Short Report

Oncogene (2003) 22, 6455–6457. doi:10.1038/sj.onc.1206739

BRAF mutations in papillary carcinomas of the thyroid

Toshihiko Fukushima1, Shinichi Suzuki1, Miyuki Mashiko1, Tohru Ohtake1, Yoshiyuki Endo1, Yuji Takebayashi1, Koji Sekikawa1, Koichi Hagiwara2 and Seiichi Takenoshita1

  1. 1Department of Surgery, Fukushima Medical University, 1-Hikarigaoka, Fukushima 960-1295, Japan
  2. 2Department of Respiratory Medicine, Saitama Medical School, 38 Morohongo, Moroyama-machi, Iruma-gun, Saitama 350-0495, Japan

Correspondence: T Fukushima, E-mail: fuku@fmu.ac.jp

Received 19 March 2003; Revised 15 April 2003; Accepted 23 April 2003.

Top

Abstract

BRAF is a serine/threonine kinase that receives a mitogenic signal from RAS and transmits it to the MAP kinase pathway. Recent studies have reported that mutations of the BRAF gene were detected with varying frequencies in several cancers, notably more than 60% in melanoma. We analysed mutations of BRAF and RAS genes in 100 cases of thyroid carcinoma to investigate genetic aberrations in the RAS/RAF/MEK/MAP kinase pathway. BRAF mutations were detected exclusively in papillary carcinomas (40 in 76 cases: 53%), and were exclusively V599E, a mutation frequently observed in other carcinomas. NRAS mutation was observed in six cases (6%), all in histological types other than papillary carcinoma, and was exclusively Q61R. No mutations were found in KRAS or HRAS. Our results suggest that BRAF mutations may play a critical role in the carcinogenesis of papillary carcinoma of the thyroid.

Keywords:

BRAF, RAS, papillary carcinoma of the thyroid, follicular carcinoma of the thyroid, MAP kinase pathway

Abbreviations:

BRAF, v-raf murine sarcoma viral oncogene homologe B1; MAP kinase, mitogen-activated protein kinase; MEK kinase, mitogen-activated protein kinase kinase

Papillary carcinoma and follicular carcinoma are types of differentiated thyroid carcinomas that are thought to arise from thyroid follicular epithelial cells. Although several studies have demonstrated differences in the biological characteristics of these carcinomas (Pierotti et al., 1996), little is known about the genetic backgrounds that underlie these differences.

Aberrant activation of the RAS-RAF-MEK-MAP kinase-signaling pathway is frequently found in human carcinomas, particularly in adenocarcinomas. The pathway transmits a mitogenic signal to the nucleus, and constitutive activation of the pathway is thought to promote uncontrolled cell division. There are three human RAS genes: NRAS, HRAS, and KRAS. The RAS mutations found in tumors produce constitutively active RAS proteins. Papillary carcinoma and follicular carcinoma of the thyroid, both of which are adenocarcinomas, exhibit RAS mutations 0–10% in papillary carcinoma and 30–50% in follicular carcinoma (Manenti et al., 1994; Lazzereschi et al., 1997; Sugg et al., 1999; Learoyd et al., 2000). RAF proteins are serine/threonine kinases that are located downstream of RAS in the signaling pathway. Humans have three RAF genes: ARAF, CRAF-1, and BRAF. Recently, point mutations of the BRAF gene were reported in more than 60% of melanomas and at lower rates in lung, colon, and ovarian carcinomas (Davies et al., 2002; Naoki et al., 2002; Yuen et al., 2002). There are two mutation hot spots in the BRAF gene. A total of 89% of mutations are located in the activation segment of kinase domain. A total of 11% of mutations are within the glycine-rich loop in the kinase domain. It has been shown that mutant BRAF proteins have elevated kinase activity and can transform NIH3T3 cells (Davies et al., 2002).

In this study, we evaluate the frequency and spectrum of BRAF mutations in thyroid carcinoma and their relation to RAS mutations.

The results of the mutation analyses are summarized in Table 1. Representative results of sequencing the BRAF gene are shown in Figure 1a and b. Of 76 cases of papillary carcinoma, 40 (53%) have heterozygous mutations in the BRAF gene at codon 599 (V599E) that result from a T to A change at nucleotide 1796 (T1796A). BRAF mutations were not observed in other types of thyroid carcinoma. On the other hand, no RAS mutations were observed in papillary carcinoma, while Q61R NRAS mutations were found in follicular and anaplastic carcinomas. No samples exhibited both BRAF and RAS mutations (Table 1).

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Mutation analysis of the BRAF gene. (a) A heterozygous missense mutation (T1796A/V599E) was identified in exon 15 in a papillary carcinoma sample, PTC20 T. (b) Nucleotide sequence in the corresponding normal tissue, PTC20N. In all, 100 thyroid tumors and corresponding normal tissue samples were obtained from surgical specimens resected at Fukushima Medical University Hospital. Of these carcinomas of the thyroid, 76 were papillary, eight were follicular, nine were medullary, and seven were anaplastic. All patients gave informed consent. High-molecular-weight DNA was extracted from tumor tissue and corresponding normal tissue separately by treatment with SDS–Proteinase K and phenol–chloroform. DNA from each tumor-normal sample pair was examined by direct sequencing for mutations in hot spots of the BRAF genes (exons 11 and 15), and the NRAS, HRAS, and KRAS genes (exons 1 and 2). The reactions were performed as follows. The 50 mul PCR mixture contained 50 pmol of each primer, 2.5 mum of each dNTP, 500 ng of genomic DNA, and 0.1 U of DNA polymerase (Sigma Co., Ltd.) in 1 times reaction buffer supplied by the manufacturer. DNA was amplified by 30 cycles of 30 s at 94°C, 30 s at 58°C, and 30 s at 72°C. The following PCR primers were used to amplify exons 11 and 15 of the BRAF gene, and exons 1 and 2 of the KRAS, NRAS, or HRAS genes: KRAS exon 1: F-ATAAGGCCTGCTGAAAATGACTGA, exon 2: R-GAATGGTCCTGCACCAGTAATATGC, exon 2: F- CCAGACTGTGTTTCTCCCTTC, exon 2: R-CAGTCCTCATGTACTGGTC, HRAS exon1: F-CAGGAGACCCTGTAGGAGGAC, exon1: R-CTCTATAGTGGGGTCGTATTC, exon 2: F-GATTCCTACCGGAAGCAGGTG, exon 2: R-CTGTACTGGTGGATGTCCTC, NRAS exon 1: F-CTGGTTTCCAACAGGTTCTTG, exon 1:R-GATTAGCTGGATTGTCAGTGC, exon 2: F-GTGGTTATAGATGGTGAAACCTG, exon 2:R-CAAATACACAGAGGAAGCCTTC, BRAF exon 11: F-TCTGTTGGCTTGACTTGACT, exon 11: R-GACTTGTCACAATGTCACCAC, exon 15: F-GCTTGCTCTGATAGGAAAATGAG, exon15: R-GTAACTCAGCAGCATCTCAGG. PCR products were purified using a QIAGEN PCR purification spin kit (Qiagen). Purified fragments were sequenced using the BigDye Terminator Cycle sequencing FS Ready Reaction Kit (Applied Biosystems) with the ABI PRISM 310 Genetic Analyzer (Applied Biosystems). Sequencing results from tumor samples and corresponding normal samples were compared to identify tumor-specific mutations

Full figure and legend (302K)


The valine at codon 599 (V599) of the BRAF gene is located in the evolutionarily conserved activation segment of the kinase domain. An amino-acid change from valine to glutamic acid (V599E) has been reported to result in a protein with elevated kinase activity that can transform NIH3T3 cells. V599E is the most prevalent BRAF mutation. For example, 90% of BRAF mutations found in melanoma are of this type (Davies et al., 2002).

Thyroid-stimulating hormone (TSH) stimulates the proliferation of thyroid follicular epithelial cells and differentiated thyroid carcinoma cells (Pierotti et al., 1996). TSH receptors are G-protein-coupled receptors, and binding of TSH to the receptors elevates intracellular cAMP levels to promote proliferation (Ledent et al., 1991). This cAMP-dependent mitogenic pathway is known to activate BRAF (Busca et al., 2000). The same scheme applies to melanocyte-stimulating hormone and the melanocortin receptor (Halaban, 2000), where binding increases the intracellular cAMP level and activates BRAF. In both melanoma and papillary carcinoma of the thyroid, increased BRAF activity due to the V599E mutation may simulate the mitogenic signal transmitted from the receptors, and thus may explain why BRAF mutations occur at higher rates in these carcinomas than in other carcinomas (Davies et al., 2002; Naoki et al., 2002; Yuen et al., 2002).

It has been suggested that BRAF mutations and RAS mutations are mutually exclusive (Davies et al., 2002) and our results are consistent with this report. A recent study has shown that microinjection of a RAS-neutralizing antibody did not inhibit the proliferation of cells with the V599E BRAF mutation, suggesting that RAS mutation does not have an additive effect on the proliferation of such cells (Davies et al., 2002). This result suggests that BRAF mutation is sufficient to activate the RAS-mediated mitogenic signaling, and thus RAS mutation is not observed in papillary carcinoma with BRAF mutations. Studies with larger numbers of samples are necessary to clearly define the relation between mutations in BRAF and RAS.

In this study, the BRAF gene was mutated in 53% of papillary carcinomas of the thyroid. This suggests that BRAF mutations provide a genetic marker that can differentiate papillary carcinomas from other types of thyroid carcinomas, and suggests that BRAF mutations play a significant role in the carcinogenesis of papillary carcinoma. These findings also suggest that an RAF inhibitor that has recently been described (Sebolt-Leopold, 2000) may be worth exploring as a molecular-targeting reagent to treat thyroid carcinoma.

Top

References

  1. Busca R, Abbe P, Mantoux F, Aberdam E, Peyssonnaux C, Eychene A, Ortonne JP and Ballotti R. (2000). EMBO J., 19, 2900–2910. | Article | PubMed | ISI | ChemPort |
  2. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W, Davis N, Dicks E, Ewing R, Floyd Y, Gray K, Hall S, Hawes R, Hughes J, Kosmidou V, Menzies A, Mould C, Parker A, Stevens C, Watt S, Hooper S, Wilson R, Jayatilake H, Gusterson BA, Cooper C, Shipley J, Hargrave D, Pritchard-Jones K, Maitland N, Chenevix-Trench G, Riggins GJ, Bigner DD, Palmieri G, Cossu A, Flanagan A, Nicholson A, Ho JW, Leung SY, Yuen ST, Weber BL, Seigler HF, Darrow TL, Paterson H, Marais R, Marshall CJ, Wooster R, Stratton MR and Futreal PA. (2002). Nature, 417, 949–954. | Article | PubMed | ISI | ChemPort |
  3. Halaban R. (2000). Pigment Cell Res., 13, 4–14. | Article | PubMed | ISI | ChemPort |
  4. Lazzereschi D, Minicione G, Coppa A, Ranieri A, Turco A, Baccheschi G, Pelicano S and Colletta G.. (1997). J. Exp. Clin. Cancer Res., 16, 325–332. | PubMed |
  5. Learoyd DL, Messian M, Zedenius J and Robinson BG. (2000). World J. Surg., 24, 923–933. | PubMed |
  6. Ledent C, Parmentier M, Maenhaut C, Taton M, Pirson I, Lamy F, Roger P and Dumont JE. (1991). Thyroidology, 3, 97–101. | PubMed |
  7. Manenti G, Pilotti S, Re FC, Della Porta G and Pierotti MA. (1994). Eur. J. Cancer, 30, 987–993.
  8. Naoki K, Chen TH, Richards WG, Sugarbaker DJ and Meyerson M. (2002). Cancer Res., 62, 7001–7003. | PubMed | ISI | ChemPort |
  9. Pierotti MA, Bongarzone I, Borello MG, Greco A, Pilotti S and Sozzi G. (1996). Genes Chromosom. Cancer, 16, 1–14. | Article | PubMed | ChemPort |
  10. Sebolt-Leopold JS. (2000). Oncogene, 27, 6594–6599.
  11. Sugg SL, Ezzat S, Zheng L, Freeman JL, Rosen IB and Asa SL. (1999). Surgery, 125, 46–52. | PubMed | ISI | ChemPort |
  12. Yuen ST, Davies H, Chan TL, Ho JW, Bignell GR, Cox C, Stephens P, Edkins S, Tsui WW, Chan AS, Futreal PA, Stratton MR, Wooster R and Leung SY. (2002). Cancer Res., 62, 6451–6455. | PubMed | ISI | ChemPort |