Efficient correction of a deleterious point mutation in primary horse fibroblasts with CRISPR-Cas9

Abstract

Phenotypic selection during animal domestication has resulted in unwanted incorporation of deleterious mutations. In horses, the autosomal recessive condition known as Glycogen Branching Enzyme Deficiency (GBED) is the result of one of these deleterious mutations (102C > A), in the first exon of the GBE1 gene (GBE1102C>A). With recent advances in genome editing, this type of genetic mutation can be precisely repaired. In this study, we used the RNA-guided nuclease CRISPR-Cas9 (clustered regularly-interspaced short palindromic repeats/CRISPR-associated protein 9) to correct the GBE1102C>A mutation in a primary fibroblast cell line derived from a high genetic merit heterozygous stallion. To correct this mutation by homologous recombination (HR), we designed a series of single guide RNAs (sgRNAs) flanking the mutation and provided different single-stranded donor DNA templates. The distance between the Cas9-mediated double-stranded break (DSB) to the mutation site, rather than DSB efficiency, was the primary determinant for successful HR. This framework can be used for targeting other harmful diseases in animal populations.

Introduction

For centuries humans have been performing phenotypic selection on plants, livestock and companion animals to suit their needs. Although this form of breeding has been successful in the establishment and improvement of many different breeds of plants and animals, we have unknowingly co-selected for deleterious mutations1. In horses, one of these deleterious mutations is the 102C > A nonsense mutation in the first exon of the GBE1 gene, which causes the condition known as Glycogen Branching Enzyme Deficiency (GBED). This disease severely disrupts glycogen metabolism by decreasing the capacity of myophosphorylase to use glycogen as a substrate to liberate glucose2. This mutation is lethal in homozygotes, due to the lack of GBE activity in liver, cardiac and skeletal muscle2,3,4,5. An estimated 9% of Quarter Horse and Paint Horse lineages are heterozygotic carriers, which have half of the normal GBE activity2,3,4,5 but are otherwise asymptomatic. In addition, this disease is a significant cause of second and third-trimester abortion and foal mortality in the American Quarter Horse breed3,6,7.

Precise manipulation of eukaryotic genomes for the correction of monogenic diseases is now possible. This is due to the development of genome editing technologies based on programmable nucleases8, together with advances in both DNA sequencing and synthesis9,10. This advances can be applied to tackle the more than 6,000 identified genetic mutations linked to disease in humans and animals11,12.

Precise editing of a genome locus has historically been hampered by the overall low frequencies of homologous recombination, in which successful modification is achieved in one per a thousand transfected cells (0.001%)13. However, this changed in 1983 with the discovery that a site-specific double-stranded break (DSB) in genomic DNA stimulates a particular locus to exchange genetic information with either a homologous chromosome or an exogenously provided repair template14. Since this discovery, the field of genome editing has pursued the development of technologies to induce site-specific DSBs using engineered nucleases15: first with the zinc-finger nucleases (ZFNs)8,16, then transcription activator-like effector nucleases (TALENs)17,18, and more recently using the CRISPR-Cas system19,20,21.

DSBs are sensed by the cells endogenous DNA repair system22,23,24,25 which repairs the DSBs predominantly using the error-prone canonical non-homologous end joining (c-NHEJ) pathway. To a lesser extent, DSBs can be repaired by homologous recombination (HR), which is comprised of at least three sub-pathways: homology-directed repair (HDR), single-stranded annealing (SSA) and the recently recognized single-stranded template repair (SSTR)26,27.

The application of genome editing technologies can have a significant impact on animal health when combined with a unique and powerful tool that is not available in human medicine: reproductive cloning28,29. Producing cloned, gene-edited animals from modified cell lines has been widely reported29,30,31,32,33,34,35,36,37,38,39,40,41,42,43. For example, hornless cattle were recently produced by the introgression of the dominant PC Celtic POLLED allele into primary cells of the Holstein breed using TALENs, which was followed by reproductive cloning44,45. However, genome editing to correct mutations in the equine genome has not been previously reported.

Here for the first time, we utilized the CRISPR-Cas9 system to successfully correct, the GBED mutation in a heterozygous primary fibroblast cell line derived from an American Quarter Horse stallion. The long-term goal of our work is to use these corrected cell lines for somatic cell nuclear transfer (SCNT), to generate a cloned animal that maintains the genetic merit of its predecessor and is free of the GBED mutation (Fig. 1).

Figure 1
figure1

Experimental design for the correction of the GBE1C>A mutation in primary equine fibroblasts. A skin biopsy from a GBE1C>A heterozygous high genetic merit American Quarter Horse stallion was used to establish a primary fibroblast cell line. Different sgRNAs at varying distances from the mutation were designed and cloned into the CRISPR-Cas9 PX458 plasmid, which allowed for GFP selection via flow cytometry. Different single-stranded oligodeoxynucleotide (ssODN) repair templates were tested. Cells were co-transfected with the PX458 plasmid and the repair template. Cells were subsequently enriched by flow cytometry and single-cell colonies were recovered. The target region was sequenced for verification of the genetic correction.

Results

Inhibiting apoptosis is beneficial for effective isolation of single-cell clones in primary horse fibroblasts

In order to correct the mutation in a heterozygous American Quarter Horse stallion (Fig. 1), we first established a protocol for clonal isolation after transfection and enrichment by fluorescence-activated cell sorting (FACS). To this end, karyotypically normal primary fibroblasts derived from the heterozygous stallion (Fig. 2A) were transfected (Fig. 2B,C) and sorted by FACS for viable cells containing the construct (Fig. 2D). Sorted cells were plated at low density and after ~10–15 days of culture, single-cell colonies were recovered by using agarose embedded cloning rings46 (Fig. 2E–H). The initial viability of the sorted cells was low, as measured by the number of total colonies divided by the number of plated cells, with only 7.0 ± 1.7% of cells forming viable colonies.

Figure 2
figure2

CRISPR-Cas9 Targeting of GBE1 locus in Primary Horse Fibroblasts. (A) Normal 64XY karyotype of the isolated equine primary fibroblasts. (B) Bright-field and (C) Fluorescent images 12 h after transfection. (D) Fluorescent activated cell sorting (FACS) enrichment of GFP+ cells. (E) Bright-field and (F) Fluorescent images of single-cells 48 h after sorting. (G) Single cell colony 11 days after sorting, (H) Coomassie blue stained colonies 15 days after sorting. (I) Effect of ROCK inhibitor Y27632 on cell viability post-sorting. (J) Schematic illustration of the different sgRNAs used to target the GBE1102C>A mutation. The C to A mutation at base 102 is indicated in red, the red arrow indicates the location of Cas9-mediated DSB 3 bp upstream of the PAM of the designed guides (i,e. +44, +15, +1, −1, −13) (K) Insertions or deletions (INDELS) generated using the designed sgRNAs. Bars represent standard deviation (SD) among biological replicates. Kruskal-Wallis One-way ANOVA with Tukey’s HSD, adjusted value (p) p < 0.001 shown as **p < 0.001 shown as ***p < 0.0001 shown as ****.

To improve the post sorting viability, we added 10 µM of a Rho-associated protein kinase (ROCK) inhibitor (Y-27632) to our recovery medium. This compound blocks the ROCK-activated caspase signaling cascade leading to cellular apoptosis47 and has been reported to increase cellular proliferation and migration in human fibroblasts48 (Fig. 2I). This compound improved the post-sorting survival, for a total average viability post FACS of 16.0% ± 3.4 (p < 0.0001, Kruskal-Wallis One-way ANOVA with Tukey’s HSD F(3,15) = 46.8) (Fig. 2I).

Cas9-induced high DSB efficiency does not imply high HR efficiency

Once we established a protocol for the isolation of single-cell clones; we designed five different sgRNAs flanking the GBE1102C>A mutation at variable distances (Fig. 2J, Supplementary Table 1), taking computationally predicted off-target activity and folding efficiency into consideration. These sgRNAs were named according to the Cas9-induced DSB relative to the C > A mutation (e.g sgRNA -1 cutting 1 bp 3′ of the mutation, as Cas9-induced DSB occurs 3 bp upstream of the protospacer adjacent motif (PAM), Fig. 2J). From the different sgRNAs tested, sgRNA +15 displayed the greatest INDEL efficiency (p < 0.0001, Kruskal-Wallis One-way ANOVA with Tukey’s HSD, F(4,10 = 84.44)), while the other sgRNAs (+44, −13, +1, and −1) displayed comparable levels of activity except for sgRNA+44 (Fig. 2K).

After successfully targeting the GBE1 locus, we then pursued the correction of the C > A mutation by homologous recombination using single-stranded oligodeoxynucleotides (ssODN) as repair templates. We observed variable INDEL formation (8.3–85.7% n = 124) but no HR, when distal sgRNAs (+44, +15, −13) were co-transfected with and without a ssODN repair template with a 100 bp 5′ homology arm and a 30 bp 3′ homology arm from the mutation ((100–30) ssODN, Supplementary Fig. 1, Table 1).

Table 1 Distal sgRNAs with and without a (100-30) ssODN.

Due to the high level of INDEL formation with sgRNA+15, we hypothesized that HR rates could be improved using this sgRNA together with small molecules previously reported to enhance HR49. To test this we used the RAD-51 stimulatory compound RS-1 (15 µM)50 and the DNA-Ligase IV inhibitory compound SCR7 (80 µM)51 alone or in combination with the previously used 100-30 ssODN. However, under these conditions, no HR events were obtained and similar INDEL rates were observed between groups (Chi-square test P > 0.05, Table 2).

Table 2 RS-1 and SCR7 effect on sgRNA +15 with a (100-30) ssODN.

We then hypothesized that our sgRNA +15 could also be cutting the newly corrected allele, so we decided to incorporate a silencing mutation in the sgRNA +15 PAM together with a longer 5′ arm (168 bp), as more extensive homology arms are normally associated with better HR rates. We again tested this new repair template in combination with RS-1 and SCR7, but no HR events were obtained (Supplementary Table 2, Supplementary Fig. 1).

The observation that the sgRNA with the highest INDEL efficiency (sgRNA +15) did not produced detectable HR rates, even in the presence of small molecules or a silenced PAM, led us to hypothesize that cleavage efficiency was not the main factor driving HR and we proceeded to evaluate DSB proximity and repair template stability as possible factors for successful repair by HR.

Proximity of Cas9-induced DSB to the mutation and repair template stability are major determinants of HR efficiency

In order to improve the stability of the repair template we incorporated phosphorothioate (PS) modifications, which have been reported to increase HR rates by protecting repair templates from exonuclease activity52. Additionally, Liang, et al.53 reported that a small asymmetric repair template was very efficient in HR, so we decided to shorten our 5′ homology arm ((67-30) PS-ssODN). We noticed that when a PS modified ssODN was used the viability was decreased (3.2% ± 0.9 (p < 0.001)) without the use of the Y-27632 compound, as compared to control cells and a non-modified ssODN (Fig. 2I). This indicates that extending the half-life of the repair template can have toxic effects in primary cells and the use of apoptosis inhibitory compounds is warranted, as the addition of Y-27632 produced an approximately 8-fold increase in the number of viable colonies (Fig. 2I).

When we tested our hypothesis by co-transfecting the proximal sgRNAs (+1, −1) together with the (67-30) PS-ssODN we observed 15.0% HR (n = 20) for sgRNA +1 and 15.4% (n = 13) HR for sgRNA −1. To decrease the probability of computationally predicted off-target effects54 (Supplementary Dataset 2), truncated versions of these sgRNAs (+1T, −1T) were used, which yielded 4.3% (n = 23) and 12.5% (n = 16) HR, respectively (Fig. 3A–C, Table 3).

Figure 3
figure3

Gene editing outcomes of proximal sgRNAs. (A) Total events with modifications showing the percent of INDELS and HR of proximal sgRNAs (+1, −1), and their truncated versions (+1T, −1T) with an asymmetric (67-30) PS-ssODN. Chi-square test (P > 0.05). (B) Sanger sequencing chromatograms of control unmodified colony: red arrow indicates the double peak showing the C (blue) to A (green) conversion in one of the alleles, representing the heterozygous state of the horse. (C) Representative chromatogram of gene-edited single-cell clone. Note there is an absence of the double peak observed in the control colony and the height of the both adjacent cytosines read peaks is approximately the same, indicating the correction of the mutation in the mutated allele. (D) Next generation sequencing (NGS) results of a subset of corrected clones and control mapping to the wildtype allele (Error bars represent SD among sequencing probes). (E) Genomic locations of the three off-target loci for guides +1, −1 and their truncated versions analyzed by NGS. Coding regions were prioritized.

Table 3 Proximal sgRNAs with and without a (67-30) PS-ssODN.

DNA from control and gene-edited clones was sent for independent analysis by the Texas A&M Genetics Laboratory for carrier status and type from 13 microsatellite markers specific to Equus caballus. Colonies analyzed are free from carrier status and from the same individual as the non-transfected control which is carrier of the GBED allele.

In order to verify that large deletions or mutations had not caused a failure to amplify the PCR product, genomic DNA from control and a subset of edited colonies were submitted for independent verification by targeted next generation sequencing (NGS) at the Genome Engineering and iPSC Center of the University of Washington School of Medicine. NGS revealed that three clones originally identified by our PCR product sequencing and TaqMan Assay as correctly repaired indeed contained detectable deletions. The remaining sequenced clones show more than >90% (93.9–98%) of reads aligned to the wildtype sequence with control showing only 50% with the remaining 50% corresponding to the mutated allele (Fig. 3D). Finally, we also sequenced the three most common predicted off-target sites among all guides and no INDELS were detected (Fig. 3E).

Taken together, we have created a framework for efficient genome editing in primary equine fibroblast and demonstrate that proximity of the cut site to the mutation site and stability of the repair template are the main factors affecting HR in our experiments.

Discussion

Traditional phenotypic selection and breeding in companion and agricultural animals has unknowingly co-selected and propagated deleterious mutations in animal populations. Monogenic diseases are surprisingly prevalent across many equine breeds, including conditions such as the Hyperkalemic Periodic Paralysis (HYPP), Severe Combined Immunodeficiency (SCID), Overo Lethal White Syndrome (OLWS), Junctional Epidermolysis Bullosa (JEB), Malignant Hyperthermia (MH), Hereditary Equine Regional Dermal Asthenia (HERDA), type 1 Polysaccharide Storage Myopathy (type 1 PSSM) and the Glycogen Branching Enzyme Deficiency (GBED) (Online Mendelian Inheritance in Animals, OMIA, http://omia.org/). With the discovery of CRISPR-Cas9 and advances in DNA sequencing and synthesis10,55, we now have the genetic tools to detect, correct and eliminate these diseases from animal populations. The main objective of this study was to correct the GBED mutation in a heterozygous American Quarter Horse stallion cell line using CRISPR-Cas9. The optimized conditions presented in this work could be used to obtain high HR-based repair rates in primary cells for the future targeting of other genetic diseases.

Many genetic engineering strategies incorporate DSBs in close proximity to the target region to be repaired56,57,58. In primary equine fibroblasts, under the conditions of this study, only the sgRNAs targeting the mutation site in very close proximity (+1, −1) were capable of producing HR events (Table 3). Our results agree with other published reports and identify proximity as one of the most critical factors for HR52. The inability to detect HR events with sgRNAs guiding Cas9-DSB distal (>~10 bp) from the mutation, could be due to our small sampling size or the low DSB efficiency (i.e sgRNA −13). We did not observe any HR events when we used a sgRNA that induced Cas9-mediated INDELs with high efficiency (sgRNA +15) despite many different conditions. (Tables 1 and 2, Supplementary Table 2). Another factor that can influence HR rates is allele specificity, as Cas9 does not tolerate PAM-proximal mismatches59, proximal sgRNAs (+1, −1) could only target the mutated allele and distal sgRNAs(+44, +15, −13) could target both alleles.

The use of the RAD-51 stimulatory compound RS-1 (15 µM)60 and the DNA-Ligase IV inhibitory compound SCR7 (80 µM)61, at the concentrations tested, did not yield any benefit in improving HR rates (Table 2, Supplementary Table 2). It is important to note that the concentration of SCR7 in the original publication of Chu, et al., was modified to 1 µM after our experiments were performed62, however this molecule has been highly controversial and other reports indicate a very high variability of this molecule between different experimental systems63 or that SCR7 is neither a selective nor a potent inhibitor of the human DNA ligase IV64. It is also unclear if this molecule can effectively inhibit equine DNA ligase IV, although it shares a 91% sequence similarity with the human homolog. RS-1 is a Rad51 stimulatory molecule identified by a small molecule screen where it was shown to stabilize the association of RAD51 with DNA60. Rad51 is an essential player in the HDR pathway that displaces the replication protein A (RPA) to form a RAD51–ssDNA nucleofilament recombinase, which is required for homology search, strand invasion and ultimately the repair of the DSB lesion65. Song et al.50, reported RS-1 improves HR rates 2–5 fold at a concentration of 7.5 µM in vitro and in vivo (from 4.4 to 26.1%). RS-1 was also shown to improve HR rates in HEK293 cells (from 3.5 to 21%) and U2OS cells (from 1.9 to 2.4%) at a concentration of 10 µM, but this varied depending on the loci and transfection methods66. It is important to note that a HR repair with a ssODN has been recently referred to as single-stranded template repair (SSTR)26,67 and it has been identified as a RAD51/BRCA2 independent pathway68, so the type of repair template used is one of the possible explanations as why we did not observe any benefit of the RS-1 molecule.

Hollywood et al.69, reported that after analyzing CRISPR-Cas9 repair tracts in the human CFTR gene, they found 90% of the editing events in the CFTR locus were long continuous repair tracts in excess of 100 bp from the DSB with no bias towards bi-directional or uni-directional correction. Based on this finding, they created sgRNAs that induced a Cas9 DSB 100 bp away from the target and obtained 1.9% HR events when providing a repair plasmid that harbored seven nucleotide differences with ~2 kb homology arms. They suggested that there is a ~200 bp window in which to select gRNAs for template-dependent editing. We could not employ long flanking homology arms due to the lack of the 3′ intronic sequence missing in the EquCab2.0 assembly at the initial time of this study and that we were unable to sequence despite numerous efforts (data not shown).Furthermore, the PCR product used to amplify the targeting region was too short to preform bulk gRNA cutting assessment with standard assays such as T7 endonuclease assay.

The lack of sequence information and the GC content flanking the GBED mutation limited our PCR product size resulting in a failure to detect large deletions. Using the new EquCab3.0 assembly, we performed targeted NGS on a subset of edited clones. We were unable to extend the coverage of the NGS reads for more than 70 bp 3′ of the GBED mutation due to the high CG content. Sequenced clonal cell lines show more than >90% (93.9–98%) of reads aligned to the wildtype GBED free sequence, whereas the heterozygous control DNA from the affected horse shows only 50% with the remaining 50% corresponding to the mutated allele. NGS revealed that three clones originally identified by our PCR product and TaqMan Assay as correctly repaired indeed had deletions that we had originally missed (Supplementary Dataset 1). Analysis of the NGS reads using both the SNP_test and raw_wt_test by CRIS.py70 confirmed that large deletions and/or mutations were not present in the genetically corrected cell lines. Finally, we performed targeted NGS for three predicted off-target sites among guides +1, −1 and their truncated versions. The sites were selected by prioritizing coding regions among possible off-target loci. No INDELS were detected in the NGS data among these sites in all the different single cell colonies sequenced. This illustrates the importance of careful analysis of the target site, as well as a reliably sequenced and annotated genome10 for the successful gene editing of agricultural and companion animals.

A single-stranded donor of approximately 90 nt in length was reported to produce high HR rates by Yang, et al., in human stem cells57. This finding was later confirmed by Liang, et al.52, who reported that an asymmetric ssODN (67-30) with PS modifications achieved up to 56% HR in HEK293 cells. A mechanistic explanation was proposed by Richardson, et al.71, who suggests that after the interaction of Cas9 with target DNA, Cas9 releases the PAM-distal non-target strand after cleavage but before complete dissociation. Based on this finding, Richardson, et al., rationally design an asymmetric ssDNA that matches the displaced strand, which increased HR rates by up to 60% in the absence of any chemical intervention71. In our work, we were able to obtain HR rates (up to 20%) when using an asymmetric ssODN with PS modifications ((67-30) PS-ssODN) together with proximal sgRNAs that induced a DSB within one nucleotide of the mutation site.

Editing of therapeutically relevant primary cells and tissues remains challenging. Exogenous DNA in primary cells stimulates the cytosolic DNA sensor cGMP-AMP (cGAMP) synthase (cGAS), which uses the second messenger cGAMP to activate the stimulator of interferon (INF) genes (STING). This leads to the production of Type I interferon and pro-inflammatory cytokines in an INF regulatory factor 3 (IFR3) and nuclear factor κβ (NF-κβ) dependent manner72,73,74. One recent improvement has been the delivery of Cas9 protein together with in vitro transcribed sgRNAs as a ribonucleoprotein complex (RNP), which bypasses these cytosolic DNA sensors and is therefore better tolerated in primary cells. Additionally Cas9 RNP delivery reduces the half-life of the complex and therefore decreases off-target effects75. However, Cas9 RNP triggers RNA-mediated innate immune responses, that can be avoided by a phosphatase treatment of sgRNAs to remove the 5′-triphosphate76,77. In this work we used CRISPR-Cas9 as a plasmid-based system because of the ability to enrich for transfected cells, which could explain the low viability post sorting we observed. New methodologies to fluorescently label the Cas9-RNP have been developed and these should be preferable in future work78.

To improve viability after transfection, we added 10 µM of the Rho-associated protein kinase (ROCK) inhibitor (Y27632) to our FACS recovery media, since this compound blocks the ROCK-activated caspase signaling cascade leading to cellular apoptosis47 and has been reported to increase cellular proliferation and migration in human fibroblasts48. We observed an approximately 6-fold increase in the number of viable colonies, for an average post FACS viability of 16.0 ± 0.9% when PS-ssODN were used (Fig. 2I). These results agree with other reports that inhibiting apoptosis is crucial for recovering edited colonies in primary cells, specifically the combined use of a p53 inhibitor (PFTα) and basic fibroblast growth factor (bFGF) in primary porcine cells79.

Besides the proximity and type of repair template, another possibility for the lack of HR with the distal sgRNAs at the GBE1 locus is the genomic context and the chromatin state at this locus. It has been shown that Cas9 diffusion and chromatin binding is reduced but not eliminated at heterochromatic regions80. Nucleosomes can directly impede Cas9 binding and cleavage, while chromatin remodeling can restore Cas9 access81. Miyaoka et al., showed that depending on the genomic context, more HR than NHEJ can be induced82, thus, the repair of the DSB is also influenced by the chromatin context. Although the repair of heterochromatic DSBs is just starting to be understood, it is known that pericentrometric heterochromatin relies on the relocalization of repair sites to the nuclear periphery before Rad51 recruitment and repair progression83,84. Due to the tissue-specific expression of the GBE1 gene, it is likely that in primary fibroblasts this gene is silenced and the DSB repair mechanisms might be influenced by the chromatin state.

C > A mutations can occur at relatively high rates due to spontaneous cytosine deamination85. Base editors provide a unique advantage to the correction of pathogenic mutations as there is no requirement for the introduction of a DSB or the HR machinery. Adenine base editors have been developed that can mediate the conversion of A•T to G•C in genomic DNA85,86, but the A•T to C•G (wild type sequence) or A•T to T•A (silence mutation) conversion required to correct the GBED mutation is not possible to date.

Although differences in HR or INDELS among proximal sgRNAs did not show statistically significant differences due to the small sample size (Fig. 3A, Table 3), we observed that truncating sgRNA+1 tended to increase INDEL rates, likely to the elimination of four continuous Gs at the 5′ end of the guide, as these are known to form a guanine-tetrad secondary structure that can decrease guide efficiency87 (Supplementary Table 1). We did not observe any off-target effects in the three evaluated loci with either the full length or truncated guides.

Producing cloned, gene-edited animals from modified cell lines has been widely reported29,30,31,32,33,34,35,36,37,38,39,40,41,42,43. Recent reports on bioinformatic analysis88,89 of the offspring of the gene-edited hornless bull44,45, homozygous for the dominant PC Celtic POLLED allele, revealed that there were unintentional integrations of the donor plasmid used as a repair template88,89. In this work we used ssODNs as repair templates that could bypass this type of unintended edits, but the risk of unintended integrations of the Cas9 plasmid could exist. The framework created in this study can be applied for the future generation of gene-edited colonies using Cas9-RNP that be then used for reproductive cloning.

In conclusion, we were able to correct the GBED mutation with moderate efficiency (~20%) when using Cas9 and proximal sgRNAs creating DSB within one nucleotide of the intended target site. We have also shown that sgRNA INDEL efficiency does not always correlate with the incorporation of HR events, even in the presence of small molecule compounds that have been reported to improve HR.

Materials and Methods

All methods were performed in accordance with Texas A&M University guidelines, biological safety and institutional animal care and use committee.

Establishing primary fibroblast cell line and culture

A skin biopsy from an American Quarter Horse Stallion was donated to our laboratory by the horse owner who collected it an aseptic manner and under local anesthesia. All work was done under the supervision of a licensed veterinarian using protocols approved by the Texas A&M University IACUC. The tissue sample was placed in 1x Ca2+ and Mg2+ free DPBS (14040133, Life Technologies®) and transported on ice. The tissue was washed in a 0.2% (v/v) chlorhexidine gluconate in DBPS followed by two DPBS washes. Tissue was trimmed into small pieces (<5 mm) and washed through a series of 1xDPBS washes in a 15 ml conical tube; where the sample was mixed by inversion, and the tissue was allowed to briefly settle to the bottom and supernatant was aspirated. The tissue was then suspended in Dulbecco’s Modified Eagle Medium with nutrient mixture F-12 (DMEM/F12, 11320082, Life Technologies®) supplemented with 10% fetal bovine serum (Premium Select FBS, S11595, Atlanta Biologicals), 1x antibiotic-antimycotic (Anti-Anti, 15240062, Thermo®) and 50 µg/ml gentamicin (15750060, Life Technologies®). The tissue sample was finally placed in a T25 tissue Falcon tissue culture flasks (353014, Corning®) and cultured at 37 °C in a 5% CO2 and 5% O2 humidified incubator (Nuaire) to reduce oxidative stress. Cells were passaged when 80% confluence was reached, in a split ratio of no more than 1 to 3.

Karyotyping

A normal karyotype integrity is essential for somatic cell nuclear transfer (SCNT) procedures90. For this, primary cells were grown for chromosome preparations following standard procedures as described by Raudsepp et al.91, and karyotyped according to GTG-banding width92.

Single guide RNA design

sgRNAs were designed using different bioinformatics web-based tools followed by a manual sequence verification. The different programs used were the Broad institute CRISPRko which uses the on-target scoring described by Doench, et al.93, and the WU-CRISPR tool of the Washington University described by Wong, et al.87, that evaluates the gRNA folding. All DNA sequences were manipulated using Benchling®94 and ApE (A plasmid editor, http://jorgensen.biology.utah.edu/wayned/ape/). RNA folding was assessed using the Mfold 2web server for nucleic acid folding and hybridization prediction. Each guide and its complementary sequence were ordered as synthetic 25 nm oligos from Thermo® with attached BbsI cloning sites: Sense: 5′–CACCGNNNNNNNNNNNNNNNNNNN–3′ and antisense: 3′–CNNNNNNNNNNNNNNNNNNNCAAA–5′ (Supplementary Table 1).

Single guide RNA cloning into the PX458 plasmid

The designed guides were cloned into the PX458 (pSpCas9(BB)-2A-GFP) plasmid (Addgene, #48138). Synthetic oligonucleotides were suspended in water to 100 µM and then 10 µM of oligos where phosphorylated using T4 PNK (M0201S, NEB) at 37 °C for 1 hour. A total 0.5 µM mix of both oligos, was denatured at 95 °C for 5 minutes and annealed by slowly cooling down at room temperature. The PX458 plasmid was digested with FastDigest BbsI (ER1011, Thermo®) for 1 hour at 37 °C, dephosphorylation was carried out with alkaline phosphatase (rSAP, M0371S NEB) for 30 minutes and the plasmid was run on a 1% agarose gel and subsequently purified using the QIAquick Gel Extraction Kit (28704, Qiagen®). We ligated 50 ng of the linearized vector and 1 µl of the annealed oligos (0.5 µM) using Quick ligase (11635379001, Roche®) for 1 h at room temperature. One Shot TOP10 competent E. coli cells (C404003, Thermo®) were transformed following manufacturer instructions and plated in 100 µg/ml Ampicillin (A5354, Sigma) LB agar plates followed by an overnight incubation at 37 °C. Insert was verified by colony PCR using the sense oligo as a forward primer and a common CBh reverse primer: 5′ GTCAATAGGGGGCGTACTTGG 3′, at a 50 °C annealing using the HiFi PCR premix (Clonetech®). A Maxiprep (Qiagen®) was performed followed by a final verification by Sanger sequencing using the LKO forward primer for the human U6 promoter: 5′ GACTATCATATGCTTACCGT 3′.

Design of repair templates

All repair templates were centered to the GBED mutation site (GenBank: AY505110.1), with a 30 bp 3′ homology arm and a variable length 5′ homology arm. All single-stranded oligodeoxinucleotide (ssODN) repair templates were ordered as PAGE Ultramer® DNA Oligos from IDT® and reconstituted to 100 µM concentration in nuclease-free water. All DNA sequences were manipulated using Benchling. (Supplementary Material 1, Supplementary Fig. 1).

Transfection of equine fibroblasts

In order to improve attachment and viability after transfection, plates were pre-coated with 0.1% gelatin in 1xDPBS and incubated at 37 °C for 1 h. Early passage cells were passed as described above and plated at density of 3 × 105 cells per well in a 6 well plate. Cells were transfected at 80% confluency using Lipofectamine 3000 (L3000001, Thermo®). For this, each well was transfected with 1 µg of CRISPR-Cas9 plasmid (PX458 with sgRNA) and 3 µl of the 10 mM ssODN (600 ng/µl). Media was replaced 12 h after transfection.

Flow cytometry enrichment of transfected. Cells

After verifying GFP expression under an inverted fluorescence microscope (Nikon Eclipse TE300), cells were trypsinized, suspended in sorting media (10% FBS in DPBS, 1xAnti-Anti and 1 mM EDTA) and transported on ice to the Texas A&M CVM flow cytometry facility. Before the flow sort, cells were stained with 2.5 ng/ml of propidium iodide (PI). PI negative and GFP positive cells were sorted into 45% FBS, 45% DMEMF12, 10% conditioned media from healthy cells, 1x Anti- Anti and 10 µM Y-27632, ROCK inhibitor (Stemcell®). Cells were plated at a density of 1000 cells per 150 mm dish for subsequent single-cell colony isolation.

Single-cell colony isolation

After ~10 days of culture single-cell colonies were recovered using agarose-embedded cloning rings for single-cell clone isolation as described by Mathupala, et al.46. Briefly, single cells colonies were marked (MBW10020, Nikon) and cloning cylinders carefully placed around clones with sterile curved forceps; then one percent (w/v) LMP agarose (A9414, Sigma®) in 1xDBPS (37 °C) was then slowly dispensed dropwise around the outside of the cloning cylinders. Cells were lifted with 40 µl of 0.05% trypsin-EDTA (Invitrogen®) at 37 °C for 5 minutes and then 100 µl of culture media was added to inactivate the trypsin and pipetted several times to detach and suspend cells before moving each colony to a 48 well plate. Subsequent passages to larger wells were made as the cells reached ~80% confluency. Cells from 6 well plates were passaged and half were cryopreserved in 10% DMSO, 45% FBS, 45% DMEM-F12 media using an isopropyl alcohol freezing container (5100-0001, Thermo®). The other half was used for DNA extraction.

Colony genotyping

DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen®) with the addition of 1 µl of tRNA (10 µg/µl) for improved DNA yield. DNA was eluted in nuclease-free water and the concentration was measured using the nanoDrop spectrophotometer (Thermo®). PCR was performed with approximately 200 ng of genomic DNA by using 2.5 units of the the HotStarTaq plus DNA polymerase (Qiagen®) with 1x Q solution, 100 µM dNTp Mix, and 0.1 µM of the forward and reverse primers in a 50 µl reaction. The PCR was performed at an annealing temperature of 57 °C with an extension time of 30 s for 40 cycles. PCR products were purified using the QIAquick PCR purification kit (Qiagen®) and eluted with nuclease-free water. Sanger sequencing was performed at the Texas A&M Institute for plant Genomics and Biotechnology. Forward primer: 5′ CTCGCCGCTATAAAGGGCCCC 3′, reverse primer: 5′ TGCGCTGGAAGTCCGGGG 3′. All chromatogram files were aligned in Benchling®. INDELs edits were analyzed using CRISPR-ID95 and ICE (Inference of CRISPR Edits)96.

Microsatellite analysis and RT-PCR taqman assay

Genomic DNA from gene edited, non-carrier single-cell colonies identified by Sanger sequencing and control sample, were sent to the Texas A&M Genetics Laboratory for independent TaqMan DNA typing and carrier status verification. A total of 13 microsatellite markers (AHT4, AHT5, ASB17, ASB23, HMS6, HMS7, HTG4, VHL20, HMS3, ASB2, HTG10, LEX33 and HTG6) specific to Equus caballus were used97,98. All markers are included in the panel were recommended by the International Society for Animal Genetics. GBED carrier status was determined by RT-qPCR TaqMan Assay. Forward primer: CCTGGGCCGCCTTCT. Reverse primer: GCGCTGGAAGTCCGGG. VIC probe: CCCGTACCTGAAGCC. FAM probe: CCCGTAACTGAAGCC.

Targeted next generation sequencing

DNA from control and a subset of edited colonies were sent for independent targeted next generation sequencing (NGS) at the Genome Engineering and iPSC Center of the University of Washington School of Medicine. Analysis was performed using CRIS.py99. The sequence of the guide RNAs +1, −1 and their truncated versions (Supplementary Table 1) were used to match the NGS output at the GBED loci. Additionally, 3 off-target loci were identified using Benchling Off-target finder and submitted for NGS and output matched to the sequence in EquCab3.0 assembly. PCR and sequencing errors such as C homopolymers were subtracted from sequencing reads before final analysis (Fig. 3D,E. Supplementary Dataset 1). Quality control measures (SNP_test and raw_wt_test ratios) were determined for each sequenced cell line to detect the potential for mutations or large deletions.

Statistical analysis

All experiments were performed using three or more independent biological replicates unless otherwise indicated. Statistical analyses of categorical variables were conducted using Pearson’s Chi-square or Fisher’s exact test99,100,101. For viability and fluorescence intensity analyses, after verifying for the assumptions of equal variance and normality, P values were calculated using One-Way ANOVA with Tukey’s HSD102. Unless otherwise indicated, error bars represent standard deviation. Analyses were performed with Prism (Graphpad®). Values with different subscripts are different (P < 0.05).

References

  1. 1.

    Brosnahan, M. M., Brooks, S. A. & Antczak, D. F. Equine clinical genomics: A clinician’s primer. Equine Vet. J. 42, 658–670 (2010).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  2. 2.

    Ward, T. L. et al. Glycogen branching enzyme (GBE1) mutation causing equine glycogen storage disease IV. Mamm. Genome 15, 570–577 (2004).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  3. 3.

    Valberg, S.J. & Mickelson, J. Glycogen branching enzyme deficiency. Proceedings of the 52nd Annual American Association of Equine Practitioners Convention, San Antonio, TX, 351–353 (2006).

  4. 4.

    Valberg, S. J. & Dyson, S. J. In Diagnosis and Management of Lameness in the Horse (Second Edition). (eds. Ross, M. W. & Dyson, S. J.) 818–839 (W.B. Saunders, Saint Louis; 2011).

  5. 5.

    Valberg, S. J. In The Athletic Horse (SECOND EDITION). (eds. Hodgson, D. R., McKeever, K. H. & McGowan, C. M.) 174–201 (W. B. Saunders, 2014).

  6. 6.

    Tryon, R. C. et al. Evaluation of allele frequencies of inherited disease genes in subgroups of American Quarter Horses. J. Am. Vet. Med. Assoc. 234, 120–125 (2009).

    PubMed  Article  PubMed Central  Google Scholar 

  7. 7.

    Wagner, M. L. et al. Allele frequency and likely impact of the glycogen branching enzyme deficiency gene in Quarter Horse and Paint Horse populations. J. Vet. Intern. Med. 20, 1207–1211 (2006).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  8. 8.

    Chandrasegaran, S. & Carroll, D. Origins of Programmable Nucleases for Genome Engineering. J. Mol. Biol. 428, 963–989 (2016).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  9. 9.

    Thompson, D. B. et al. The Future of Multiplexed Eukaryotic Genome Engineering. ACS Chem. Biol. 13, 313–325 (2018).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  10. 10.

    Shendure, J. et al. DNA sequencing at 40: past, present and future. Nature (2017).

  11. 11.

    OMIM, Vol. 2017 (Online Mendelian Inheritance in Man, Johns Hopkins University, 2017).

  12. 12.

    Porteus, M. H. & Baltimore, D. Chimeric nucleases stimulate gene targeting in human cells. Science 300, 763 (2003).

    PubMed  Article  PubMed Central  Google Scholar 

  13. 13.

    Smithies, O., Gregg, R. G., Boggs, S. S., Koralewski, M. A. & Kucherlapati, R. S. Insertion of DNA sequences into the human chromosomal beta-globin locus by homologous recombination. Nature 317, 230–234 (1985).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  14. 14.

    Szostak, J. W., Orr-Weaver, T. L., Rothstein, R. J. & Stahl, F. W. The double-strand-break repair model for recombination. Cell 33, 25–35 (1983).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  15. 15.

    Rouet, P., Smih, F. & Jasin, M. Introduction of double-strand breaks into the genome of mouse cells by expression of a rare-cutting endonuclease. Mol. Cell Biol. 14, 8096–8106 (1994).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  16. 16.

    Kim, Y. G., Cha, J. & Chandrasegaran, S. Hybrid restriction enzymes: zinc finger fusions to Fok I cleavage domain. Proc. Natl Acad. Sci. USA 93, 1156–1160 (1996).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  17. 17.

    Boch, J. et al. Breaking the code of DNA binding specificity of TAL-type III effectors. Science 326, 1509–1512 (2009).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  18. 18.

    Christian, M. et al. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186, 757–761 (2010).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  19. 19.

    Barrangou, R. & Doudna, J. A. Applications of CRISPR technologies in research and beyond. Nat. Biotechnol. 34, 933–941 (2016).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  20. 20.

    Doudna, J. A. & Charpentier, E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096 (2014).

    Article  CAS  Google Scholar 

  21. 21.

    Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816–821 (2012).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  22. 22.

    Chang, H. H. Y., Pannunzio, N. R., Adachi, N. & Lieber, M. R. Non-homologous DNA end joining and alternative pathways to double-strand break repair. Nat. Rev. Mol. Cell Biol. 18, 495–506 (2017).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  23. 23.

    Heyer, W. D., Ehmsen, K. T. & Liu, J. Regulation of homologous recombination in eukaryotes. Annu. Rev. Genet. 44, 113–139 (2010).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  24. 24.

    Panier, S. & Boulton, S. J. Double-strand break repair: 53BP1 comes into focus. Nat. Rev. Mol. Cell Biol. 15, 7–18 (2014).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  25. 25.

    Ciccia, A. & Elledge, S. J. The DNA damage response: making it safe to play with knives. Mol. Cell 40, 179–204 (2010).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  26. 26.

    Jasin, M. & Haber, J. E. The democratization of gene editing: Insights from site-specific cleavage and double-strand break repair. DNA Repair. 44, 6–16 (2016).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  27. 27.

    Richardson, C. D. et al. CRISPR-Cas9 Genome Editing In Human Cells Works Via The Fanconi Anemia Pathway. bioRxiv (2017).

  28. 28.

    Wilmut, I., Schnieke, A. E., McWhir, J., Kind, A. J. & Campbell, K. H. Viable offspring derived from fetal and adult mammalian cells. Nature 385, 810–813 (1997).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  29. 29.

    Campbell, K. H., McWhir, J., Ritchie, W. A. & Wilmut, I. Sheep cloned by nuclear transfer from a cultured cell line. Nature 380, 64–66 (1996).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  30. 30.

    Li, H. et al. Generation of biallelic knock-out sheep via gene-editing and somatic cell nuclear transfer. Sci. Rep. 6, 33675 (2016).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  31. 31.

    Gavin, W. et al. In Principles of Cloning (Second Edition). (eds. Cibelli, J. et al.) 329–342 (Academic Press, San Diego; 2014).

  32. 32.

    Liu, J. et al. Production of cloned embryos from caprine mammary epithelial cells expressing recombinant human beta-defensin-3. Theriogenology 79, 660–666 (2013).

    CAS  PubMed  Article  Google Scholar 

  33. 33.

    Zhang, P. et al. Handmade cloned transgenic sheep rich in omega-3 Fatty acids. Plos one 8, e55941 (2013).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  34. 34.

    Wu, X. et al. Production of cloned transgenic cow expressing omega-3 fatty acids. Transgenic Res. 21, 537–543 (2012).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  35. 35.

    Zhang, P. et al. Handmade cloned transgenic piglets expressing the nematode fat-1 gene. Cell Reprogram 14, 258–266 (2012).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  36. 36.

    Echelard, Y. et al. Production of recombinant albumin by a herd of cloned transgenic cattle. Transgenic Res. 18, 361–376 (2009).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  37. 37.

    Vajta, G. & Gjerris, M. Science and technology of farm animal cloning: state of the art. Anim. Reprod. Sci. 92, 211–230 (2006).

    PubMed  Article  PubMed Central  Google Scholar 

  38. 38.

    Kurome, M., Ueda, H., Tomii, R., Naruse, K. & Nagashima, H. Production of transgenic-clone pigs by the combination of ICSI-mediated gene transfer with somatic cell nuclear transfer. Transgenic Res. 15, 229–240 (2006).

    CAS  PubMed  Article  Google Scholar 

  39. 39.

    Lai, L. et al. Generation of cloned transgenic pigs rich in omega-3 fatty acids. Nat. Biotechnol. 24, 435–436 (2006).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  40. 40.

    Galli, C. et al. Pregnancy: a cloned horse born to its dam twin. Nature 424, 635 (2003).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  41. 41.

    Wells, D. In eLS (John Wiley & Sons, Ltd, 2001).

  42. 42.

    Polejaeva, I. A. et al. Cloned pigs produced by nuclear transfer from adult somatic cells. Nature 407, 86–90 (2000).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  43. 43.

    Schnieke, A. E. et al. Human factor IX transgenic sheep produced by transfer of nuclei from transfected fetal fibroblasts. Science 278, 2130–2133 (1997).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  44. 44.

    Tan, W. et al. Efficient nonmeiotic allele introgression in livestock using custom endonucleases. Proc. Natl Acad. Sci. USA 110, 16526–16531 (2013).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  45. 45.

    Carlson, D. F. et al. Production of hornless dairy cattle from genome-edited cell lines. Nat. Biotechnol. 34, 479–481 (2016).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  46. 46.

    Mathupala, S. & Sloan, A. A. An agarose-based cloning-ring anchoring method for isolation of viable cell clones. BioTechniques 46, 305–307 (2009).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  47. 47.

    Dakic, A. et al. ROCK inhibitor reduces Myc-induced apoptosis and mediates immortalization of human keratinocytes. Oncotarget 7, 66740–66753 (2016).

    PubMed  PubMed Central  Article  Google Scholar 

  48. 48.

    Piltti, J., Varjosalo, M., Qu, C., Hayrinen, J. & Lammi, M. J. Rho-kinase inhibitor Y-27632 increases cellular proliferation and migration in human foreskin fibroblast cells. Proteomics 15, 2953–2965 (2015).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  49. 49.

    Fujii, W. et al. Zygote-mediated generation of genome-modified mice using Streptococcus thermophilus 1-derived CRISPR/Cas system. Biochemical Biophysical Res. Commun. 477, 473–476 (2016).

    CAS  Article  Google Scholar 

  50. 50.

    Song, J. et al. RS-1 enhances CRISPR/Cas9- and TALEN-mediated knock-in efficiency. Nature communications 7 (2016).

  51. 51.

    Srivastava, M. et al. An inhibitor of nonhomologous end-joining abrogates double-strand break repair and impedes cancer progression. Cell 151, 1474–1487 (2012).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  52. 52.

    Liang, X., Potter, J., Kumar, S., Ravinder, N. & Chesnut, J. D. Enhanced CRISPR/Cas9-mediated precise genome editing by improved design and delivery of gRNA, Cas9 nuclease, and donor DNA. J. Biotechnol. 241, 136–146 (2017).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  53. 53.

    Liang, X. et al. Rapid and highly efficient mammalian cell engineering via Cas9 protein transfection. J. Biotechnol. 208, 44–53 (2015).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  54. 54.

    Fu, Y., Sander, J. D., Reyon, D., Cascio, V. M. & Joung, J. K. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nat. Biotechnol. 32, 279–284 (2014).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  55. 55.

    Chari, R. & Church, G.M. Beyond editing to writing large genomes. Nat Rev Genet (2017).

  56. 56.

    Urnov, F. D. et al. Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature 435, 646–651 (2005).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  57. 57.

    Yang, L. et al. Optimization of scarless human stem cell genome editing. Nucleic Acids Res. 41, 9049–9061 (2013).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  58. 58.

    Byrne, S. M., Ortiz, L., Mali, P., Aach, J. & Church, G. M. Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Res. 43, e21 (2015).

    PubMed  Article  CAS  PubMed Central  Google Scholar 

  59. 59.

    Zheng, T. et al. Profiling single-guide RNA specificity reveals a mismatch sensitive core sequence. Sci. Rep. 7, 40638 (2017).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  60. 60.

    Jayathilaka, K. et al. A chemical compound that stimulates the human homologous recombination protein RAD51. Proc. Natl Acad. Sci. USA 105, 15848–15853 (2008).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  61. 61.

    Maruyama, T. et al. Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nat. Biotechnol. 33, 538–542 (2015).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  62. 62.

    Chu, V. T. et al. Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat. Biotechnol. 33, 543–548 (2015).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  63. 63.

    Gutschner, T., Haemmerle, M., Genovese, G., Draetta, G. F. & Chin, L. Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair. Cell Rep. 14, 1555–1566 (2016).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  64. 64.

    Greco, G. E. et al. SCR7 is neither a selective nor a potent inhibitor of human DNA ligase IV. DNA Repair. 43, 18–23 (2016).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  65. 65.

    Lisby, M. & Rothstein, R. Cell biology of mitotic recombination. Cold Spring Harb. Perspect. Biol. 7, a016535 (2015).

    PubMed  PubMed Central  Article  CAS  Google Scholar 

  66. 66.

    Pinder, J., Salsman, J. & Dellaire, G. Nuclear domain ‘knock-in’ screen for the evaluation and identification of small molecule enhancers of CRISPR-based genome editing. Nucleic Acids Res. 43, 9379–9392 (2015).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  67. 67.

    Vriend, L. E. et al. Distinct genetic control of homologous recombination repair of Cas9-induced double-strand breaks, nicks and paired nicks. Nucleic Acids Res. 44, 5204–5217 (2016).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  68. 68.

    Bothmer, A. et al. Characterization of the interplay between DNA repair and CRISPR/Cas9-induced DNA lesions at an endogenous locus. Nat. Commun. 8, 13905 (2017).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  69. 69.

    Hollywood, J. A., Lee, C. M., Scallan, M. F. & Harrison, P. T. Analysis of gene repair tracts from Cas9/gRNA double-stranded breaks in the human CFTR gene. Sci. Rep. 6, 32230 (2016).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  70. 70.

    Connelly, J.P. & Pruett-Miller, S.M. CRIS.py: A Versatile and High-throughput Analysis Program for CRISPR-based Genome Editing. Scientific Reports 9, 4194 (2019).

  71. 71.

    Richardson, C. D., Ray, G. J., DeWitt, M. A., Curie, G. L. & Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat. Biotechnol. 34, 339–344 (2016).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  72. 72.

    Sun, L., Wu, J., Du, F., Chen, X. & Chen, Z. J. Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339, 786–791 (2013).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  73. 73.

    Wu, J. et al. Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339, 826–830 (2013).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  74. 74.

    Motwani, M., Pesiridis, S. & Fitzgerald, K. A. DNA sensing by the cGAS-STING pathway in health and disease. Nat Rev Genet (2019).

  75. 75.

    Kim, S., Kim, D., Cho, S. W., Kim, J. & Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012–1019 (2014).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  76. 76.

    Kim, S. et al. CRISPR RNAs trigger innate immune responses in human cells. Genome Res (2018).

  77. 77.

    Wienert, B., Shin, J., Zelin, E., Pestal, K. & Corn, J. E. In vitro-transcribed guide RNAs trigger an innate immune response via the RIG-I pathway. PLoS Biol. 16, e2005840 (2018).

    PubMed  PubMed Central  Article  CAS  Google Scholar 

  78. 78.

    Lee, K. et al. Synthetically modified guide RNA and donor DNA are a versatile platform for CRISPR-Cas9 engineering. Elife 6 (2017).

  79. 79.

    Niu, D. et al. Inactivation of porcine endogenous retrovirus in pigs using CRISPR-Cas9. Science 357, 1303–1307 (2017).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  80. 80.

    Knight, S. C. et al. Dynamics of CRISPR-Cas9 genome interrogation in living cells. Science 350, 823–826 (2015).

    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

  81. 81.

    Horlbeck, M. A. et al. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. Elife 5 (2016).

  82. 82.

    Miyaoka, Y. et al. Systematic quantification of HDR and NHEJ reveals effects of locus, nuclease, and cell type on genome-editing. Sci. Rep. 6, 23549 (2016).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  83. 83.

    Amaral, N., Ryu, T., Li, X. & Chiolo, I. Nuclear Dynamics of Heterochromatin Repair. Trends genetics: TIG 33, 86–100 (2017).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  84. 84.

    Caridi, P.C., Delabaere, L., Zapotoczny, G. & Chiolo, I. And yet, it moves: nuclear and chromatin dynamics of a heterochromatic double-strand break. Philosophical transactions of the Royal Society of London. Series B, Biological sciences 372 (2017).

  85. 85.

    Rees, H. A. & Liu, D. R. Base editing: precision chemistry on the genome and transcriptome of living cells. Nat. Rev. Genet. 19, 770–788 (2018).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  86. 86.

    Gaudelli, N. M. et al. Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage. Nature 551, 464–471 (2017).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  87. 87.

    Wong, N., Liu, W. & Wang, X. WU-CRISPR: characteristics of functional guide RNAs for the CRISPR/Cas9 system. Genome Biol. 16, 218 (2015).

    PubMed  PubMed Central  Article  CAS  Google Scholar 

  88. 88.

    Young, A. E. et al. Genomic and phenotypic analyses of six offspring of a genome-edited hornless bull. Nature biotechnology (2019).

  89. 89.

    Norris, A. L. et al. Template plasmid integration in germline genome-edited cattle. bioRxiv, 715482 (2019).

  90. 90.

    Galli, C., Lagutina, I., Duchi, R., Colleoni, S. & Lazzari, G. Somatic cell nuclear transfer in horses. Reprod. Domest. Anim. 43(Suppl 2), 331–337 (2008).

    PubMed  Article  PubMed Central  Google Scholar 

  91. 91.

    Raudsepp, T. & Chowdhary, B. P. In Phylogenomics. (ed. W.J. Murphy) 31–49 (Humana Press, Totowa, N. J.; 2008).

  92. 92.

    Seabright, M. A rapid banding technique for human chromosomes. Lancet 2, 971–972 (1971).

    CAS  PubMed  Article  PubMed Central  Google Scholar 

  93. 93.

    Doench, J. G. et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat. Biotechnol. 34, 184–191 (2016).

    CAS  PubMed  PubMed Central  Article  Google Scholar 

  94. 94.

    Sia, S. K. & Owens, M. P. Share and share alike. Nat. Biotech. 33, 1224–1228 (2015).

    CAS  Article  Google Scholar 

  95. 95.

    Dehairs, J., Talebi, A., Cherifi, Y. & Swinnen, J. V. CRISP-ID: decoding CRISPR mediated indels by Sanger sequencing. Sci. Rep. 6, 28973 (2016).

    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

  96. 96.

    Hsiau, T. et al. Inference of CRISPR Edits from Sanger Trace Data. bioRxiv, 251082 (2019).

  97. 97.

    Khanshour, A., Conant, E., Juras, R. & Cothran, E. G. Microsatellite analysis of genetic diversity and population structure of Arabian horse populations. J. heredity 104, 386–398 (2013).

    CAS  Article  Google Scholar 

  98. 98.

    Khanshour, A. M., Juras, R. & Cothran, E. G. Microsatellite analysis of genetic variability in Waler horses from Australia. Australian J. Zool. 61, 357–365 (2013).

    Article  Google Scholar 

  99. 99.

    Ugoni, A. & Walker, B. F. The Chi Square Test: An Introduction. COMSIG Rev. 4, 61–64 (1995).

    CAS  PubMed  PubMed Central  Google Scholar 

  100. 100.

    De Muth, J. E. Overview of biostatistics used in clinical research. Am. J. health-system pharmacy: AJHP: Off. J. Am. Soc. Health-System Pharmacists 66, 70–81 (2009).

    Article  Google Scholar 

  101. 101.

    Xu, B., Feng, X. & Burdine, R. D. Categorical data analysis in experimental biology. Developmental Biol. 348, 3–11 (2010).

    CAS  Article  Google Scholar 

  102. 102.

    Kao, L. S. & Green, C. E. Analysis of Variance: Is There a Difference in Means and What Does It Mean? J. surgical Res. 144, 158–170 (2008).

    Article  Google Scholar 

Download references

Acknowledgements

We would like to thank the Patsy Link Equine Research Endowment for the funding that made this research possible. We would like to thank Megan Mikkelson, Haley White, James Oldeschulte, Dalton Horn and Camilo Hernandez for their valuable help in different aspects of this project. We would like to thank Dr. Carly Turner for her help taking the biopsy samples and Dr. Gus Wright for his help during flow cytometry. We would like to thank Monica Sentmanat and Florian Colin for their help with next generation sequencing and analysis. Finally, we would like to thank Jun Wu, Isabel Lopez-Garcia and Emily Binshtok for their comments on the manuscript.

Author information

Affiliations

Authors

Contributions

C.P.A., M.C.G., D.V. and C.R.L. conceived and planned experiments. C.P.A. performed the experiments. C.P.A. and M.S. established the primary fibroblast cell line. C.L. and N.M. assisted with transfection, FACS, single-cell colony isolation, DNA purification, PCR and PCR purification. T.R. performed karyotype analysis and BAC sequencing efforts. R.J. performed the microsatellite analysis. C.P.A., C.R.L., D.V. and M.C.G. analyzed and evaluated data. C.P.A. and C.R.L. wrote the manuscript with critiques from all other authors. All authors reviewed the manuscript.

Corresponding author

Correspondence to Charles R. Long.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Pinzon-Arteaga, C., Snyder, M.D., Lazzarotto, C.R. et al. Efficient correction of a deleterious point mutation in primary horse fibroblasts with CRISPR-Cas9. Sci Rep 10, 7411 (2020). https://doi.org/10.1038/s41598-020-62723-3

Download citation

Further reading

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing