Abstract
The CRISPR-Cas9 system has been successfully applied in many organisms as a powerful genome-editing tool. Undoubtedly, it will soon be applied to human genome editing, including gene therapy. We have previously reported that unintentional DNA sequences derived from retrotransposons, genomic DNA, mRNA and vectors are captured at double-strand breaks (DSBs) sites when DSBs are introduced by the CRISPR-Cas9 system. Therefore, it is possible that unintentional insertions associated with DSB repair represent a potential risk for human genome editing gene therapies. To address this possibility, comprehensive sequencing of DSB sites was performed. Here, we report that exosome-mediated horizontal gene transfer occurs in DSB repair during genome editing. Exosomes are present in all fluids from living animals, including seawater and breathing mammals, suggesting that exosome-mediated horizontal gene transfer is the driving force behind mammalian genome evolution. The findings of this study highlight an emerging new risk for this leading-edge technology.
Similar content being viewed by others
Introduction
Since 2000, three types of genome editing technologies have been developed: zinc-finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR-Cas91. Of these, CRISPR-Cas9 features not only the easiest construct design but also high double-strand break (DSB) efficiency; however, CRISPR-Cas9 can cause DSBs at unintended sites1,2.
In mouse zygotes, most DSBs introduced by CRISPR-Cas9 are repaired by nonhomologous end joining (NHEJ) without homologous DNA oligos for homologous recombination (HR)3. NHEJ-mediated repair of DSBs is prone to error, causing small indels3. In 2015, we reported that DSBs introduced by CRISPR-Cas9 can be repaired by the capture of retrotransposon sequences, reverse-transcribed spliced mRNA sequences (RMDR: RT-product-mediated DSB repair) and CRISPR-Cas9 vector sequences (non-RMDR: non-RT-product-mediated DSB repair) in mouse zygotes4. Most captured DNA sequences are truncated at their 5′ and 3′ ends. Short microhomologies (1–4 bp) between the captured DNA sequence and the DSB-introduced site were observed in only half of the cases, suggesting that both RMDR and non-RMDR proceed via NHEJ4. RMDR and non-RMDR have also been observed in DSBs induced by CRISPR-Cas9 in NIH-3T3 cells4.
The capture of DNA sequences was also observed at the DSB site introduced by the I-SceI restriction enzyme in Saccharomyces cerevisiae, a human hepatoma cell line and human monocytic leukemia cells and at naturally occurring DSB sites in Daphnia, Drosophila, and Aspergillus5,6,7,8,9,10,11. Ty1 retrotransposon insertions into DSB sites were induced by I-SceI in HR-deficient S. cerevisiae8,9. In the case of the hepatoma cell line LMH, I-SceI induced the insertion of truncated infected hepatitis B virus into DSB sites10. Endogenous nucleotide sequence insertions were also induced by I-SceI in the human monocytic leukemia cell line U93711. In Daphnia, Drosophila, and Aspergillus, greater than half of recent naturally gained introns originated from the repair of staggered DSBs5,6,7.
These capture of unintentional DNA sequences at DSB sites might be an evolutional driving force of mammalian genomes, including horizontal gene transfer. In this report, comprehensive analyses of DSB sites introduced by CRISPR-Cas9 in vivo and in vitro were performed to identify the relationships between DSB repairs and genome evolution and verify the risk for the leading-edge technology. Our results highlight exosome-mediated horizontal gene transfer, which occurs in DSB repair, during genome editing and represents a potential new risk for genome editing.
Results
Determination of indels by deep sequencing
First, we accurately determined the lengths of the indels introduced by the CRISPR-Cas9 system in vivo and in vitro by deep sequencing of PCR products amplified with two primers across the target DSB site (Fig. 1a).
We introduced DSBs at the Peg10 gene locus by transfecting NIH-3T3 cells with a CRISPR plasmid encoding both Cas9 and gRNA targeting the Peg10 gene and a PGK-Puro plasmid4. After transient selection with puromycin, DNA was extracted from the cells, and PCRs were performed to amplify the region containing the DSB site introduced into Peg10 (Fig. 1a). Then, the PCR products were subjected to high-throughput next-generation sequencing analyses. Greater than half of the sequence reads contained ±1–2 bp indels as previously described12 (Fig. 1b, c, Table 1). These populations may have been repaired by error-prone NHEJ as previously reported1. Greater than 90% of the deletions (3–64 bp) exhibited microhomologies (1–4 bp) at the junction, suggesting that these deletions were also mediated by NHEJ13 (Fig. 1b, Supplementary Fig. 1, Table 1, Supplementary Data 1).
Long insertions (>33 bp) were observed in 4% of sequence reads from DSB-induced NIH-3T3 cells (Fig. 1b, c). Greater than half of the long insertion sequences were derived from plasmid DNA (Fig. 1c, d). In total, 16% and 2% of long insertions were identical to mouse genomic DNA and mRNAs (Fig. 1c, d, Supplementary Data 2). These results are comparable to previous results obtained by gel extraction and subcloning/Sanger sequencing4.
Capture of bovine and E. coli genomic DNA by horizontal gene transfer
One of the two novel findings of our high-throughput sequencing analyses is that 21% of the long insertions were derived from Escherichia coli genomic DNA. These sequences are identical to the E. coli K12 strain, suggesting that they are derived from contamination by the host E. coli genomic fragments used to amplify the CRISPR-Cas9 vectors (Fig. 1d). DNA sequences from E. coli with or without microhomologies were captured (Supplementary Fig. 2). Finally, 2% of the long insertions mostly (88%) consists of mouse repeats, including mouse short interspersed nuclear elements (SINEs), mouse long interspersed nuclear element-1s (L1s), mouse endogenous retroviruses, and mouse satellite repeats and simple repeats, whereas the remaining 12% of the insertions were derived from bovine genomic DNA, including bovine SINE and bovine satellite repeats (Fig. 1d–g, Table 2a, Supplementary Data 2).
Exosome-mediated horizontal gene transfer
Most of the inserted bovine DNA was derived from bovine satellite DNA sequences, such as BTSAT2, BTSAT3, and BTSAT4, and bovine SINE sequences, such as Bovc-tA214 (Table 2a). Dulbecco’s Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS) was used to culture NIH-3T3 cells. Thus, DNA or RNA from FBS in the form of cell-free DNA/RNA, including exosomal DNA/RNA might be the source of the bovine DNA sequences captured by the DSB sites in the cultured mouse cells15,16,17,18,19,20,21.
To confirm the possibility of such horizontal gene transfer from the cell culture medium, we repeated these experiments using goat serum instead of FBS (Fig. 2). As noted in the experiments with FBS, mouse genomic DNA, mRNA, or plasmid DNA and E. coli genomic DNA were detected as expected (Fig. 2a, b). As expected, goat DNA sequences were captured in the DSB sites of NIH-3T3 cells (Fig. 2c–e, Table 2b, Supplementary Data 3). These data demonstrate that horizontal gene transfer can occur from the serum used in the culture medium. To clarify the origin of the captured bovine DNA sequences, i.e., whether these sequences arose from cell-free nucleic acids or nucleic acids in exosomes, we introduced DSBs by CRISPR-Cas9 in NIH-3T3 cell lines cultured with exosome-free 10% FBS (DMEM), which contains comparable amount of cell-free nucleic acids (Fig. 3, Supplementary Fig. 3). Bovine DNA sequences originating from cell-free nucleic acids should still be introduced at the DSB sites if horizontal gene transfer was mediated by cell-free nucleic acids. In contrast, a reduction in the insertion of bovine DNA sequences in the presence of exosome-free serum would indicate that trans-species gene transfer is mediated by exosomes. The insertion rates of endogenous mouse DNA sequences, vector sequences, and E. coli sequences were comparable in cells cultured with exosome-free FBS or normal FBS; however, most of the bovine DNA insertions were abolished by culture with exosome-free 10% FBS/DMEM (Figs. 3a–c and 4, Table 2c, Supplementary Data 4). Furthermore, exosomal RNA collected from FBS by ultracentrifugation and treated with or without RNase and DNase/RNase were comprehensively sequenced. Bovine satellite sequence RNAs and bovine retrotransposon RNAs were highly expressed in FBS under all the conditions, suggesting that bovine satellite sequence RNAs and bovine retrotransposon RNAs were within the exosomes (Supplementary Fig. 4).
These data support exosome-mediated trans-species gene transfer; however, it is possible that these horizontal gene transfer events were mediated by cell-free nucleic acids. Because exosomes and cell-free nucleic acids are reportedly present in all fluids from living animals, trans-species gene transfer events may also occur in mouse embryos in which DSBs are introduced by injection of CRISPR-Cas9 mRNA into zygotes. Thus, DNA was extracted from day 10 embryos in which CRISPR-Cas9 mRNA and Peg10 sgRNA were injected at the zygote stage and analyzed by high-throughput sequencing. One of 12 embryos (#20) captured BTAUL1, a bovine SINE (Fig. 5a, b, Supplementary Fig. 5, Supplementary Data 5). The KSOM medium used to culture the mouse zygotes contains bovine serum albumin (BSA) fraction V, which may contain exosomes or cell-free nucleic acids.
Discussion
In this report, we demonstrated that horizontal gene transfer assisted by CRISPR-Cas9 occurs in NIH-3T3 cells and mouse embryos. This phenomenon might be the driving force behind mammalian genome evolution. In fact, mice with fusions between the murine Peg10 gene and a bovine SINE were obtained (Supplementary Fig. 5). A number of possible trans-species horizontal gene transfer events have been reported in mammals. Chromodomains (chromatin organization modifier), a protein structural domain, are highly conserved in chromoviruses, and SCAN domains might originate from GYPSYDR-1 retrotransposons. Sirh-family genes, which are conserved in mammals, contain a gag-like domain from the Ty3/Gypsy-type retrotransposon of fugu fish22,23,24,25,26. Recently, in silico analyses demonstrated horizontal transfer of BovB (non-LTR retrotransposon from Bos taurus) and L1 retrotransposons (B. taurus) in eukaryotes27. In this study, we revealed that BovB and L1 were abundant in exosomes and that goat BovB was horizontally transferred into mouse NIH-3T3 cells. These data support that horizontal gene transfer events are mediated by exosomes.
CRISPR-Cas9 itself exhibits some propensity for inducing off-target mutations2. The DSBs produced by CRISPR-Cas9, whether on target or off target, were repaired by the capture of unintentional DNA sequences2. Although the risk of unintentional insertions is greater than 4%, considerable efforts have focused on reducing off-target effects. The pair of CRISPR-Cas9 D10A (nickase) and a high-fidelity CRISPR-Cas9 nuclease reduce genome-wide off-target effects28,29. These efforts hold promise because DSBs at off-target sites could be neglected. However, unintentional insertions at on-target DSB site cannot be suppressed by these off-target-reducing methods. Therefore, gene therapy using these genome-editing technologies may capture unintentional insertions. DSBs are typically repaired by NHEJ or HR. NHEJ is the predominant pathway in mammals30,31 and Drosophila32,33, whereas HR is the major pathway in S. cerevisiae34. Another DSB repair mechanism, microhomology-mediated end-joining (MMEJ), repairs DSBs via the use of substantial microhomology. MMEJ uses microhomologies of 5–25 bp during the alignment of two broken ends, whereas NHEJ frequently proceeds through the annealing of short (1–4 bp) microhomologies13. Most of the insertion sequences identified in the present study displayed short microhomologies (1–4 bp) or no microhomology with the introduced DSB site, suggesting that they were captured by NHEJ rather than MMEJ.
SCR7, an inhibitor of NHEJ, improves the efficiency of HR in genome editing35,36. Increasing the efficiency of HR may be a key strategy to reduce the risk of unintended insertions.
Methods
Animals
All animal studies were conducted in accordance with the guidelines approved by the animal care committee of the National Institute of Health Sciences (No. 1004). The animal welfare committee of National Institute of Health Sciences (No. 539) approved the protocol. Animals had access to a standard chow diet and water ad libitum and were housed in a pathogen-free barrier facility with a 12L:12D cycle, as previously described4.
Plasmid preparation
The plasmids expressing both hCas9 and Peg10-ORF1-sgRNA were prepared as previously described4. Briefly, Peg10-ORF1-sgRNA (5′-TGTCTCTACTGTGGCAATGG-3′) oligo DNA was ligated into the BbsI site of pX330 (http://www.addgene.org/42230/). Plasmid preparations were performed using the QIAGEN Plasmid Maxi kit (QIAGEN, Hilden, Germany). All oligo sequences in this study are shown in Table 3.
Production of hCas9 mRNA and Peg10-ORF1-sgRNA
To produce the Cas9 mRNA, the T7 promoter was added to the Cas9 coding region of the pX330 plasmid by PCR amplification, as previously described3. Briefly, the T7-Cas9 PCR product was gel purified and used as the template for in vitro transcription (IVT) using the mMESSAGE mMACHINE T7 ULTRA kit (Thermo Fisher Scientific, Waltham, MA). The T7 promoter was added to the Peg10-ORF1-sgRNA region of the pX330 plasmid by PCR purification using the following primers as previously described: Peg10-ORF1-IVT-F (TGTAATACGACTCACTATAGGGTGTCTCTACTGTGGCAATGG) and IVT-R (AAAAGCACCGACTCGGTGCC)4.
The T7-sgRNA PCR product was gel purified and used as the template for IVT using the MEGAshortscript T7 kit (Thermo Fisher Scientific, Waltham, MA). Both the Cas9 mRNA and Peg10-ORF1-sgRNA were treated with DNase to eliminate template DNA, purified using the MEGAclear kit (Thermo Fisher Scientific, Waltham, MA), and eluted into RNase-free water as previously described4.
Cell culture
NIH-3T3 cells (RIKEN BRC-Cell Bank: RBRC-RCB2767) were cultured with 10% FBS (Invitrogen)/DMEM, 10% goat serum (Cosmo Bio, Tokyo, Japan)/DMEM or 10% exosome-free FBS (System Biosciences, Palo Alto, CA)/DMEM. pX330-Peg10-ORF1 plasmid and pGK-puro plasmid (500 ng each) were introduced into 2 × 105 NIH-3T3 cells/well in a six-well plate using Lipofectamine LTX reagent (Thermo Fisher Scientific, Waltham, MA). At 24 h after transfection, 10 μg/ml puromycin (Thermo Fisher Scientific, Waltham, MA) was added to the wells. Two days after transfection, the cells were collected, and genomic DNA was extracted as previously described4.
Exosome collection and exosome RNA isolation
Exosomes were prepared by a stepwise centrifugation–ultracentrifugation method as described previously with minor modifications17. Briefly, 1.4 ml FBS was centrifuged at 10,000×g for 30 min to remove the cell debris and then centrifuged at 100,000×g for 70 min using a TLA-55 rotor (BECKMAN COULTER, Indianapolis, IN). The pellets were washed twice with phosphate-buffered saline (PBS) and then resuspended in 87.5 μL of PBS as exosome-enriched fractions. These exosome-enriched fractions were treated with RNase and RNase/DNase to remove extraneous nucleic acids outside of exosomes. Then, the exosome fraction with and without RNase and RNase/DNase treatment was mixed with 700 μL of QIAzol Lysis reagent (QIAGEN, Hilden, Germany), and the aqueous phase was collected by adding chloroform. After the addition of ethanol to the aqueous phase, total RNA was purified using RNeasy Mini Elute Spin Columns (QIAGEN, Hilden, Germany). The RNA sample was in 14 μL of nuclease-free water. The concentration of RNA was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA), and the quality of RNA was analyzed using an Agilent 2100 Bioanalyzer and RNA pico chips (Agilent Technologies, Palo Alto, CA).
PCR and DNA sequencing
For analyses of unintentional sequence insertion associated with DSB repairs, genomic DNA was prepared from the embryonic yolk sac or cultured cells using the DNeasy kit (QIAGEN, Hilden, Germany). The identity of the indels induced by DSB repair was confirmed by PCR and subsequent next-generation sequencing using MiSeq (Illumina Inc., San Diego, CA). The following primers were used: Peg10 F (5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagacgccgcaaaatgaat-3′; NNNNNNNN = Illumina barcode S sequence) and Peg10 R (5′-CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGgaggctttcgctggacac-3′; NNNNNNNN = Illumina barcode N sequence) as previously described4.
A mixture of 1× ExTaq buffer (Takara Bio, Kusatsu, Japan), 2.5 mM dNTPs, primers and 2.5 U of ExTaq (Takara Bio, Kusatsu, Japan) was subjected to 32 PCR cycles of 96 °C for 15 s, 65 °C for 30 s, and 72 °C for 30 s in a Bio-Rad C1000 Touch system. Each PCR product was purified using an Ampure XP (BECKMAN COULTER, Indianapolis, IN) as previously described4.
For analyses of exosomes from FBS, exosome cDNA libraries were synthesized with SMARTer smRNA-Seq Kit for Illumina (Takara Bio, Kusatsu, Japan). The concentration of the PCR products with DSB repair and cDNA synthesized from exosome RNA were quantified using a Kapa Library Quantification kit (Roche, Basel, Switzerland). These products (8 pM) were then subjected to 300 cycles of paired-end index sequencing (total 600 cycles) on an Illumina MiSeq sequencer according to the manufacturer’s instructions (Illumina Inc., San Diego, CA). All the sequence data were converted to FASTQ format by using Illumina BaseSpace (https://basespace.illumina.com/home/index).
Evaluation of cell-free nucleic acids in FBS and exosome-free FBS
Briefly, 24 ml of FBS and exosome-free FBS were centrifuged at 10,000×g for 30 min to remove the cell debris and cell-free nucleic acids were purified via a phenol-chloroform procedure. Then, ethanol precipitation with glycogen was performed and eluted into DNase/RNase-free water. The concentration and quality of cell-free nucleic acids were determined by using a NanoDrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA) and Agilent 2100 Bioanalyzer and DNA HS chips (Agilent Technologies, Palo Alto, CA), respectively.
One-cell embryo injection
C57BL/6J × CBA F1 female mice (4 weeks) (Charles River Japan, Yokohama, Japan) were superovulated, and IVF was performed using C57BL/6J male mice sperm. Then, 50 ng/μL Cas9 mRNA and 25 ng/μL Peg10-ORF1-sgRNA were injected into the cytoplasm of 147 fertilized eggs. The eggs were cultivated overnight in KSOM, and 55 fertilized eggs were then transferred into the oviducts of pseudopregnant MCH females (CLEA Japan, Inc. Tokyo, Japan) as previously described4.
Determination of sequence length distribution
All analyses were performed using Galaxy (https://usegalaxy.org). FASTQ files were filtered by the FILTER By Quality program with default parameters. Paired-end reads were merged using the PEAR program and default parameters, and assembled reads with the Peg10-F sequence at the 5′ end and the Peg10-R sequence at the 3′ end were filtered by the Barcode Splitter program. The lengths of the filtered sequences were counted by the Compute sequence length program. Frequent reads were identified by FastQC.
Sequence analyses
PCR products longer (>32 bp) than WT were analyzed by the BLASTN program from the NCBI server (http://www.ncbi.nlm.nih.gov/BLAST/) and the CENSOR program from the GENETIC INFORMATION RESEARCH INSTITUTE (http://www.girinst.org/censor/index.php). The reference sequences are Mus musculus (mouse): MM10 (NCBI) for mouse genome, GRCm38 (NCBI) for mouse cDNA and ENSMUST (Ensembl) for mouse mRNA; B. taurus (bovine): bosTau7 (NCBI) for bovine genome; Capra hircus (goat): CHIR_1.0 (NCBI) for goat genome; and E. coli str.K-12 (NCBI) for E. coli genome. These data were obtained from the NCBI (https://www.ncbi.nlm.nih.gov/genome/) and Ensembl (https://asia.ensembl.org/info/data/ftp/index.html) databases.
Reporting summary
Further information on experimental design is available in the Nature Research Reporting Summary linked to this article.
Data availability
The authors declare that the data supporting the findings of this study are available within the article and its Supplementary Information files.
References
Gaj, T., Gersbach, C. A. & Barbas, C. F. 3rd ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397–405 (2013).
Fu, Y. et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechnol. 31, 822–826 (2013).
Wang, H. et al. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910–918 (2013).
Ono, R. et al. Double strand break repair by capture of retrotransposon sequences and reverse-transcribed spliced mRNA sequences in mouse zygotes. Sci. Rep. 5, 12281 (2015).
Li, W., Tucker, A. E., Sung, W., Thomas, W. K. & Lynch, M. Extensive, recent intron gains in Daphnia populations. Science 326, 1260–1262 (2009).
Farlow, A., Meduri, E., Dolezal, M., Hua, L. & Schlotterer, C. Nonsense-mediated decay enables intron gain in Drosophila. PLoS Genet. 6, e1000819 (2010).
Zhang, L. Y., Yang, Y. F. & Niu, D. K. Evaluation of models of the mechanisms underlying intron loss and gain in Aspergillus fungi. J. Mol. Evol. 71, 364–373 (2010).
Moore, J. K. & Haber, J. E. Capture of retrotransposon DNA at the sites of chromosomal double-strand breaks. Nature 383, 644–646 (1996).
Teng, S. C., Kim, B. & Gabriel, A. Retrotransposon reverse-transcriptase-mediated repair of chromosomal breaks. Nature 383, 641–644 (1996).
Bill, C. A. & Summers, J. Genomic DNA double-strand breaks are targets for hepadnaviral DNA integration. Proc. Natl. Acad. Sci. USA 101, 11135–11140 (2004).
Onozawa, M. et al. Repair of DNA double-strand breaks by templated nucleotide sequence insertions derived from distant regions of the genome. Proc. Natl. Acad. Sci. USA 111, 7729–7734 (2014).
Yang, Z. et al. Fast and sensitive detection of indels induced by precise gene targeting. Nucleic Acids Res. 43, e59 (2015).
McVey, M. & Lee, S. E. MMEJ repair of double-strand breaks (director’s cut): deleted sequences and alternative endings. Trends Genet. 24, 529–538 (2008).
Kohany, O., Gentles, A. J., Hankus, L. & Jurka, J. Annotation, submission and screening of repetitive elements in Repbase: RepbaseSubmitter and Censor. BMC Bioinformatics 7, 474 (2006).
Alberry, M. et al. Free fetal DNA in maternal plasma in anembryonic pregnancies: confirmation that the origin is the trophoblast. Prenat. Diagn. 27, 415–418 (2007).
Raposo, G. et al. B lymphocytes secrete antigen-presenting vesicles. J. Exp. Med. 183, 1161–1172 (1996).
Valadi, H. et al. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat. Cell Biol. 9, 654–659 (2007).
Lawrie, C. H. et al. Aberrant expression of microRNA biosynthetic pathway components is a common feature of haematological malignancy. Br. J. Haematol. 145, 545–548 (2009).
de Jong, O. G. et al. Cellular stress conditions are reflected in the protein and RNA content of endothelial cell-derived exosomes. J. Extracell. Vesicles 1, 18396 (2012).
Yoshioka, Y. et al. Comparative marker analysis of extracellular vesicles in different human cancer types. J. Extracell. Vesicles 2, 20424 (2013).
Yanez-Mo, M. et al. Biological properties of extracellular vesicles and their physiological functions. J. Extracell. Vesicles 4, 27066 (2015).
Ono, R. et al. A retrotransposon-derived gene, PEG10, is a novel imprinted gene located on human chromosome 7q21. Genomics 73, 232–237 (2001).
Ono, R. et al. Identification of a large novel imprinted gene cluster on mouse proximal chromosome 6. Genome Res. 13, 1696–1705 (2003).
Ono, R. et al. Deletion of Peg10, an imprinted gene acquired from a retrotransposon, causes early embryonic lethality. Nat. Genet. 38, 101–106 (2006).
Sekita, Y. et al. Role of retrotransposon-derived imprinted gene, Rtl1, in the feto-maternal interface of mouse placenta. Nat. Genet. 40, 243–248 (2008).
Naruse, M. et al. Sirh7/Ldoc1 knockout mice exhibit placental P4 overproduction and delayed parturition. Development 141, 4763–4771 (2014).
Ivancevic, A. M., Kortschak, R. D., Bertozzi, T. & Adelson, D. L. Horizontal transfer of BovB and L1 retrotransposons in eukaryotes. Genome Biol. 19, 85 (2018).
Ran, F. A. et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, 1380–1389 (2013).
Kleinstiver, B. P. et al. High-fidelity CRISPR-Cas9 nucleases with no detectable genome-wide off-target effects. Nature 529, 490–495 (2016).
Takata, M. et al. Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells. EMBO J. 17, 5497–5508 (1998).
Rebuzzini, P. et al. New mammalian cellular systems to study mutations introduced at the break site by non-homologous end-joining. DNA Repair 4, 546–555 (2005).
Preston, C. R., Flores, C. C. & Engels, W. R. Differential usage of alternative pathways of double-strand break repair in Drosophila. Genetics 172, 1055–1068 (2006).
Beumer, K. J. et al. Efficient gene targeting in Drosophila by direct embryo injection with zinc-finger nucleases. Proc. Natl. Acad. Sci. USA 105, 19821–19826 (2008).
Jeggo, P. A. DNA breakage and repair. Adv. Genet. 38, 185–218 (1998).
Chu, V. T. et al. Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat. Biotechnol. 33, 543–548 (2015).
Maruyama, T. et al. Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nat. Biotechnol. 33, 538–542 (2015).
Acknowledgements
The authors thank Toshiko Momiyama, Erika Tachihara, Miki Uchiyama, and Yusuke Furukawa for excellent technical assistance. This work was supported in part by the Research on Regulatory Science of Pharmaceuticals and Medical Devices (18mk0104073j0103) and the Research on Development of New Drugs (18ak0101093j001) from Japan Agency for Medical Research and Development (AMED), Health Sciences Research Grants from the Ministry of Health, Labor, and Welfare, Japan (H30-KAGAKU-IPPAN-002, H30-KAGAKU-SHITEI-001), and JSPS KAKENHI (26430183 and 18K19315) to R.O.
Author information
Authors and Affiliations
Contributions
R.O. conceived of the study. R.O., K.A., S.K., J.K., and Y.H. participated in the experimental design. R.O. performed most analyses. Y.Y. produced mutant mice by CRISPR/Cas. R.O. wrote the manuscript. All authors read and approved the final manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Ono, R., Yasuhiko, Y., Aisaki, Ki. et al. Exosome-mediated horizontal gene transfer occurs in double-strand break repair during genome editing. Commun Biol 2, 57 (2019). https://doi.org/10.1038/s42003-019-0300-2
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s42003-019-0300-2
This article is cited by
-
Improving CRISPR–Cas9 directed faithful transgene integration outcomes by reducing unwanted random DNA integration
Journal of Biomedical Science (2024)
-
Quality and Safety Considerations for Therapeutic Products Based on Extracellular Vesicles
Pharmaceutical Research (2024)
-
DNA in extracellular vesicles: from evolution to its current application in health and disease
Cell & Bioscience (2022)
-
Mitigating off-target effects in CRISPR/Cas9-mediated in vivo gene editing
Journal of Molecular Medicine (2020)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.