Corrigendum | Open Access | Published:

Corrigendum: Characterization of a P1-like bacteriophage carrying CTX-M-27 in Salmonella spp. resistant to third generation cephalosporins isolated from pork in China

Scientific Reports volume 7, Article number: 46728 (2017) | Download Citation

This Article contains errors in the Materials and Methods section under subheading ‘Prevalence investigation of P1-like bacteriophage in Salmonella isolates’, where incorrect primers were quoted.

“The presence of the insertion sequence on the other nontypeable plasmids carrying blaCTX-M-27 gene was detected using the following primers: IS-fw (AGAATCATCGC CGAAGGGCTGTAACTGGTTTT) and IS-rev (GCGAACATCATCCGTTGCACT CTCTTTGT)”.

should read:

“The presence of the insertion sequence on the other nontypeable plasmids carrying blaCTX-M-27 gene was detected using the following primers: IR-fw-(GTTGCTGGCTGACGCCTATGAAG) and IR-rev-(ATGTTTGCCATTTCATAGGGGAG)”.

About this article

Publication history

Published

DOI

https://doi.org/10.1038/srep46728

Authors

  1. Search for Ling Yang in:

  2. Search for Wan Li in:

  3. Search for Gui-Ze Jiang in:

  4. Search for Wen-Hui Zhang in:

  5. Search for Huan-Zhong Ding in:

  6. Search for Ya-Hong Liu in:

  7. Search for Zhen-Ling Zeng in:

  8. Search for Hong-Xia Jiang in:

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Newsletter Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing