Introduction

Deletions of chromosome 14q are rarely reported. Excluding ring chromosome 14, about 30 previous articles have dealt with distal deletion of chromosome 14q,1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 of which only 22 cases affected the 14q3 region. Three of these cases involved autosomal translocations.2, 3, 4 In six other cases, the deletion was associated with either a 20p deletion5 or a chromosome 14 rearrangement.6, 7, 8, 9, 10 In one case, the deletion appeared to be interstitial.11, 12 In one case, the deletion was associated with mosaicism (46,XX/46,XX,del(14)(q32.3)).13 Only 11 cases were considered as examples of pure, distal and homogeneous 14q arm deletions12, 14, 15, 16, 17, 18, 19, 20, 21 (Table 1).

Table 1 Published cases with 14q3 terminal deletions
Full size table

Most of the reported cases were cytogenetically visible and diagnosed by classical banding. Five cases were diagnosed only by subtelomere fluorescent in situ hybridisation (FISH).3, 20, 21 If we consider the case of Maurin et al,10 a pure distal 14q deletion since the presence of a terminal NOR region should not have any influence on the phenotype assuming the absence of position effect, a total of eight cases with pure distal deletion were confirmed by FISH12, 17, 19, 20, 21 and the break points were mapped in only four patients10, 12, 19, 20 (Table 1).

We report here the clinical findings in two patients with 14q32.2 and 14q32.32 deletions identified by subtelomere screening. Patient 1 had a pure distal 14q32.2 deletion and patient 2 had a deleted derivative 14 chromosome from a paternal cryptic translocation t(14;17)(q32.32;qter). We analysed by FISH the length of the corresponding size of the deletions to contribute to the del(14q) genotype–phenotype correlation. The parental origin of the deletion in patient 1 was established by genotyping of sequence tagged sites (STS) microsatellites. This study has been initiated on behalf of the ACLF (‘Association des Cytogeneticiens de langue Française’).

Subjects and methods

Patients

Patient 1

This patient was the first child of non-consanguineous Caucasian parents. His father and mother were aged 32 and 28 years, respectively, at the time of his birth. Prenatal ultrasound scans disclosed a thick nuchal skinfold at 11 WG, which prompted chorionic villi sampling (the result showed normal karyotype). Ultrasonography scans during second and third trimesters showed a short corpus callosum, and generalised oedema of the skin. A control karyotype on amniotic fluid cells was considered normal. The child was born at 40 weeks of gestation with a birth weight of 3450 g (50th centile), a length of 49.5 cm (−1 SD), and OFC of 35 cm (M). Brief resuscitation was necessary because of primary apnoea. In the neonatal period, difficulty in swallowing necessitated transient G-tube feeding. At first evaluation at the genetic clinics at age 2 months, the following dysmorphic features were recorded: narrow face, bulging forehead, narrow and upslanted palpebral fissures, marked epicanthal folds, bushy eyebrows, cylindrical nose with wide, upturned tip and shallow root, long philtrum, narrow mouth, normal palate, microretrognathia, prominent, thick earlobes, short neck (Figure 1a and b). The fontanels were widely opened. Genitalia were hypoplastic. The patient had gross hypotonia and poor mimics. Heart and kidney ultrasonography scans were normal and brain MRI confirmed the hypoplasia of the corpus callosum. Inguinal hernias were surgically corrected at age 3 months. Recurrent obstructive apnoea associated with gastro-oesophageal reflux required multiple hospital admissions. Psychomotor development was severely impaired: he sat with support at 10 months of age and without support at 2 years of age. The first spoken words were observed at 3 years of age but non-verbal skills were less affected (non-verbal communication, imitative plays). There was no hearing loss.

Figure 1
figure 1

Pictures of patients 1 and 2 showing the dymorphic facial features. Patient 1 at 6 months of age: narrow face, bulging forehead, narrow, upslanted palpebral fissures, marked epicanthal folds, cylindrical nose with wide, upturned tip and shallow root, long philtrum, small mouth, microretrognathia (a) and prominent, thick earlobes (b). Patient 2 at 1 year (c) and 3 years (d) of age with hypertelorism, epicanthal folds, long philtrum, tented upper lip, long palpebral fissures, bilateral ptosis and forehead hirsutism (c and d).

Full size image

At the last examination, at 4 years of age, he was 100 cm tall (M), weighed 18.4 kg (+2 SD) and had an OFC of 50 cm (−0.5 SD). The facial dysmorphism was quite the same as that recorded at the first examination but the forehead was more prominent and bulging, microretrognathia with overbite was more severe and the face was still hypomimic although no facial palsy was present. He was unable to walk. Neurological examination was otherwise unremarkable. His speech was limited to single, poorly understandable words.

Metabolic screening, creatine kinase and Steinert gene screening were normal. Systematic screening of subtelomeric regions disclosed a 14q deletion. No chromosomal rearrangement was found by FISH in the parents.

Patient 2

This boy was the first child of young healthy parents. Single thickening of nuchal skinfolds with increased translucency was found on ultrasonography at 12 weeks gestation. A karyotype, performed on amniotic fluid cells at 16 weeks of gestation, was considered normal (46,XY). The boy was delivered at 40 weeks gestation. Birth weight, length and OFC were 3.170 kg (10th centile), 50 cm (−1 SD) and 33.5 cm (−2 SD), respectively. Apgar score was normal. During the neonatal period, the boy was hypotonic and had coronal hypospadias, bilateral blepharophimosis and ptosis (surgically corrected at 10 months of age) and auricular septal defect, ostium secundum type. At age 6 months, he developed infantile spasms. Cortical atrophy and hypoplasia of the corpus callosum were evidenced on brain MRI. Blood karyotype and FISH for the Prader-Willi/Angelman region were normal. The boy was clinically re-evaluated at the age of 3 years. OFC and weight decreased by −2 and −1.5 SD, respectively, whereas height remained normal. Motor and mental developments were severely delayed. Facial dysmorphic features included hypertelorism, epicanthal folds, long palpebral fissures, bilateral ptosis, bushy eyebrows, long philtrum, tented upper lip, short neck and forehead hirsutism (Figure 1c and d). A multi-FISH analysis using a panel of subtelomeric probes was performed and led to the diagnosis of a cryptic terminal 14q deletion derived from a paternal cryptic t(14;17)(qter;qter)pat translocation (data not shown).

Methods

Molecular cytogenetics

Chromosome analysis was performed on peripheral blood lymphocytes by G- and R-banding using standard and 550-band resolution technique. FISH was performed on metaphase spreads obtained using previously described cytogenetic techniques.22 The terminal 14q deletion was diagnosed by subtelomeric FISH screening for both patients. The two deletions were further mapped by FISH with BAC and PAC probes chosen along the 14q arm from 97 Mb to the telomere (end: 106 368 585 bp). The relative order of those probes was obtained by the NCBI and Ensembl databases (http://www.ncbi.nlm.nih.gov/mapview/, http://ensembl.org/Homo_sapiens/cytoview).

The following BAC clone probes provided by M Rocchi (Uniba-Bari) were used: RP11-300N18, RP11-483K13, RP11-68I8, RP11-431B1, RP11-168L7, RP11-796G6, RP11-1017G21, RP11-356L8, RP11-456M14, RP11-454M12 and RP11-435F10 from centromere to telomere, respectively. The most distal PAC clone GS-820M16 was provided by Knight23 (Table 2). DNA from BAC and PAC colonies was extracted using the Macherey-Nagel kit (Nucleobond, 74579, Hoerdt, France) and labelled with Cy3-dUTP (Amersham Bioscience, PA53022, Gehealthcare, Europe Gmbh, Munich, Germany) by nick translation (Nick Translation System, 18160-010, Invitrogen, San Diego, CA, USA). The Cy3-labelled DNA probe was precipitated and hybridised using standard procedures. Twenty metaphases were analysed under a fluorescence DMRB microscope (Leica) equipped with Metasystem Isis software (Altlussheim, Germany).

Table 2 FISH results with BAC and PAC probes
Full size table

Genotyping

The DNA was extracted from peripheral blood lymphocytes using standard techniques for patient 1 and his parents. Genotyping of the DNA of the proband and his parents was performed by PCR amplification using STS microsatellite primers for STSs D14S306 (14q21.1), D14S77 (14q24.2), D14S308 (14q32.33) and D14S1420 (14q32.33). Two sequences (1 and 2) were tested for D14S1420 (Table 3). DNA was not available for patient 2 and his parents.

Table 3 Genotyping results with STS markers
Full size table

Results

Molecular cytogenetics

Patient 1

The deletion extended from a break point located between the undeleted clone RP11-431B1 and the deleted clone RP11-168L7 to the end of the chromosome 14q arm tagged by the most distal subtelomeric probe GS-820M16 (300 kb from the end of 14qter) (Table 2 and Figure 2a and b). The deleted segment was shown to be 6.55±1.05 Mb long (Ensembl cytoview database).

Figure 2
figure 2

FISH using 14q32.3 BAC and PAC probes showed two red signals on chromosomes 14 when not deleted (probes RP11-483K13 (patient 1: a) and RP11-1017G21 (patient 2: d)) and a single red signal on its normal homologue when deleted for probes GS-820M16 (patient 1: b), RP11-454M12 (patient 2: c) and RP11-356L8 (patient 2: e). FISH using chromosome 17q subtelomeric probe GS-362K4 (patient 2: f) showed three signals on both normal 17 chromosomes and one on the der(14)t(14;17)(qter;qter).

Full size image

FISH results’ designation: .ish del(14)(q32.2 → qter)(RP11-300N18+,RP11-483K13+,RP11-68I8+,RP11-431B1+,RP11-168L7-,RP11-796G6-,RP11-435F10-,GS-820M16-).

Patient 2

The deleted chromosome 14 was derived from a paternal cryptic translocation t(14;17)(q32.32;qter)pat. The deletion extended from a break point located between the undeleted clone RP11-1017G21 and the deleted clone RP11-356L8, to the distal part of 14q arm (clone GS-820M16) (Table 2 and Figure 2c–f). Its size was shown to be 4.67±0.10 Mb long (Ensembl cytoview database).

FISH results’ designation: .ish del(14)(q32.32 → qter)(RP11-796G6+,RP11-1017G21+,RP11-356L8-,RP11-456M14-,RP11-454M12-,RP11-435F10-,GS-820M16-).

Genotyping

Patient 1

This patient had inherited a maternal and a paternal allele for STS D14S306 and D14S77, but STS D14S308 was uninformative. No paternal allele was observed for D14S1420 sequences 1 and 2 (Figure 3). This analysis showed that the deleted chromosome 14 was of paternal origin (Table 3).

Figure 3
figure 3

Migration pattern on the gels of amplified DNAs for patient no. 1 (C), his father (F) and mother (M) using microsatellite markers STS D14S77 and D14S1420 (sequence 1: left primer TGTTTGAAGAAGGGAGTCGT/right primer CCCACTCCATGTCTTCTGTT). The child inherited both paternal and maternal alleles for D14S77 and only maternal allele for D14S1420.

Full size image

Patient 2

No DNA was available for the second family but nevertheless the derivative der(14) was derived from a paternal translocation. Consequently, we assumed this deleted chromosome 14 to be of paternal origin.

Discussion

Deletions on chromosome 14q are usually associated with ring chromosome 14.1, 24 A purely distal 14q32 deletion was reported in less than 15 published cases (Table 1), and only 8 of them were analysed by molecular cytogenetics (Table 1). The deleted fragments were mapped in only four cases. Indeed Schlade-Bartusiak et al20 described two patients with a terminal 14q32.3 deletion mapped by FISH using BAC clones. The first patient HSC1658 had a 3.2-Mb-long 14q32.3 terminal deletion with a proximal break point located between CKB and KNS2 genes. The second patient HSC1363, also studied by Wintle et al,12 had a 5.3-Mb-long 14q32.3 terminal deletion with a proximal break point located proximally to the deleted gene DIO3. Maurin et al10 reported a third patient with a der(14)t(14;D/G)(q32.33;p12) resulting in a 1–1.6 Mb terminal 14q32.33 deletion with a break point located between non-deleted BAC RP11-1087P8 and deleted BAC RP11-417P24. Van Karnebeek et al19 reported a fourth patient with a del(14)(q32.31) mapped by molecular analysis using PCR-based analysis of microsatellite repeat polymorphism12, 19, 20 (Table 1). The deletion was shown to be truly telomeric and the proximal break point was located between D14S985 (not deleted) and D14S292 (deleted).

We report here two cases: patient 1 with a pure del(14)(q32.2) 6.55±1.05 Mb long, and patient 2 with a distal 14q32.32 deletion 4.67±0.10 Mb long derived from a t(14;17)(q32.32;qter)pat. Considering this last patient, we must keep in mind that the features were partially related to the cryptic 17qtel duplication. The following features associated with 17q partial distal trisomy were previously elicited: psychomotor and growth retardation, microcephaly, high forehead and temporal retraction, narrow palpebral fissures, large mouth with thin lips, cleft palate, low hairline, malformed ears, webbed short neck, abnormal skeletal features and external genitalia.25, 26, 27

Regarding the phenotype associated with terminal 14q deletions among 23 cases of deletions distal to 14q24, Van Karnebeek et al19 suggested to define the emerging phenotype by the features present in at least 50% of the cases such as neurologic deficits (mental retardation and hypotonia), a specific dysmorphic face (microcephaly, high and prominent forehead, blepharophimosis, epicanthi, broad and flat nasal bridge, short bulbous nose, broad philtrum, thin upper lip, small carpe-shaped mouth, highly arched palate, abnormal dentition, low-set ears with malformed helices and micrognathia) and a single palmar crease. Congenital malformations associated with such 14qter deletion were almost limited to congenital heart defects. Other rare anomalies were reported: haemangioma, coloboma, hypospadias, imperforate anus, fingerlike thumbs and oesophageal atresia with tracheo-oesophageal fistula, hearing loss and cat cry.19

Compared to the clinical criteria suggested by Van Karnebeek et al,19 on a cohort of deletions distal to 14q24, we found some discrepancies. Patient 1 was not microcephalic and both patients 1 and 2 had neither highly arched palate nor abnormal dentition. Prominent earlobes instead of thick helices, short neck and single palmar creases were noted in both our patients and had not been previously reported. These patients were suspected initially at prenatal ultrasound screening because of the presence of thick nuchal skinfolds. Interestingly, both had hypoplasia of the corpus callosum. Brain morphological investigations have been documented in 11 patients with pure or not 14q terminal deletion in the literature,3, 4, 7, 8, 9, 10, 12, 14, 18, 21 showing abnormalities in six patients. In one case, a subarachnoid haemorrhage over the cerebral convexity was observed at birth by CT scan, but the brain MRI was normal at 5 years of age.8 In a second case, post-mortem examination showed irregular polygyria, lack of opercularisation of the temporal lobes, and occipital periventricular neuronal heterotopia.7 In a third case, MRI showed non-specific white matter hyperdensity in the periventricular areas10 and in a fourth case lissencephaly was reported.21 An abnormal corpus callosum was disclosed only in the two following cases: (a) Mertens et al18 reported a complete agenesis of the corpus callosum observed during autopsy of a newborn child associated with pure del(14)(q32)18 and (b) Bregant et al4 described a 2-week-old boy with asymmetric cranial lateral ventricles and hypoplastic corpus callosum associated with a der(14)t(10;14)(q24;q32)4. Unfortunately, the length of the deletion in the last two patients was not mapped as we did for our two patients with corpus callosum hypoplasia.

The delineation of a del(14)(q32) emerging phenotype is complicated by the fact that this region is submitted to imprinting. At least three imprinted genes have been reported in this region: MEG3 and DLK1 expressed maternally and paternally in humans, respectively 28 and the gene DIO3 described as preferentially expressed from the paternal allele in the mouse fetus.29 The three documented 14q32 deletion data reported two maternally19, 20 and one paternally20 derived deletions. In the present observations, the loss of functionally active, paternally derived alleles, in combination with maternally imprinted genes, on 14q could be involved in the phenotype. Indeed patients 1 and 2 showed features observed in maternal uniparental disomy (UPD14) such as developmental deficiency, hypotonia, feeding problems and short stature. Patient 2 had a marked ptosis with long and narrow palbebral fissures. Interestingly, blepharophimosis was postulated to be characteristic for paternal UPD14,30 but none of the three genes MEG3, DLK1 and DIO3 were deleted in this patient. Regarding patient 1, DIO3 was deleted but it could not be assessed if MEG3 or DLK1 was deleted because these genes are located between the proximal and distal edge of the 14q32.2 break point: BACs RP11-431B1 (not deleted) and RP11-168L7 (deleted).

Conclusion

The number of reported cases with a terminal 14q32 deletion is very small. We report here two new cases with del(14)(q32.2) and del(14)(q32.32) of 6.55±1.05 and 4.67±0.10 Mb, respectively, both on the paternal chromosome 14. The patients had common postnatal features such as developmental deficiency, hypotonia, feeding problems, short stature, facial dysmorphic features and short webbed neck. We report two additional features that may help in prenatal diagnosis: thick nuchal skinfold and hypoplastic corpus callosum. Microcephaly usually reported in larger del(14q) was not present in our two patients. These findings should contribute to delineate the emerging phenotype in terminal 14q32 deletion but need further data.