Amelioration of established collagen induced arthritis by systemic IL-10 gene delivery

Abstract

A novel formulation of cationic liposomes containing the novel cytofectin ACHx was used for delivery of an anti-inflammatory cytokine gene, IL-10, to mice with established collagen induced arthritis. A single intraperitoneal injection of human IL-10 expression plasmid complexed with liposomes 2 to 4 days after the onset of arthritis was sufficient to give significant and prolonged amelioration of arthritis for 30 days. Preliminary experiments suggested that the therapeutic effect was IL-10 dose-dependent. The distribution of the human IL-10 DNA after injection was widespread, including the inflamed paws. Human IL-10 mRNA was also detected in the paws 24 h after injection. IL-10 protein was below the level of detection in paws and serum but was detected in some tissues up to 10 days after injection. The target cell of transfection was demonstrated to be the macrophage. These results suggest that systemic therapy with plasmid DNA complexed with cationic liposomes merits further development as an alternative method for anti-inflammatory treatment of arthritis.

Introduction

Rheumatoid arthritis (RA) is a disease characterised by inflammation of the synovial membranes and subsequent destruction of the underlying cartilage and bone. A variety of animal models of RA have been developed and although none has all the characteristics of the human disease, collagen induced arthritis (CIA) induced by immunisation with type II collagen (CII) has many of the features of RA. The pattern of joint involvement in RA and CIA is similar with the affected joints showing thickening of the synovium by cell proliferation and infiltration, cartilage destruction and pannus formation.12 In RA, granulocytes enter the synovial fluid and mononuclear cells (including a significant proportion of macrophages) infiltrate the synovium. Depletion of phagocytic cells, either systemically3 or intra-articularly4 results in long-term amelioration of experimental arthritis demonstrating the importance of the macrophage in experimental disease. The involvement of the monocyte derived pro-inflammatory cytokines tumour necrosis factor α (TNFα), interleukin-1 (IL-1) and IL-6 has been demonstrated in both RA567 and CIA.89 During the remission phase of CIA significant amounts of IL-10 are produced8 and IL-10 has been demonstrated in the RA synovium10 alongside other regulatory cytokines (interleukin 4 and transforming growth factor β; TGFβ) and cytokine inhibitors (IL-1ra and soluble TNF receptors).111213 The presence of both pro-inflammatory cytokines and their inhibitors suggests that there is a natural balance between cytokines and their inhibitors and that this balance is disturbed during periods of inflammation.

Attempts at therapy using cytokine inhibitors have been successful in animal models and in a clinical setting. Targeting either IL-1α and β or TNFα by monoclonal antibody infusion produced significant amelioration of disease in CIA1415 and in clinical trials anti-TNFα produced significant short-term alleviation of symptoms in RA.1617 Investigators have also addressed the potential therapeutic role of regulatory cytokines and several studies have shown that IL-10 protein administered systemically before or at the time of onset of the symptoms of CIA resulted in significant amelioration of disease.181920 However, for this approach to be effective daily injections of at least 5 μg of recombinant IL-10 were required.

Whilst the transient nature of therapy with monoclonal antibodies or recombinant cytokines is well recognised,21 the potential of gene therapy in the treatment of inflammatory conditions has not generally been well investigated to date. The exception to this is the series of studies and ongoing phase I clinical trial led by Robbins and Evans which have demonstrated the applicability of anti-cytokine therapy in models of arthritis.22232425 However, the methodology employed in these studies requires intra-articular injection of ex vivo infected synovial cells directly into the affected joints.2224 Since RA is a systemic disease it is preferable to develop a delivery vehicle to carry the therapeutic gene to the joint or other sites of inflammation.

Although the aetiology of arthritis is unknown, it is evident from the depletion studies34 that macrophages are critical for the development of CIA. Macrophages readily take up liposomes26 and this ability has been exploited to deplete macrophages in vivo using liposome encapsulated cytotoxic drugs3 and to visualise sites of active inflammation in patients with RA or in experimental arthritis through the use of radiolabelled liposomes.27 Liposomes need not be injected locally since in the adjuvant arthritis model of RA, methotrexate conjugated liposomes were effective in reducing joint swelling even if delivered intravenously, due to the uptake of the liposomes by inflammed tissue of the joint.28 However, these studies used large, neutral liposomes and the potential of cationic liposomes to deliver genes to sites of inflammation has not been previously addressed. In this study we have investigated the potential of cationic liposomes to deliver a therapeutic gene to areas of inflammation using a novel formulation of liposomes. Our results suggest that uptake does indeed occur at inflamed sites and that this treatment has a significant beneficial impact on the course of CIA in DBA/1 mice.

Results

Efficient in vitro transfection using ACHx/DC-Chol:DOPE liposomes

A previous study examined the efficiency of gene delivery mediated by liposomes formulated from a systematic series of polyamine analogues of DC-Chol (3β-[N-(N′,N′-dimethylaminoethane) carbamoyl] cholesterol).29 Liposomes formulated from several of these analogues gave higher levels of transfection in vitro and in vivo than DC-Chol:DOPE (DC-Chol with dioleoyl L-α-phosphatidylethanolamine) liposomes, including liposomes formulated from analogue ACHx (3-aza-N′-cholesteryloxycarbonyl hexane 1,6-diamine; Figure 1) which was selected for further study here. In the earlier report,29 the cell line CFT1 was used for in vitro transfection and here we demonstrate that liposomes incorporating ACHx were able to transfect the mouse macrophage cell line (J774) by staining for β-galactosidase activity after transfection of J774 cells with the plasmid pCMVβ. Cells were examined under phase contrast illumination in order to distinguish cells producing β-galactosidase from those that absorbed the X-gal product after fixation. Figure 2 shows that using 10 μg of pCMVβ complexed with 48 μg (40 μl) ACHx/DCChol:DOPE liposomes, greater than 90% of cells were transfected and that if the amounts of plasmid and liposomes were increased to 15 μg and 72 μg (60 μl), respectively, staining for β-galactosidase appeared more intense, although this was not quantified. In three further experiments (using separate preparations of liposomes) transfection efficiency with ACHx/DCChol:DOPE liposomes was greater than 90% as determined by in situ β-galactosidase staining.

Figure 1
figure1

Structural formulae of the cytofectins used in this study.

Figure 2
figure2

Enumeration of transfected J774 cells. (a) Untransfected cells; (b) cells transfected with 10 μg pCMVβ complexed with 40 μl (48 μg) ACHx/DCChol:DOPE liposomes; or (c) 15 μg pCMVβ complexed with 60 μl (72 μg) ACHx/DCChol:DOPE liposomes were stained 24 h later for β-galactosidase. Experiments were performed in duplicate and are representative of four experiments. Cells were examined under both bright field and phase contrast illumination. Original magnification ×100.

The effect of in vivo IL-10 gene delivery on the course of CIA

In order to investigate the effect of gene delivery in vivo we compared two plasmids expressing human IL-10 cDNA. The two vectors pcI and pcD differ only in their promoter usage: pcI has a CMV I-E promoter with human β-globin intron and pcD has a SV40 promoter and HTLV-1 LTR. Both plasmids expressed human IL-10 protein when transfected into J774 cells in culture. However, transfection of equal amounts of the two plasmids produced different levels of IL-10 in the culture supernatant, 1.9 ng/ml by pcI Hu IL-10 and 3.6 ng/ml by pcD Hu IL-10. Using a mouse model of arthritis enabled us to study the effect of treatment on active disease and by using human rather than endogenous IL-10 we were able to trace the distribution of the transgene after injection.

Two to 4 days after the first appearance of arthritis (erythaema and slight swelling) mice with CIA were treated by intraperitoneal (i.p.) injection of plasmid complexed with ACHx/DCChol:DOPE liposomes (0.3 mg plasmid with 0.72 mg liposomes). The plasmids used for treatment were pcI HuIL-10 (number of mice per group, n = 8), pcD HuIL-10 (n = 6) or control plasmid (pcI vector; n = 9) and a fourth group of mice (n = 6) remained untreated. Mice were assessed daily for the degree of arthritis for the first 2 weeks, after which time the animals were assessed less often and assessment was no longer blinded. Mice injected with control plasmid and liposome complexes showed a transient drop in disease activity immediately following injection but full disease returned by day 6 and paw swelling reached a maximum of 113% of the day 0 value on day 8 (1.8 mm ± 0.4; Figure 3a). Mice treated with pcI HuIL-10 plasmid also showed a transient recovery followed by a return to disease, not significantly different from that of the pcI vector group (Figure 3a and b). Untreated mice were followed for the first 3 weeks and the course of disease in this group was similar to the pcI vector treated mice in terms of paw swelling and worse as judged by the grade of arthritis.

Figure 3
figure3

Comparison of effect of treatment with pcD HuIL-10 (high IL-10 expression) or pcI HuIL-10 (low IL-10 expression) on the course of arthritis. Mice with CIA of 2–4 days duration were injected i.p. with 0.3 mg of plasmid complexed with 0.72 mg of ACHx/DCChol:DOPE liposomes and were assessed for (a) paw swelling; (b) grade of arthritis. Plasmids injected were pcI vector (number of animals per group n = 9) (♦), pcI HuIL-10 n = 8 (•) or pcD HuIL-10 n = 6 (▪) on day 0. Six mice were left untreated (). The day 0 mean value is taken as 100%. The mean + s.e.m. of measurements at each time point are expressed as percentage of the day 0 mean value. Human IL-10 synthesis by J774 cells transfected with the IL-10 expression plasmids and liposome preparations subsequently used for i.p. injections was determined: 3.6 ng/ml human IL-10 for pcD Hu IL-10; 1.9 ng/ml human IL-10 for pcI HuIL-10. Asterisk indicates significant suppression of paw swelling at day 8 and 9 with pcD HuIL-10 vs pcI vector (P < 0.01; Mann–Whitney rank sum test with Yate's correction).

In contrast, injection of the expression plasmid pcD HuIL-10 to CIA affected mice had a substantial affect on the course of disease. There was an immediate fall in disease activity (similar to pcI vector and pcI Hu IL-10 treated mice) but the reduction in paw swelling was sustained, down to 27% at day 6 (0.3 mm ± 0.1) and 18% at days 14 to 30 (0.2 mm ± 0.1). The reduction in swelling was significant at day 8 and 9 (P < 0.01 compared with pcI vector; Figure 3a). After day 10 there was a marked difference in paw swelling between the pcI vector and pcD Hu IL-10 treated groups, but this was not significant due to the fall in swelling in the pcI vector treated mice. This improvement was also observed for the grade of disease (reduced to 44% at day 9 or grade of 1.2 ± 0.3 and 37% at day 14 to 27 or 1.0 ± 0.5; Figure 3b). For the period up to 30 days, four out of nine animals treated with pcI vector showed arthritis spreading to additional limbs whereas five out of six of the pcD HuIL-10 group remained free of disease for up to 1 month. However, on day 30–35, disease returned to three out of six of the pcD HuIL-10 group of mice, spreading to additional limbs and increasing both paw swelling and the grade of disease (Figure 3a and b). The number of limbs affected by arthritis in these mice was also recorded in this experiment but no differences were obvious between the groups. The number of affected limbs in the untreated, pcI vector, pcI HuIL-10 and pcD HuIL-10 treated groups was 1.3 ± 0.2, 2.0 ± 0.2, 1.4 ± 0.2 and 2.0 ± 0.3, respectively, at day 0; and 2.0 ± 0.3, 1.4 ± 0.2, 0.9 ± 0.3 and 0.8 ± 0.4 at day 9. Histological examination was performed on paws to assess if there was any evidence of a protective effect of treatment with pcD Hu IL-10 on the joints. Paws taken from mice injected with pcI vector or pcD Hu IL-10 at the same time after the onset of arthritis and with equivalent grade of disease were examined after 1 month for evidence of joint erosions (Table 1). Five joints from pcI vector and four joints from pcD Hu IL-10 treated mice were examined. Two of four paws of the IL-10 treated group showed an improvement in the grade of arthritis; none of the control group did. In spite of this improvement in the grade of arthritis, limited histological assessment did not show any difference in the extent of joint erosions between the pcI vector and pcD Hu IL-10 treated groups of mice.

Table 1 Effect of pcD Hu IL-10 treatment on established arthritis

In a second experiment mice with active CIA of 2–4 days standing were injected with either pcD vector (n = 6) or pcD HuIL-10 (n = 5) complexed with ACHx/DCCChol:DOPE liposomes or were left untreated (n = 6). Animals were examined blind for 2 weeks and assessed for limb involvement, the degree of swelling and the grade of disease. In pcD vector treated mice or those remaining untreated disease progressed for the duration of the experiment with an increase in mean paw swelling from 100% (0.9 mm ± 0.2 and 1.0 mm ± 0.2, respectively) at the time of injection to 167% and 150% (1.5 mm ± 0.3) on day 8 or 9. The grade of arthritis in these two groups also increased, from 100% (grade of 1.7 ± 0.2 and 1.9 ± 0.4) at day 0 to 159% (2.7 ± 0.6) and 158% (3.0 ± 0.8) by day 8. The course of disease in the pcD HuIL-10 injected mice showed a quite different pattern with both paw swelling and the grade of arthritis declining for the first week after treatment. In this group, paw swelling and grade were reduced to 33% (0.2 mm ± 0.1) and 50% (grade of 0.8 ± 0.2), respectively, on day 6 and remained lower than in the pcD vector treated group for 2 weeks. The reduction in grade of arthritis was significantly lower in the pcD HuIL-10 treated group compared with the vector group at day 8 (P < 0.05).

These results therefore show a transient therapeutic effect of treatment with the human IL-10 expression vector and comparison of the two vectors pcI Hu IL-10 and pcD Hu IL-10 suggests that the therapeutic effect is likely to be dose dependent.

Distribution of human IL-10 plasmid, cDNA and protein in mice with CIA

Following administration of the human IL-10 plasmid pcD Hu IL-10 complexed with ACHx/DCChol:DOPE liposomes, the tissue distribution of plasmid and mRNA product of the transgene were detected by PCR and RT-PCR, respectively. The PCR primers were designed such that they would not detect murine IL-10 DNA. Mice with active CIA were injected i.p. with 0.3 mg of pcD Hu IL-10 complexed with 0.72 mg of ACHx/DCChol:DOPE liposomes and two mice were killed for tissue sampling at each time point from 24 h to 1 month after injection. Twenty-four hours after injection, human IL-10 plasmid was present in the liver, kidney, spleen, lung and paws of mice although not in the draining (inguinal) lymph nodes of the arthritic limbs (Figure 4a) nor in the tissues of mice injected with control plasmid (pcD vector) complexed with liposomes (Figure 4d). PCR was further performed on tissues taken 2, 5, 10, 15 and 30 days after injection. A similar pattern of expression was seen on day 2, although only one of two paw samples had detectable human IL-10 DNA. On days 5, 10 and 15 human IL-10 DNA was detected in liver, kidney, spleen and lung and by day 30 only in spleen and lung (Figure 4b, c and data not shown).

Figure 4
figure4

Detection of human IL-10 plasmid DNA in mouse tissues by PCR. RNA from tissues of two mice with CIA was taken 1 day (a), 15 days (b), and 30 days (c), after injection of 0.3 mg pcD HuIL-10 complexed with ACHx/DCChol:DOPE liposomes and analysed by RT-PCR for human IL-10 plasmid (350 bp; which co-purifies with RNA) and actin cDNA (548 bp). RNA from two further mice injected with pcD vector and tissues harvested after 1 day were also analysed (d). LN, inguinal lymph node.

In order to detect human IL-10 mRNA it was necessary to treat tissue RNA preparations with DNase before reverse transcription of the RNA to remove plasmid which co-purifed with the RNA. Destruction of plasmid was confirmed by PCR of DNase treated RNA before the RT step. Human IL-10 cDNA was detected in kidney, spleen and paw 1 day after injection of pcD Hu IL-10 plasmid (Figure 5a) and for up to 7 days (data not shown) but not in control plasmid injected mice (Figure 5b). Human IL-10 protein in tissue homogenates was detected by a species specific ELISA. Expression of protein was highest in the kidney on days 1 and 2 (1300 pg/g tissue on day 1) and detectable up to day 10 in other tissues (spleen, liver and lung).

Figure 5
figure5

Detection of human IL-10 cDNA in mouse tissues by RT-PCR. Five microgrammes of RNA extracted from tissues shown was treated with DNase before cDNA synthesis and RT-PCR analysis for human IL-10 (350 bp) and actin (548 bp). (a) Two arthritic mice injected 1 day earlier with pcD HuIL-10 complexed with ACHx/DCChol:DOPE liposomes. (b) Two arthritic mice injected 1 day earlier with pcD vector complexed with ACHx/DCChol:DOPE liposomes.

Peritoneal macrophages are transfected by intraperitoneal injection

It was anticipated that intraperitoneal injection of plasmid complexed with ACHx/DCChol:DOPE liposomes would transfect macrophages at the site of injection.26 To investigate this, smears of peritoneal cells were stained by in situ hybridisation (ISH) using a probe specific for human IL-10 DNA, following i.p. injection of pcD Hu IL-10 complexed with ACHx/DCChol:DOPE liposomes. Peritoneal cells taken from an animal that had been injected with pcI vector complexed with liposomes 4 h earlier were used as a control for non-specific staining by ISH and these cells did not stain with the human IL-10 probe (Figure 6a). Immediately after injection of pcD Hu IL-10 complexed with liposomes large amounts of extracellular plasmid was detected in the peritoneal fluid, as well as adhered to the majority of the cells (Figure 6b). Thirty minutes later, there was less extracellular plasmid and more cells with positive stained cytoplasm (Figure 6c) and after 4 h the ISH staining was mainly intracellular (Figure 6d). The number of peritoneal cells staining for human IL-10 plasmid at 4 h by this procedure was 46%. By 24 h after injection the number of IL-10 DNA stained PEC had decreased to 18% (Figure 6e).

Figure 6
figure6

In situ hybridisation of peritoneal exudate cells (PEC). Smears of peritoneal cells recovered after intraperitoneal injection of 0.3 mg pcD HuIL-10 or pcI vector complexed with ACHx/DCChol:DOPE liposomes were examined by in situ hybridisation using a probe specific for human IL-10 DNA. Photomicrography was performed under bright field illumination at an original magnification of ×400. (a) PEC recovered 4 h after injection of pcI vector; (b) PEC recovered immediately after injection of pcD HuIL-10; (c) 30 min after injection of pcD HuIL-10; (d) 4 h after injection of pcD HuIL-10; and (e) 24 h after injection of pcD Hu IL-10.

In order to see if macrophages were the cells transfected, peritoneal cells were double stained for human IL-10 DNA by ISH and expression of CD11b (Mac-1; a marker of monocytes30) by immunocytochemical staining. Four hours after injection of the control pcD vector approximately 30% of cells stained with anti-CD11b (Figure 7a; six of 13 cells are CD11b positive) but these cells were not positive by ISH for IL-10 DNA (Figure 7b). Peritoneal cells recovered from two mice injected with pcD HuIL-10 complexed with two different preparations of ACHx/DCChol:DOPE liposomes also showed CD11b positive cells (Figure 7c). When double labelling was performed some of the CD11b positive cells were co-stained by ISH for human IL-10 DNA (Figure 7d), confirming macrophages as the target cell of in vivo transfection.

Figure 7
figure7

Combined human IL-10 in situ hybridisation and CD11b immunocytochemistry of peritoneal exudate cells. Smears of peritoneal exudate cells (PEC) taken 4 h after i.p. injection of 0.3 mg pcD vector complexed with ACHx/DCChol:DOPE liposomes or 0.3 mg pcD HuIL-10 complexed with ACHx/DCChol:DOPE liposomes were stained by immunoperoxidase for CD11b expression alone or by a combination of immunoperoxidase and in situ hybridisation for human IL-10 DNA. Open arrowhead indicates CD11b negative cells; closed arrowhead indicates CD11b stained cells; arrow indicates CD11b and human IL-10 DNA double stained cells. (a) pcD vector injected; PEC stained for CD11b only (b) pcD vector injected; PEC co-stained for CD11b and human IL-10 DNA. (c) pcD HuIL-10 injected; PEC stained for CD11b only (d) pcD HuIL-10 injected; PEC co-stained for CD11b and human IL-10. Original magnification ×1000.

Discussion

Although initially conceived of as a means of replacing defective genes, gene therapy has now moved into areas of medicine that involve manipulation of pathological responses31 including the immune response.3233 In inflammatory conditions such as arthritis, the pro-inflammatory cytokines are essential for disease expression and are obvious targets for antibody and gene therapy. A variety of gene therapy protocols has been tried in an attempt to control experimental arthritis and a human clinical trial is currently in progress. However, in only a few previous reports has a gene therapy protocol succeeded in controlling established arthritis. Previous studies have shown that it is possible to have a moderate impact on the severity and incidence of arthritis by pre-treating mice induced for CIA before the onset of symptoms with xenogeneic cells expressing IL-4 or IL-13.34 Similarly, pre-treatment with recombinant adenovirus encoding viral IL-10 also delayed the onset and reduced the severity of subsequent arthritis.353637 However, this treatment regime was of no benefit when tested in established arthritis.36 Moreover, the adenoviral vectors currently in use are known to produce an immune response themselves,38 thus limiting their application, particularly in an inflammatory condition, where intra-articular injection exacerbates inflammation.3639 By comparison, intramuscular injection of naked plasmid encoding IL-10 or TGFβ resulted in long-term suppression of cutaneous inflammatory lesions or experimental arthritis.4041 This suggests that a more effective approach to the treatment of chronic inflammatory conditions may be the use of a system that avoids immune reactions.

Since macrophages are essential for the development of CIA as demonstrated by depletion studies34 and macrophages are the major source of pro-inflammatory cytokines in the arthritic synovium42 these cells would be appropriate targets for gene therapy. Neutral or anionic liposomes, particularly if large, have been used to deliver drugs to macrophages in a variety of studies434445 and have been shown to traffic to sites of inflammation.2746 Such liposomes however are unsuitable for DNA delivery. Cationic liposomes, however, have been proven in other studies to deliver therapeutic genes in sufficient quantity to have a biological affect in conditions such as cystic fibrosis47 or endotoxic shock.48 They have been shown to be well tolerated in mice49 and non-immunogenic when delivered intraperitoneally50 or intra-articularly51 and our results show that ACHx/DCChol: DOPE liposomes are also well tolerated in vivo. In previous studies the transfection efficiency was not significantly greater with ACHx formulated liposomes than DCChol:DOPE liposomes.2952 Yet we have shown that a significant therapeutic effect was obtained in mice with CIA when ACHx/DCChol:DOPE liposomes were used for in vivo gene delivery.

Whalen et al37 demonstrated that intravenous administration of adenoviral vector resulted in transgene expression in serum, lung and liver for 3 days, whereas i.p. injection led to preferential expression in the spleen and less expression in serum. In our experiments utilising cationic liposomes, human IL-10 mRNA was detected in the paws 24 h after i.p. injection and IL-10 protein was detected in several tissues, particularly the kidney for 10 days after injection. There was some discrepancy in detecting human IL-10 plasmid, mRNA and protein and this probably reflects the difficulty in extracting sufficient mRNA and protein from tissues for the detection methods used here. However results of these distribution studies suggest that after i.p. injection plasmid is rapidly distributed to distant tissues, is transcribed and human IL-10 protein is synthesised in these tissues but is not released into the serum.

It is recognised that the route of administration can determine the in vivo distribution of plasmid/liposome complexes. Previous studies by Philip et al53 and Liu et al54 have shown that intravenous and intraperitoneal injections of plasmid/cationic liposome complexes produce reporter gene expression in many tissues including heart, liver, kidney and spleen. Lung tissue was only transfected by i.v. administration and lymph nodes only transfected after subcutaneous injection.55 However, it has not been previously reported that cationic liposomes can deliver plasmid to distant sites of inflammation and the mechanism of this delivery could be of therapeutic importance. Our results demonstrate the expected influx of monocytes and polymorphonuclear cells after i.p. injection of plasmid complexed with liposomes and rapid adherence and uptake of IL-10 plasmid to these cells. Moreover, CD11b positive cells recovered from the peritoneal fluid 4 h after injection co-stained by in situ hybridisation for human IL-10 DNA indicating that monocytes were transfected after i.p. injection. Whether the distal localisation to the paws is the result of circulation of these monocyte/macrophages or is due to adherence of the plasmid/liposome complexes to blood mononuclear cells is unknown.

One mechanism by which macrophages auto-regulate pro-inflammatory cytokine production is through the release of IL-1056 and there is good evidence that IL-10 functions as an anti-inflammatory agent in many situations5758 including arthritis.1819 Our results demonstrate that mice with established CIA treated with IL-10 expression plasmid complexed with liposomes were improved in terms of paw swelling and grade of disease compared with control treated mice. The rapid fall in disease activity, with an obvious reduction in swelling after just 24 h is consistent with the detection of human IL-10 cDNA and protein expression in the tissues 24 h after injection of plasmid/liposomes complexes. The reason for the initial drop in disease activity in the control group of mice given vector plasmid is uncertain. It may be related to an effect on macrophage function of the liposomes themselves since DC-Chol-containing liposomes can reduce inflammation by interfering with macrophage nitric oxide and TNF production59 or toxicity of that particular preparation of liposome–DNA complexes. However, the effect of transfection with IL-10 expression plasmid was over and above this non-specific effect and the reduction in disease was sustained. One month after injection of pcD HuIL-10, five of six mice remained almost free of disease and only one had moderate arthritis. Only at about day 30 did disease return in three out of six mice in this group. Since mice treated with the same amount of the plasmid pcI HuIL-10 (which expressed less IL-10 in tissue culture) showed only slight suppression of disease, our results suggest that amelioration of disease is related to the amount of IL-10 produced. Because of the possible effect on macrophage function of the DNA/plasmid lipoplexes themselves it was important that all injections used the same amount of plasmid and liposomes to control for this. The amounts of plasmid and liposome complexes used for in vitro transfections was high and this may explain the high percentage of cells transfected but also demonstrates that toxicity of this formulation of liposomes was generally low. The amount used for in vivo transfections is comparable to that used in similar studies.4860

It is uncertain if the prolonged amelioration of CIA observed was due to the continued expression of human IL-10 protein. Plasmid was detected in spleen and lung for as long as the amelioration lasted (30 days after injection), but IL-10 protein was not detected after 10 days. It is possible that a level of IL-10 production below the limit of detection (50 pg/g tissue for IL-10 protein) was still able to affect ongoing inflammation, particularly if the cells secreting human IL-10 were in part responsible for maintaining the inflammation. A second hypothesis to explain the prolonged amelioration of CIA is that release of a significant amount of IL-10 (a Th2 cytokine) early on in CIA may have altered the developing Th1 like T cell response. This may be the explanation for the findings of Bessis et al34 who demonstrated that IL-4 and IL-13 expressing CHO cells injected subcutaneously into CII primed mice suppressed the subsequent development of CIA. It is unlikely that in an immunocompetent animal the transplanted xenogeneic cells would be tolerated for long periods but it is possible that the transient production of IL-4 or IL-13 early on was sufficient to alter the developing Th1 like T cell response. In addition, other experimental treatments for CIA such as the use of non-depleting anti-CD4 antibodies61 or priming with CII in Freund's incomplete adjuvant862 have been suggested to exert their ameliorating effect by stimulating preferentially the development of Th2 cells and production of Th2 cytokines. However, unlike the studies reported here, none of these experiments were performed in animals with established and inflammatory arthritis. The observation that IL-10 DNA treated mice used in our experiments eventually suffered a relapse of CIA suggests that the underlying disease process was kept in check by the procedures used but was not eliminated.

In summary, we have demonstrated for the first time that cationic liposome-mediated gene delivery is a viable method for the delivery of therapeutic genes to distant inflammatory sites, and that the transgene is expressed in sufficient quantity to have a beneficial effect on established arthritis.

Materials and methods

Expression plasmids

Two types of expression plasmids for IL-10 were used in this study: pcD (which contains a SV40 promoter) containing human IL-10 cDNA was generously provided by Dr Y Chernajovsky (Kennedy Institute of Rheumatology, London, UK). To generate control pcD vector, the IL-10 cDNA was excised with XhoI. The second expression plasmid used was pcI neo (Promega, Southampton, UK, in which the promoter is from CMV) and a PstI to BamHI full length human IL-10 cDNA was cloned into pBluescript and subsequently into the EcoRI and XbaI sites of pcIneo. The plasmid pCMVb was obtained from Clontech (Palo Alto, CA, USA).

Plasmid DNA was isolated by the method of Wicks et al.63 Briefly, overnight cultures of bacteria were centrifuged and the pellet resuspended in 20% sucrose, 50 mM Tris pH 8 with lysozyme (0.8 mg/ml) and incubated on ice for 5 min. EDTA pH8 was added to 60 mM and after a further 5 min on ice Tris pH 8 was added to 50 mM and the suspension incubated for 10 min at 37°C. The resulting spheroblasts were then lysed by alkaline lysis and plasmid was isolated by Qiagen purification according to the manufacturer's instructions (Qiagen, Dorking, UK). For in vivo transfection an additional caesium chloride gradient purification step was also carried out. Following extensive washing in 70% ethanol, plasmid DNA was redissolved in TE with 150 mM sodium chloride (TE is 10 mM Tris pH 8, 1 mM EDTA pH 8) at 2 mg/ml and treated with End-X (Charles River Endosafe, Margate, UK). Endotoxin contamination of plasmid was determined using the LAL assay (Associates of Cape Cod, Liverpool, UK) and was typically less than 0.3 endotoxin units/ml.

Formulation of cationic liposomes

Structural formulae are shown in Figure 1. DCChol:DOPE liposomes were prepared by adding 6 μmol of 3β-[N-(N′,N′-dimethylaminoethane) carbamoyl] cholesterol (DCChol) and 4 μmol of dioleoyl L-a-phosphatidylethanolamine (DOPE) (supplied at 10 mg/ml in CHCl3 by Sigma, Poole, UK) to freshly distilled CH2Cl2 (5 ml) under nitrogen. DC-Chol was prepared in the manner as described by Alton et al.64 Following this, sterilised 20 mM N′-(2-hydroxyethyl) piperazine-N′-(2-ethanesulfonic acid) (HEPES; Sigma) buffer pH 7.8 (5 ml) was added and the mixture sonicated for 3 min. Organic solvents were removed under reduced pressure and the resulting liposome suspension was then sonicated for a further 3 min.

ACHx/DCChol:DOPE liposomes were formulated from 3-aza-N′-(cholesteryloxycarbonyl) hexane 1,6-diamine (ACHx), DCChol and DOPE. ACHx was synthesised as described previously.29 ACHx (2.4 mg, 4.5 μmol), DC-Chol (0.75 mg, 1.5 μmol) and DOPE (0.3 ml, 3 mg, 4 μmol; 10 mg/ml in CHCl3 by Sigma) were combined in freshly distilled CH2Cl2 (5 ml) under nitrogen, before addition of HEPES buffer, sonication and solvent removal, as above. Liposome preparations were stored at 4°C before use.

Cell culture

J774 cells (a mouse macrophage line) were kindly donated by Dr J Raynes (London School of Hygiene and Tropical Medicine) were maintained in RPMI + 5% FCS. For the transfection studies cells were allowed to adhere overnight and washed with Hank's buffered salt solution (HBSS) just before transfection.

Transfections

For in vitro transfections 10 or 15 μg of pDNA was mixed with the appropriate amount of undiluted liposomes (1.2 mg/ml) at the ratios shown, incubated for 10 min at room temperature and added to washed adherent cells in 1 ml of HBSS. After 1 h at 37°C the HBSS was replaced with RPMI + 5% FCS and the cells incubated for 24 h before harvesting for the in situ β-galactosidase or 48 h before harvesting supernatants for IL-10 ELISA. For in vivo transfections 0.3 mg of plasmid was mixed with 0.72 mg of ACHx/DCChol:DOPE liposomes (1.2 mg/ml), incubated for 10 min and injected intraperitoneally.

In situ β-galactosidase assay

Cells were washed twice with phosphate buffered saline (PBS), fixed with 2% glutaraldehyde for 1 h and incubated with X-gal solution (0.2% X-gal, 10 mM sodium phosphate pH 7, 150 mM sodium chloride, 1 mM magnesium chloride, and 3.3 mM each of potassium ferricyanide and potassium ferrocyanide) for 1–4 h. For viewing and storage the staining solution was replaced with 70% glycerol.

ELISA

Human IL-10 was detected by a capture assay using an antibody pair (18551D and 18562D Pharmingen, Cambridge Bioscience, Cambridge, UK) following the manufacturer's protocol. Briefly, ELISA plates (Costar 3590, Corning, NY, USA) were coated with capture antibody (18551D) at 1 μg/ml (in 0.1 M Na2HCO3 pH 8.2), free sites blocked with 3% bovine serum albumin in PBS and test samples incubated overnight at 4°C. Biotin conjugated detection antibody (1 μg/ml in PBS 0.05% Tween 20) was applied, followed by avidin-peroxidase (2.5 μg/ml; Sigma A3151) and substrate (OPD; Sigma P8287 0.4 mg/ml in 0.05 M citrate phosphate buffer pH 5). Purified, recombinant IL-10 (Pharmingen; 19701V) was used as the standard in this assay. For detection of human IL-10 in murine tissues, weighed pieces of post mortem samples were homogenised in RPMI + 5% FCS, centrifuged and the cleared supernatant applied in the ELISA at 50% dilution and neat (serum was applied at 20% and 10% dilutions).

RT-PCR

Mice were killed by cervical dislocation and tissue samples snap frozen in liquid nitrogen. For the isolation of total cellular RNA, frozen tissue was thawed directly in RNAzol (Biogenesis, Poole, UK) and samples individually homogenised; RNA was precipitated with isopropanol and redissolved in diethyl pyrocarbonate treated water before reverse transcription of 5 μg RNA with 100 units Superscript II (Gibco BRL, Paisley, UK). Human IL-10 plasmid (which co-purifies with the RNA in this method) and actin cDNA (as an internal control) were detected by PCR using 2.5 units Taq polymerase (Promega) and 20 pmol each of forward and reverse primers of the sequences shown below. Thirty-five PCR cycles were carried out at 95°C for 1 min, 58°C for 1 min, 72°C for 2 min and a final extension of 72°C for 7 min. PCR products were analysed on 1% agarose gels. To detect human IL-10 the following primer pair was used: 5′ TGAGAACCAAGACCCAGAC 3′ and 3′ GGGAACT CTTTGGAATAAC 5′ yielding a 350 bp product. The actin primer pair had the sequences: 5′ GTGGGGCGCC CCAGGCACCA 3′ and 3′ CTCCTTAATGTCACGCACGATTTC 5′ producing a 548 bp product. For the detection of RNA free of plasmid contamination, the RNA preparation was treated with DNase (5 units for 1 h at 37°C; then 15 min at 72°C with 2 mM EDTA) before reverse transcription.

In situ hybridisation and immunocytochemical staining

Primer specific for human IL-10 DNA (5′ CTGTTCTCAGACTGGGTGCC 3′) was labelled at the 3′ end with fluorescein-dUTP according to the manufacturer's instructions (Amersham, UK; RPN3400). After i.p. injection of liposome–plasmid complexes mice were anaesthetised and killed by cervical dislocation. 2 ml of HBSS was injected i.p. and peritoneal cells aspirated and stored on ice until cells were pelleted by centrifugation. Cells were resuspended, smeared on to microscope slides, air dried and stored frozen. On thawing, slides were post fixed in 4% paraformaldehyde and treated with 0.25% acetic anhydride in 0.1 M triethanolamine before blocking of endogenous alkaline phosphatase activity by rinsing in cold 20% acetic acid followed by 5 min incubation in 2 mM levamisole. Slides were taken through alcohol to a 5 min chloroform treatment. Fluoresceinated probe was applied to dry slides at 50 ng/ml in 1:1 formamide:hybridisation buffer (Amersham) under coverslips, heated to 90°C for 3 min and incubated for 16–24 h at 37°C. Post-hybridisation washes were of 2 × SSC (1 × SSC is 0.15 M NaCl, 0.015 M Na citrate) followed by 1 × SSC at 45°C and slides were further treated with 0.5% blocking agent (Amersham) in Tris buffered saline (TBS) for 30 min. Alkaline phosphatase conjugated anti-fluorescein antibody in 0.5% bovine serum albumin in TBS was applied for 45 min and the substrate of nitroblue tetrazolium/5-bromo-chloro-indolyl phosphate in 100 mM Tris, 100 mM NaCl, 50 mM Mg2Cl pH 9.5 (Amersham) applied overnight at RT. Slides were mounted in 75% glycerol and examined and photographed under × 400 magnification.

In some experiments smears of peritoneal cells were additionally stained for the surface marker CD11b. After post-fixation but before in situ hybridisation slides were treated with anti-CD11b (clone M1/70, Pharmingen) or control rat IgG2b antibody. After washing and blocking of endogenous peroxidase with 1% hydrogen peroxide in methanol, horse radish peroxidase conjugated anti-rat IgG was applied in 20% normal mouse serum in PBS followed by diaminobenzidine solution (Sigma D4168; used according to manufacturer's instructions). In situ hybridisation was then performed on the same slides. Slides were mounted in 70% glycerol and photographed under oil immersion.

Induction and assessment of arthritis

Bovine type II collagen (CII) was prepared as described.65 Male DBA/1 mice of 8–10 weeks were immunised subcutaneously at the base of the tail with 100 μg of CII in Freund's complete adjuvant followed 3 weeks later by a second injection of 200 μg in Freund's incomplete adjuvant. Animals were treated with liposome–plasmid preparations 2–4 days after the onset of arthritis. Disease activity was monitored by both paw swelling measured with calipers and grading of disease in each limb (a score of 1 = erythaema or slight swelling; 2 = obvious swelling; and 3 = ankylosis). Mice were assigned at random to the different treatment groups and the degree of swelling and grade of arthritis at day 0 (the day of treatment) for the groups are standardised to 100% to allow comparisons between groups. One month after the onset of arthritis mice were killed and paws that had shown evidence of arthritis were removed, formalin fixed and decalcified before sectioning and staining with haematoxylin and eosin. Sagittal sections of the proximal interphalangeal joint were examined blind for inflammatory infiltrates and erosion of the bone and cartilage. Severity of arthritis was classified as: slight, minimal cellular infiltration with no erosions; mild, minimal synovitis, cartilage loss and bone erosions; moderate, obvious synovitis and erosions but joint intact; severe, extensive cellular infitration and erosions and joint architecture disrupted.

Statistical analysis

The Mann–Whitney rank sum test with Yate's correction was used to assess the effects of treatment on the course of CIA.

References

  1. 1

    Staines NA, Wooley PH . Collagen arthritis – what can it teach us? Br J Rheumatol 1994 33: 798–807

    CAS  PubMed  Article  Google Scholar 

  2. 2

    Maini RN et al (eds). Oxford Textbook of Rheumatology: Immunopathogenesis of Rheumatoid Arthritis Oxford University Press: Oxford 1993

    Google Scholar 

  3. 3

    Kinne RW et al. Long-term amelioration of rat adjuvant arthritis following systemic elimination of macrophages by clodronate-containing liposomes Arthr Rheum 1995 38: 1777–1790

    CAS  Article  Google Scholar 

  4. 4

    van Lent PL et al. In vivo role of phagocytic synovial lining cells in onset of experimental arthritis Am J Pathol 1993 143: 1226–1237

    CAS  PubMed  PubMed Central  Google Scholar 

  5. 5

    Di Giovine FS, Nuki G, Duff GW . Tumour necrosis factor in synovial exudates Ann Rheum Dis 1988 47: 768–772

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  6. 6

    Miyasaka N et al. Augmented interleukin-1 production and HLA-DR expression in the synovium of rheumatoid arthritis patients. Possible involvement in joint destruction Arthr Rheum 1988 31: 480–486

    CAS  Article  Google Scholar 

  7. 7

    Hirano T et al. Excessive production of interleukin 6/B cell stimulatory factor-2 in rheumatoid arthritis Eur J Immunol 1988 18: 1797–1801

    CAS  PubMed  Article  Google Scholar 

  8. 8

    Mauri C, Williams RO, Walmsley M, Feldmann M . Relationship between Th1/Th2 cytokine patterns and the arthritogenic response in collagen-induced arthritis Eur J Immunol 1996 26: 1511–1518

    CAS  Article  Google Scholar 

  9. 9

    Takai Y et al. Enhanced production of interleukin-6 in mice with type II collagen-induced arthritis Arthr Rheum 1989 32: 594–600

    CAS  Article  Google Scholar 

  10. 10

    Katsikis PD et al. Immunoregulatory role of interleukin 10 in rheumatoid arthritis J Exp Med 1994 179: 1517–1527

    CAS  PubMed  Article  Google Scholar 

  11. 11

    Brennan FM et al. Detection of transforming growth factor-beta in rheumatoid arthritis synovial tissue: lack of effect on spontaneous cytokine production in joint cell cultures Clin Exp Immunol 1990 81: 278–285

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  12. 12

    Deleuran BW et al. Localization of interleukin-1 alpha, type 1 interleukin-1 receptor and interleukin-1 receptor antagonist in the synovial membrane and cartilage/pannus junction in rheumatoid arthritis Br J Rheumatol 1992 31: 801–809

    CAS  PubMed  Article  Google Scholar 

  13. 13

    Firestein GS et al. IL-1 receptor antagonist protein production and gene expression in rheumatoid arthritis and osteoarthritis synovium J Immunol 1992 149: 1054–1062

    CAS  PubMed  Google Scholar 

  14. 14

    Joosten LA, Helsen MM, van de Loo FA, van den Berg WB . Anticytokine treatment of established type II collagen-induced arthritis in DBA/1 mice. A comparative study using anti-TNF alpha, anti-IL-1 alpha/beta, and IL-1Ra Arthr Rheum 1996 39: 797–809

    CAS  Article  Google Scholar 

  15. 15

    Williams RO, Feldmann M, Maini RN . Anti-tumor necrosis factor ameliorates joint disease in murine collagen-induced arthritis Proc Natl Acad Sci USA 1992 89: 9784–9788

    CAS  Article  Google Scholar 

  16. 16

    Elliott MJ et al. Treatment of rheumatoid arthritis with chimeric monoclonal antibodies to tumor necrosis factor alpha Arthr Rheum 1993 36: 1681–1690

    CAS  Article  Google Scholar 

  17. 17

    Elliott MJ et al. Randomised double-blind comparison of chimeric monoclonal antibody to tumour necrosis factor alpha (cA2) versus placebo in rheumatoid arthritis Lancet 1994 344: 1105–1110

    CAS  Article  Google Scholar 

  18. 18

    Persson S et al. Interleukin-10 suppresses the development of collagen type II-induced arthritis and ameliorates sustained arthritis in rats Scand J Immunol 1996 44: 607–614

    CAS  PubMed  Article  Google Scholar 

  19. 19

    Walmsley M et al. Interleukin-10 inhibition of the progression of established collagen-induced arthritis Arthr Rheum 1996 39: 495–503

    CAS  Article  Google Scholar 

  20. 20

    Tanaka Y et al. Effect of IL-10 on collagen-induced arthritis in mice Inflamm Res 1996 45: 283–288

    CAS  PubMed  Article  Google Scholar 

  21. 21

    Chernajovsky Y, Feldmann M, Maini RN . Gene therapy of rheumatoid arthritis via cytokine regulation: future perspectives Br Med Bull 1995 51: 503–516

    CAS  PubMed  Article  Google Scholar 

  22. 22

    Muller Ladner U et al. Human IL-1Ra gene transfer into human synovial fibroblasts is chondroprotective J Immunol 1997 158: 3492–3498

    CAS  PubMed  Google Scholar 

  23. 23

    Otani K et al. Suppression of antigen-induced arthritis in rabbits by ex vivo gene therapy J Immunol 1996 156: 3558–3562

    CAS  Google Scholar 

  24. 24

    Hung GL et al. Suppression of intra-articular responses to interleukin-1 by transfer of the interleukin-1 receptor antagonist gene to synovium Gene Therapy 1994 1: 64–69

    CAS  Google Scholar 

  25. 25

    Evans CH et al. Clinical trial to assess the safety, feasibility, and efficacy of transferring a potentially anti-arthritic cytokine gene to human joints with rheumatoid arthritis Hum Gene Ther 1996 7: 1261–1280

    CAS  Article  Google Scholar 

  26. 26

    Kirsh R, Poste G . Liposome targeting to macrophages: opportunities for treatment of infectious diseases Adv Exp Med Biol 1986 202: 171–184

    CAS  PubMed  Article  Google Scholar 

  27. 27

    Oyen WJ et al. Detecting infection and inflammation with technetium-99m-labeled Stealth liposomes J Nucl Med 1996 37: 1392–1397

    CAS  PubMed  Google Scholar 

  28. 28

    Williams AS, Camilleri JP, Williams BD . Suppression of adjuvant-induced arthritis by liposomally conjugated methotrexate in the rat Br J Rheumatol 1994 33: 530–533

    CAS  PubMed  Article  Google Scholar 

  29. 29

    Cooper RG et al. Polyamine analogues of 3-[N-(N′,N′-dimethylaminoethane)carbamoyl]-cholesterol (DC-Chol) as agents for gene delivery Chem Eur J 1998 4: 137–151

    Article  Google Scholar 

  30. 30

    Springer T, Galfre G, Secher DS, Milstein C . Mac-1: a macrophage differentiation antigen identified by monoclonal antibody Eur J Immunol 1979 9: 301–306

    CAS  Article  Google Scholar 

  31. 31

    Ross G et al. Gene therapy in the United States: a five-year status report Hum Gene Ther 1996 7: 1781–1790

    CAS  Article  Google Scholar 

  32. 32

    Robbins PD, Evans CH . Prospects for treating autoimmune and inflammatory diseases by gene therapy (editorial) Gene Therapy 1996 3: 187–189

    CAS  PubMed  Google Scholar 

  33. 33

    Mackensen A, Lindemann A, Mertelsmann R . Immunostimulatory cytokines in somatic cells and gene therapy of cancer Cytok Growth Factor Rev 1997 8: 119–128

    CAS  Article  Google Scholar 

  34. 34

    Bessis N et al. Attenuation of collagen-induced arthritis in mice by treatment with vector cells engineered to secrete interleukin-13 Eur J Immunol 1996 26: 2399–2403

    CAS  Article  Google Scholar 

  35. 35

    Apparailly F et al. Adenovirus-mediated transfer of viral IL-10 gene inhibits murine collagen-induced arthritis J Immunol 1998 160: 5213–5220

    CAS  Google Scholar 

  36. 36

    Ma Y et al. Inhibition of collagen-induced arthritis in mice by viral IL-10 gene transfer J Immunol 1998 161: 1516–1524

    CAS  Google Scholar 

  37. 37

    Whalen JD et al. Adenoviral transfer of the viral IL-10 gene peri-articularly to mouse paws suppresses development of collagen-induced arthritis in both injected and uninjected paws J Immunol 1999 162: 3625–3632

    CAS  PubMed  PubMed Central  Google Scholar 

  38. 38

    Yang Y et al. Cellular immunity to viral antigens limits E1 deleted adenoviruses for gene therapy Proc Natl Acad Sci USA 1994 91: 4407–4411

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  39. 39

    Le CH, Nicolson AG, Morales A, Sewell KL . Suppression of collagen-induced arthritis through adenovirus-mediated transfer of a modified tumor necrosis factor alpha receptor gene Arthr Rheum 1997 40: 1662–1669

    CAS  Article  Google Scholar 

  40. 40

    Chun S, Daheshia M, Lee S, Rouse BT . Immune modulation by IL-10 gene transfer via viral vector and plasmid DNA: impliccation for gene therapy Cell Immunol 1999 194: 194–204

    CAS  PubMed  Article  Google Scholar 

  41. 41

    Song XY et al. Plasmid DNA encoding transforming growth factor-beta1 suppresses chronic disease in streptococcal cell wall-induced arthritis model J Clin Invest 1998 101: 2615–2621

    CAS  PubMed  PubMed Central  Google Scholar 

  42. 42

    Miossec P . Pro- and anti-inflammatory cytokine balance in rheumatoid arthritis Clin Exp Rheumatol 1995 13 (Suppl 12): S13–S16

    PubMed  Google Scholar 

  43. 43

    van Rooijen N, Sanders A . Liposome mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications J Immunol Meth 1994 174: 83–93

    CAS  Article  Google Scholar 

  44. 44

    Muller CD, Schuber F . Neo-mannosylated liposomes: synthesis and interaction with mouse Kupffer cells and resident peritoneal macrophages Biochim Biophys Acta 1989 986: 97–105

    CAS  PubMed  Article  Google Scholar 

  45. 45

    Barratt G, Tenu JP, Yapo A, Petit JF . Preparation and characterisation of liposomes containing mannosylated phospholipids capable of targetting drugs to macrophages Biochim Biophys Acta 1986 862: 153–164

    CAS  PubMed  Article  Google Scholar 

  46. 46

    Love WG, Amos N, Kellaway IW, Williams BD . Specific accumulation of cholesterol-rich liposomes in the inflammatory tissue of rats with adjuvant arthritis Ann Rheum Dis 1990 49: 611–614

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  47. 47

    Caplen NJ et al. Liposome-mediated CFTR gene transfer to the nasal epithelium of patients with cystic fibrosis (see comments) (published erratum appears in Nat Med 1995; 1: 272) Nat Med 1995 1: 39–46

    CAS  Article  Google Scholar 

  48. 48

    Rogy MA et al. Human tumor necrosis factor receptor (p55) and interleukin 10 gene transfer in the mouse reduces mortality to lethal endotoxemia and also attenuates local inflammatory responses J Exp Med 1995 181: 2289–2293

    CAS  Article  Google Scholar 

  49. 49

    Stewart MJ et al. Gene transfer in vivo with DNA–liposome complexes: safety and acute toxicity in mice Hum Gene Ther 1992 3: 267–275

    CAS  Article  Google Scholar 

  50. 50

    Yokoyama M, Zhang J, Whitton JL . DNA immunization: effects of vehicle and route of administration on the induction of protective antiviral immunity FEMS Immunol Med Microbiol 1996 14: 221–230

    CAS  PubMed  Article  Google Scholar 

  51. 51

    Nita I et al. Direct gene delivery to synovium. An evaluation of potential vectors in vitro and in vivo Arthr Rheum 1996 39: 820–828

    CAS  Article  Google Scholar 

  52. 52

    Fife K et al. Endothelial cell transfection with cationic liposomes and herpes simplex-thymidine kinase mediated killing Gene Therapy 1998 5: 614–620

    CAS  Article  Google Scholar 

  53. 53

    Philip R et al. In vivo gene delivery. Efficient transfection of T lymphocytes in adult mice J Biol Chem 1993 268: 16087–16090

    CAS  Google Scholar 

  54. 54

    Liu Y et al. Cationic liposome-mediated intravenous gene delivery J Biol Chem 1995 270: 24864–24870

    CAS  Article  Google Scholar 

  55. 55

    Allen TM, Hansen CB, Guo LS . Subcutaneous administration of liposomes: a comparison with the intravenous and intraperitoneal routes of injection Biochim Biophys Acta 1993 1150: 9–16

    CAS  PubMed  Article  Google Scholar 

  56. 56

    de Waal Malefyt R et al. Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes J Exp Med 1991 174: 1209–1220

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  57. 57

    Ferguson TA, Dube P, Griffith TS . Regulation of contact hypersensitivity by interleukin 10 J Exp Med 1994 179: 1597–1604

    CAS  PubMed  Article  Google Scholar 

  58. 58

    Berg DJ et al. Interleukin 10 but not interleukin 4 is a natural suppressant of cutaneous inflammatory responses J Exp Med 1995 182: 99–108

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  59. 59

    Filion MC, Phillips NC . Anti-inflammatory activity of cationic lipids Br J Pharmacol 1997 122: 551–557

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  60. 60

    Denham W et al. Transient human gene therapy: a novel cytokine regulatory strategy for experimental pancreatitis Ann Surg 1998 227: 812–820

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  61. 61

    Chu CQ, Londei M . Induction of Th2 cytokines and control of collagen-induced arthritis by nondepleting anti-CD4 Abs J Immunol 1996 157: 2685–2689

    CAS  PubMed  Google Scholar 

  62. 62

    Stasiuk LM, Abehsira Amar O, Fournier C . Collagen-induced arthritis in DBA/1 mice: cytokine gene activation following immunization with type II collagen Cell Immunol 1996 173: 269–275

    CAS  PubMed  Article  Google Scholar 

  63. 63

    Wicks IP et al. Bacterial lipopolysaccharide copurifies with plasmid DNA: implications for animal models and human gene therapy Hum Gene Ther 1995 6: 317–323

    CAS  Article  Google Scholar 

  64. 64

    Alton EW et al. Non-invasive liposome-mediated gene delivery can correct the ion transport defect in cystic fibrosis mutant mice (published erratum appears in Nat Genet 1993 5: 312: Nat Genet 1993 5: 135–142

    Article  Google Scholar 

  65. 65

    Miller EJ . Structural studies on cartilage collagen employing limited cleavage and solubilization with pepsin Biochemistry 1972 11: 4903–4909

    CAS  Article  Google Scholar 

Download references

Acknowledgements

This work was supported by the Medical Research Council.

Author information

Affiliations

Authors

Corresponding author

Correspondence to R Fellowes.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Fellowes, R., Etheridge, C., Coade, S. et al. Amelioration of established collagen induced arthritis by systemic IL-10 gene delivery. Gene Ther 7, 967–977 (2000). https://doi.org/10.1038/sj.gt.3301165

Download citation

Keywords

  • cationic liposome
  • IL-10
  • macrophage
  • collagen induced arthritis

Further reading

Search

Quick links