATGGA; NPR1-R: agtcgacCCGACGACGATGAGAGARTTTAC; UBC21-F: TCAAATGGACCGCTCTTATC; UBC21-R: TCAAATGGACCGCTCTTATC. Uncropped gel images are shown in Supplementary Fig. 1. c, The npr1-6 line, similar to npr1-1, is greatly compromised in benzothiadiazole (BTH)-mediated resistance to Pst-DC3000 infection. The Col-0, npr1-1 and npr1-6 plants were sprayed with 100 μM BTH and dip-inoculated with Pst-DC3000 at 1 × 108 cfu ml−1 24 h later. Bacterial populations were determined 3 days after inoculation. Significant difference between mock and BTH treatment was determined by Student’s t-test (two-tailed); *P = 0.027; ***P = 1.6 × 10−4; NS, not significant (P = 0.19). n = 3 technical replicates; data are shown as mean ± s.d. Experiments were repeated three times.
Extended Data Figure 7 Construction and characterization of the mfec and mbbc quadruple mutants.
a, CRISPR–Cas9-mediated mutations in the 4th exon of the AtMIN7 gene (exons indicated by blue boxes) in the quadruple mutant lines used in this study. The underlined sequence in the wild type (WT) indicates the region targeted by sgRNA. The number 399 indicates the nucleotide position in the AtMIN7 coding sequence. +1 and −1 indicate frame shifts in the mutant lines. b, Col-0 and various mutants used in this study have similar growth, development and morphology. Four-week-old plants are shown. c, The mfec and mbbc plants show a tendency to develop sporadic water soaking under high humidity. Five-week-old regularly-grown (around 60% relative humidity) Col-0, mfec and mbbc plants were shifted to high humidity (approximately 95%) overnight and images of mature leaves were taken after the high humidity incubation. d, Even leaves of mfec and mbbc plants that do not have sporadic water soaking have a tendency to develop some water soaking after hrcC− inoculation. Five-week-old Col-0, mfec and mbbc plants were dip-inoculated with hrcC− at 1 × 108 cfu ml−1, and kept under high humidity (approximately 95%). Leaf images were taken 2 days after inoculation. Images are representative of leaves from at least four plants. e, The non-pathogenic hrcC− mutant causes significant necrosis and chlorosis in the quadruple mutant plants. Col-0, mfec and mbbc plants were dip-inoculated with the hrcC− strain at 1 × 108 cfu ml−1. Images were taken 9 days after inoculation. This is one of the four independent experimental replications of the results presented in Fig. 5b.
Extended Data Figure 8 Multiplication of endophytic phyllosphere bacterial community.
a, An increase in the endophytic bacterial community in mfec and mbbc plants depends on high humidity. Col-0, mfec and mbbc plants were either sprayed with H2O and kept under high humidity (approximately 95%) or low humidity (around 50%). On day 5, total populations of the endophytic bacterial community were quantified. Statistical analysis was performed by one-way ANOVA with Tukey’s test (significance set at P ≤ 0.05). Bacterial populations indicated by different letters (a and b) are significantly different. n = 4 technical replicates; data are shown as mean ± s.d. Experiments were repeated three times. b, Mild chlorosis and necrosis in leaves is associated with increased endophytic bacterial community level in the mfec and mbbc quadruple mutant plants. Plants were sprayed with H2O and kept under high (approximately 95%) humidity. Images were taken 10 days after spraying. Individual leaves are enlarged and shown in the lower panel, showing mild chlorosis and necrosis in some of the mfec and mbbc leaves.
Extended Data Figure 9 Validation of 1 min as an effective surface sterilization time.
Five-week-old Col-0 plants were sprayed with H2O and kept under high humidity (approximately 95%) for 5 days. Leaves were detached, surface sterilized in 75% ethanol for 20 s, 40 s, 1 min or 2 min and then rinsed in sterile water twice. No sterilization (0 s) was used as control. Leaves were ground in sterile water and bacterial numbers were determined by serial dilutions and counting of colony-forming units on R2A plates. Statistical analysis was performed by one-way ANOVA with a Tukey’s test (significance set at P ≤ 0.05). Bacterial populations indicated by different letters (that is, a and b) are significantly different. n = 4 technical replicates; data are shown as mean ± s.d. Experiments were repeated twice with similar results.
Supplementary information
Supplementary Figure 1
This file contains uncropped gel/blot images. The red boxes indicate cropped sections that are used in the Figures and Extended Data Figures. Diagram in a indicates how the two gel blots in b and c were generated. (PDF 102 kb)
The process of Pst DC3000 infection of Arabidopsis plants.
Five-week-old Col-0 plants were dip-inoculated with Pst DC3000 at 1x108 cfu/ml. Plants were kept under high humidity (~95%) and the disease symptoms were recorded over 4 days. The process was sped up by 8,640-fold (24 h to 10 seconds). The recording started 7 h after inoculation and the red arrow indicates one leaf, as an example, that showed the transient appearance of water soaking. (MOV 7863 kb)
Rights and permissions
About this article
Cite this article
Xin, XF., Nomura, K., Aung, K. et al. Bacteria establish an aqueous living space in plants crucial for virulence. Nature 539, 524–529 (2016). https://doi.org/10.1038/nature20166
Received:
Accepted:
Published:
Issue Date:
DOI: https://doi.org/10.1038/nature20166
This article is cited by
-
Leaf microbiome dysbiosis triggered by T2SS-dependent enzyme secretion from opportunistic Xanthomonas pathogens
Nature Microbiology (2024)
-
Commensal lifestyle regulated by a negative feedback loop between Arabidopsis ROS and the bacterial T2SS
Nature Communications (2024)
-
Extracellular niche establishment by plant pathogens
Nature Reviews Microbiology (2024)
-
Nonpathogenic Pseudomonas syringae derivatives and its metabolites trigger the plant “cry for help” response to assemble disease suppressing and growth promoting rhizomicrobiome
Nature Communications (2024)
-
Understanding plant pathogen interactions using spatial and single-cell technologies
Communications Biology (2023)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.
