Beta-Glycerophosphate-Induced ORAI1 Expression and Store Operated Ca2+ Entry in Megakaryocytes

Pelzl, Lisann; Sahu, Itishri; Ma, Ke; Heinzmann, David; Bhuyan, Abdulla Al Mamun; al-Maghout, Tamer; Sukkar, Basma; Sharma, Yamini; Marini, Irene; Rigoni, Flaviana; Artunc, Ferruh; Cao, Hang; Gutti, Ravi; Voelkl, Jakob; Pieske, Burkert; Gawaz, Meinrad; Bakchoul, Tamam; Lang, Florian

doi:10.1038/s41598-020-58384-x

Download PDF

Article
Open access
Published: 03 February 2020

Beta-Glycerophosphate-Induced ORAI1 Expression and Store Operated Ca²⁺ Entry in Megakaryocytes

Scientific Reports volume 10, Article number: 1728 (2020) Cite this article

1925 Accesses
8 Citations
1 Altmetric
Metrics details

Subjects

Abstract

Impairment of renal phosphate elimination in chronic kidney disease (CKD) leads to enhanced plasma and tissue phosphate concentration, which in turn up-regulates transcription factor NFAT5 and serum & glucocorticoid-inducible kinase SGK1. The kinase upregulates ORAI1, a Ca²⁺-channel accomplishing store-operated Ca²⁺-entry (SOCE). ORAI1 is stimulated following intracellular store depletion by Ca²⁺-sensors STIM1 and/or STIM2. In megakaryocytes and blood platelets SOCE and thus ORAI1 are powerful regulators of activity. The present study explored whether the phosphate-donor ß-glycerophosphate augments NFAT5, ORAI1,2,3 and/or STIM1,2 expressions and thus SOCE in megakaryocytes. Human megakaryocytic Meg01cells were exposed to 2 mM of phosphate-donor ß-glycerophosphate for 24 hours. Platelets were isolated from blood samples of patients with impaired kidney function or control volunteers. Transcript levels were estimated utilizing q-RT-PCR, cytosolic Ca²⁺-concentration ([Ca²⁺]_i) by Fura-2-fluorescence, and SOCE from increase of [Ca²⁺]_i following re-addition of extracellular Ca²⁺ after store depletion with thapsigargin (1 µM). NFAT5 and ORAI1 protein abundance was estimated with Western blots. As a result, ß-glycerophosphate increased NFAT5, ORAI1/2/3, STIM1/2 transcript levels, as well as SOCE. Transcript levels of NFAT5, SGK1, ORAI1/2/3, and STIM1/2 as well as NFAT5 and ORAI1 protein abundance were significantly higher in platelets isolated from patients with impaired kidney function than in platelets from control volunteers. In conclusion, phosphate-donor ß-glycerophosphate triggers a signaling cascade of NFAT5/SGK1/ORAI/STIM, thus up-regulating store-operated Ca²⁺-entry.

Increased levels of the megakaryocyte and platelet expressed cysteine proteases stefin A and cystatin A prevent thrombosis

Article Open access 03 July 2019

P2X7 Receptor Stimulation Is Not Required for Oxalate Crystal-Induced Kidney Injury

Article Open access 27 December 2019

Platelet-derived microparticles enhance megakaryocyte differentiation and platelet generation via miR-1915-3p

Article Open access 02 October 2020

Introduction

Compromised renal elimination of phosphate leads in chronic kidney disease (CKD) to increase of phosphate concentration in plasma and tissues which in turn triggers vascular calcification leading to cardiovascular events and the respective increases of morbidity and mortality^1,2,3,4. Calcium deposition in the vascular wall involves osteo-/chrondrogenic reprogramming of vascular smooth muscle cells (VSMCs)^5,6,7,8. The signaling includes up-regulation of the transcription factor NFAT5 (nuclear factor of activated T cells 5)^9,10,11,12. NFAT5 was originally cloned as tonicity responsive enhancer binding protein (TonEBP) stimulated by hyperosmotic cell shrinkage^13,14 and subsequently been shown to be enhanced in several disorders, such as diabetes¹⁵, inflammation¹⁶ and CKD¹².

NFAT5-regulated genes include SGK1 (serum and glucocorticoid inducible kinase 1)¹⁷. SGK1 up-regulates the transcription factor NFκB (nuclear factor κB)¹⁸. NFκB triggers transcription of the Ca²⁺-channel ORAI1. Following depletion of intracellular Ca²⁺-stores ORAI1 is activated by Ca²⁺ sensing STIM (stromal interaction molecules)¹⁸. Opening of ORAI1 by STIM leads to the so-called store operated Ca²⁺-entry (SOCE)¹⁸, SOCE is a powerful mechanism activating blood platelets^19,20. Genetic or pharmacological knockout of SGK1 down-regulates ORAI1²¹, blunts platelet activation^22,23 and thus counteracts thrombosis²³ and arteriosclerosis²⁴. SGK1 and thus SGK1-dependent up-regulation of ORAI1 expression is stimulated by ischemia, oxidative stress, hyperglycemia, advanced glycation end products (AGEs) and several mediators including glucocorticoids, mineralocorticoids, transforming growth factor beta (TGFβ), interleukin 6 (IL-6), platelet-derived growth factor (PDGF), thrombin and endothelin²⁵. By stimulating ORAI1 expression, upregulated SGK1 may increase the risk of thrombo-occlusive events in diabetes mellitus, inflammation, and chronic kidney disease^20,24,25.

Platelets are released into the blood stream by megakaryocytes, which differentiate from hematopoietic progenitor cells in the bone marrow^26,27. Megakaryocytes reorganize their cytoplasm into long proplatelet extensions that release platelets into the circulation²⁷. Consequently, the proteins expressed in megakaryocytes are expected to be transferred into circulating blood platelets²⁷. Recent observations revealed a powerful SGK1 dependent stimulation of ORAI1 expression by NFAT5 overexpression in megakaryocytes²⁸.

In view of those observations we hypothesized that the phosphate-donor ß-glycerophosphate mimicking enhanced extracellular phosphate concentration may up-regulate the expression of NFAT5 in megakaryocytes, and that NFAT5 enhances the expression of SGK1, ORAI1 and STIM1 and/or STIM2. Considering that the abundance of the respective proteins in circulating platelets is a function of protein synthesis in megakaryocytes, enhanced extracellular phosphate may up-regulate the expression of NFAT5, SGK1, ORAI1 and STIM1 and/or STIM2 in circulating blood platelets. To the best of our knowledge, however, nothing is hitherto known on the contribution of NFAT5 to the regulation of megakaryocyte or platelet function in CKD patients.

The present study thus explored whether NFAT5, SGK1, ORAI1, ORAI2, ORAI3 STIM1 and/or STIM2 expression in megakaryocytes is sensitive to phosphate-donor ß-glycerophosphate and altered in patients with CKD incl. dialysis-dependency.

Results

As the transcription factor NFAT5 is known to upregulate expression of SGK1¹⁷ which in turn activates transcription factor NFkB with upregulation of ORAI and STIM isoform expression¹⁸, the present study explored whether the phosphate donor ß-glycerophosphate modifies the transcript levels of the transcription factor nuclear factor of activated T cells 5 (NFAT5), of the NFAT5-regulated serum & glucocorticoid inducible kinase 1 (SGK1), of the SGK1-sensitive Ca²⁺ release activated ion channels ORAI1, ORAI2 and ORAI3 as well as of the ORAI activating Ca²⁺ sensor isoforms STIM1 and STIM2. As illustrated in Fig. 1, 24 hours exposure of human megakaryocytes to 2 mM ß-glycerophosphate was followed by a significant increase in the transcript levels of NFAT5, SGK1, ORAI1, ORAI2, ORAI3, STIM1, and STIM2 (Fig. 1A–G). As illustrated in Fig. 1H, exposure to 2 mM ß-glycerophosphate further increases the transcription of fibroblast growth factor 23 (FGF23), a gene sensitive to ORAI1-dependent Ca²⁺ entry into UMR106 bone cells²⁹.

In order to test, whether the enhanced expression of ORAI and STIM isoforms is followed by the respective alterations of Ca²⁺ signaling, Fura2 fluorescence was utilized to determine the cytosolic Ca²⁺ activity ([Ca²⁺]_i). The 340 nm/380 nm ratio reflecting [Ca²⁺]_i was, prior to store depletion, similar in ß-glycerophosphate treated (0.425 ± 0.030, n = 7) and in untreated (0.459 ± 0.046, n = 7) megakaryocytes. For determination of SOCE, cells were exposed to thapsigargin (1 µM), a sarco-/endoplasmic reticulum Ca²⁺/ATPase (SERCA) inhibitor, and Ca²⁺-free solutions to deplete intracellular Ca²⁺ stores. In the following extracellular Ca²⁺ was re-added in the continued presence of thapsigargin to quantify SOCE from the increase of [Ca²⁺]_I (Fig. 2A). As illustrated in Fig. 2A,C–E, ß-glycerophosphate pretreatment significantly increased both peak and slope of SOCE. SOCE was significantly decreased by the selective ORAI1 inhibitor MRS1845 (10 µM) (Supplementary Fig. 3). The 340 nm/380 nm ratio was similar prior to (0.444 ± 0.016, n = 4) and 3 min following (0.495 ± 0.022, n = 4) acute administration of 2 mM ß-glycerophosphate in the presence of extracellular Ca²⁺ (Supplementary Fig. 4). Moreover, a 30 min pretreatment with 2 mM ß-glycerophosphate did not significantly modify SOCE (Supplementary Fig. 5).

In order to test, whether the observed upregulation of NFAT5, SGK1, ORAI1, ORAI2, STIM1 and STIM2 by ß-glycerophosphate in megakaryocytes leads to the respective alterations of transcript levels in circulating blood platelets, the cells were isolated from patients with impaired kidney function and control volunteers with normal kidney function. Supplementary Fig. 2 displays creatinine plasma levels, glomerular filtration rate (GFR), as well as numbers of leukocytes and platelets in blood from control volunteers and patients with impaired kidney function. As illustrated in Fig. 3, the transcript levels of NFAT5, SGK1, ORAI1, ORAI2, and STIM2 were significantly higher in blood platelets from patients with impaired kidney function than in platelets from control volunteers. As illustrated in Fig. 4, NFAT5, SGK1, ORAI isoforms and STIM isoforms transcript levels were negatively correlated with GFR, i.e. a decline of GFR was associated with enhanced transcript levels of NFAT5, SGK1, ORAI1, ORAI2, STIM1 and STIM2.

Western blotting was employed in order to test, whether the enhanced NFAT5 and ORAI1 transcript levels in patients with impaired kidney function are paralleled by the respective alterations of protein abundance. As illustrated in Fig. 5, both, NFAT5 and ORAI1 protein abundance was significantly higher in platelets from patients with impaired kidney function than in platelets from control volunteers.

Discussion

The present study discloses a novel effect of the phosphate donor ß-glycerophosphate in megakaryocytes, i.e. the upregulation of ORAI1, ORAI2, ORAI3, STIM1 and STIM2 expression. ORAI1 is a Ca²⁺ channel²² shown to accomplish store operated Ca²⁺ entry (SOCE) in multiple cell types³⁰ including platelets²⁰ and megakaryocytes²². To the best of our knowledge, an effect of phosphate or of phosphate donor ß-glycerophosphate on ORAI, STIM and their isoforms has never been shown before in megakaryocytes or platelets.

The effect of phosphate-donor ß-glycerophosphate is disrupted by pharmacological inhibition of SGK1 and is thus presumably due to upregulation of SGK1 by NFAT5. NFAT5 has previously been shown to increase the expression of SGK1¹⁷, which is known to trigger the degradation of the inhibitor protein IκBα thus allowing nuclear translocation of the transcription factor NFκB¹⁸. Genes up-regulated by NFκB include ORAI1¹⁸.

In view of the upregulation of NFAT5, SGK1, ORAI1, STIM1 and STIM2 expression in megakaryocytes by the phosphate donor ß-glycerophosphate, the transcript levels of NFAT5, SGK1, ORAI1, ORAI2, ORAI3, STIM1 and STIM2 were expected to be enhanced in platelets from patients with impaired kidney function. As a matter of fact, the transcript levels of each, NFAT5, SGK1, ORAI1, ORAI2, STIM1and STIM2 were significantly higher in platelets isolated from patients with impaired kidney function than in platelets isolated from control volunteers. As shown for NFAT5 and ORAI1, the increase of transcript levels is paralleled by the respective increase of protein abundance. NFAT5 expression has been shown to be upregulated by patients with advanced CKD incl. dialysis-dependency in other cell types¹², but not in megakaryocytes or blood platelets.

The upregulation of ORAI1 and STIM2 in platelets of CKD patients is expected to sensitize the platelets for activators³¹. The presently observed stimulation of ORAI1 and STIM2 could thus contribute to the known high risk of cardiac infarction and stroke in CKD patients^32,33. Excessive activation of blood platelets is well known to enhance the risk of cardiac infarction and stroke³⁴. Additional effort is needed to define the contribution of phosphate-sensitive ORAI1 and STIM2 expression in blood platelets to the enhanced cardiovascular risk in patients with advanced CKD.

As shown for other cell types, NFAT5 is up-regulated in further clinical disorders, such as dehydration¹¹, diabetes mellitus¹⁵ and inflammatory disease¹⁶. In those conditions the enhanced NFAT5 expression may lead to stimulation of SGK1 expression with subsequent upregulation of ORAI1, STIM1 and STIM2 in megakaryocytes and sensitization of blood platelets to activating stimuli. The signalling may again involve SGK1-sensitive degradation of the inhibitor protein IκBα thus allowing nuclear translocation of the transcription factor NFκB.

ORAI1 expression and thus SOCE may be sensitive to phosphate or ß-glycerophosphate in other cell types. The ORAI^{35,36,37,38,39} and STIM^{40,41,42,43,44} isoforms accomplish store operated Ca²⁺ entry (SOCE) in a myriad of cell types. Alterations of cytosolic Ca²⁺ activity in turn contribute to the regulation of diverse cellular functions including excitation, exocytosis, migration, cell proliferation and cell death^{45,46,47,48,49}. Notably, ORAI1 and STIM1 are expressed in lymphocytes thus participating in the orchestration of immune response and inflammation^50,51. The overexpression of ORAI1 and STIM1 in tumor cells contributes to cancer growth^{52,53,54,55,56}. Future experimental effort will be required to define the pathophysiological impact of phosphate sensitive ORAI and STIM expression on inflammation and malignancy in CKD.

Genes previously shown to be upregulated by NFAT5, SGK1, ORAI1, ORAI2, STIM1 and STIM2 in UMR106 cells include FGF23²⁹. Here we demonstrate that the phosphate donor ß-glycerophosphate upregulates FGF23 in megakaryocytes. In view of the putative influence of SOCE on FGF23 transcription in UMR106 cells²⁹, it is tempting to speculate that the observed signaling contributes to the phosphate-induced FGF23 release from bone. Whether ORAI1 expression and function is sensitive to phosphate in UMR106 cells remains, however, to be shown.

In conclusion, the phosphate donor ß-glycerophosphate stimulates the expression of NFAT5, SGK1, ORAI and STIM isoforms and thus store operated Ca²⁺ entry (SOCE) into megakaryocytes (Fig. 6). Accordingly, NFAT5, SGK1, ORAI and STIM isoform expression is enhanced in platelets of patients with impaired kidney function and could thus contribute to the enhanced cardiovascular risk in those patients.

Materials and Methods

Patients and volunteers

11 patients (8♂, 3♀) with impaired kidney function and 12 volunteers with normal kidney function (9♂, 3♀) have been enrolled in the study. The patients were recruited from the Department of Internal Medicine, University Hospital Tuebingen. The study was performed in accordance to the approval by ethics committee of the University of Tübingen (270/2011BO1) and in accordance with the Declaration of Helsinki. Informed written consent was provided by both, volunteers and patients. Clinical details of the patients are compiled in Table 1.

Table 1 Recruited patients with advanced CKD incl. dialysis-dependency and control volunteers.

Full size table

Preparation of human platelets

Venous blood was drawn into tubes containing acid/citrate/dextrose buffer, from the antecubital vein of volunteers and patients with impaired kidney function. Platelet-rich plasma (PRP) was removed by centrifugation at 430 × g for 20 min. PRP was centrifuged at 900 × g for 10 min after adding Tyrodes/HEPES buffer (2.5 mmol/liter HEPES, 1 mmol/liter KCl, 2.5 mmol/liter NaHCO₃, 150 mmol/liter NaCl, 0.36 mmol/liter NaH₂PO₄, 5.5 mmol/liter glucose, and 1 mg/ml BSA, pH 6.5). The platelets were resuspended after removing supernatant, in 200 µl of Tyrodes/HEPES buffer (supplemented with 1 mmol/liter CaCl_2, pH 7.4) and used for RNA/protein isolation. ~98% purity of the platelet preparation was obtained as determined by a Haematology Analyser (Sysmex KX219, Sysmex Germany GmbH).

Cell culture

Human megakaryocytic cells (Meg01) from ATCC (American Type Culture Collection, Manassas, VA, USA) were cultured in RPMI 1640 (Roswell Park Memorial Institute medium, Gibco Thermo Fischer Scientific, Paisley, United Kingdom) containing 10% FBS and 1% Penicillin/Streptomycin in humidified incubator at 37 °C and 5% CO₂. Where indicated, the cells were exposed to 2 mM ß-glycerophosphate (Sigma, Steinheim, Germany) for 24 hours in the absence and presence of ORAI1 inhibitor MRS1845 (10 µM) (Tocris, Bristol, United Kingdom). In the analysis of vascular calcification, phosphate donor ß-glycerophosphate is widely used as substitute for phosphate and well established stimulator of tissue calcification^57,58,59.

Quantitative PCR

To determine transcript levels of NFAT5, ORAI1, ORAI2, ORAI3, STIM1, STIM2 and FGF23 total RNA was extracted according to manufacturer’s instructions with TriFast (Peqlab, Erlangen, Germany)^{60,61,62,63,64}. DNAse digestion was performed to avoid DNA contamination and was followed by reverse transcription using random hexamers (Promega, Manheim, Germany) and GoScript™ reverse transcription system (Promega, Manheim, Germany). Real-time polymerase chain reaction (RT-PCR) amplification of the respective genes were set up in a total volume of 20 µl using 40 ng of cDNA, 500 nM forward and reverse primer and 2x GoTaq® qPCR Master Mix (Promega, Hilden, Germany) following manufacturer’s protocol. Cycling conditions were as follows: initial denaturation at 95 °C for 2 minutes, followed by 40 cycles of 95 °C for 15 seconds, 55 °C for 15 seconds and 68 °C for 20 seconds. For amplification the following primers were used (5′- > 3′ orientation) (Invitrogen, Carlsbad, CA, USA)):

NFAT5

fw: GAGCAGAGCTGCAGTAT

rev: AGCTGAGAAAGCACATAG

GAPDH:

fw: TGAGTACGTCGTGGAGTCCAC

rev: GTGCTAAGCAGTTGGTGGTG

ORAI1:

fw: CGTATCTAGAATGCATCCGGAGCC

rev: CAGCCACTATGCCTAGGTCGACTAGC

ORAI2:

fw: CAGCTCCGGGAAGGAACGTC

rev: CTCCATCCCATCTCCTTGCG

ORAI3:

fw:CTTCCAATCTCCCACGGTCC

rev:GTTCCTGCTTGTAGCGGTCT

SGK1:

fw:TTCCTATCGCAGTGTTTCAGTTCTT

rev:CACACTCACACGACGGTTCAC

STIM1:

fw: CCTCGGTACCATCCATGTTGTAGCA

rev: GCGAAAGCTTACGCTAAAATGGTGTCT

STIM2:

fw: CAAGTTGCCCTGCGCTTTAT

rev: ATTCACTTTTGCACGCACCG

FGF23:

fw: ATGAGCGTCCTCAGAGCCTA

rev: AGACGTCGTACCCGTTTTCC

Melting curves were analysed to confirm PCR product specificity. CFX96 Real-Time System (BioRad, Munich, Germany) was used to perform real-time PCR amplifications and all experiments were done in duplicate. The house-keeping gene Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was amplified to standardize the amount of sample RNA.

Western blotting

Protein abundance of NFAT5, ORAI1, and GAPDH was determined by Western blotting^{60,61,62,63,64}. After isolation of platelets from control donors and patients with impaired kidney function, platelets were centrifuged for 5 minutes at 600 g and 4 °C. The pellet was washed with ice cold PBS and suspended in 50 μl ice-cold RIPA lysis buffer (Cell Signalling Technology, USA) containing Protease Inhibitor Cocktail (Sigma-Aldrich, Taufkirchen, Germany). After centrifugation (20,000 g, 4 °C for 20 minutes) the supernatant was taken to determine protein concentration using the Bradford assay (BioRad, München, Germany). For Western blotting 50 µg of protein were electro-transferred onto a nitrocellulose membrane after electrophoresis using 12% SDS- PAGE and blocked with 5% milk in TBST at room temperature for 1 h. The membranes were incubated with primary anti-NFAT5 antibody (1:1000, Novus Biologicals), anti-ORAI1 antibody (1:1000, Proteintech, Chicago, USA) and anti-GAPDH antibody (1:1000, Cell Signaling, Danvers, USA) at 4 °C overnight. After washing (TBST), the blots were incubated with secondary anti-rabbit antibody conjugated with horseradish peroxidase (1:1000, Cell Signaling, Danvers, USA) for 1 h at room temperature. Protein bands were detected after additional washes (TBST) with an ECL detection reagent (Amersham, Freiburg, Germany). For densitometry image analysis, western blots were scanned and analyzed by ImageJ software (NIH, USA), and the results are shown as the ratio of total protein to GAPDH normalized to the control group. Protein-Marker VI (Peqlab, Erlangen, Germany) was used as reference to assign the right protein size.

Calcium measurements in megakaryocytes

To determine cytosolic Ca²⁺ concentration ([Ca²⁺]_i), Fura-2/AM fluorescence was utilized^{60,61,62,63,64,65}. Cells were preincubated for 15–30 minutes with Fura-2/AM (2 µM, Invitrogen, Goettingen, Germany) at 37 °C and excited alternatively at 340 nm and 380 nm in an inverted phase-contrast microscope (Axiovert 100, Zeiss, Oberkochen, Germany) through an objective (Fluor 40×/1.30 oil). At 505 nm, the emitted fluorescence intensity was recorded. Data (6/minute) were acquired using a computer software Metafluor (Universal Imaging, Downingtown, USA). To estimate cytosolic Ca²⁺ activity, a ratiometer (340 nm/380 nm) based analysis was employed. SOCE was determined following extracellular Ca²⁺ removal causing store depletion and subsequent Ca²⁺ re-addition in constant presence of SERCA inhibitor thapsigargin (1 µM, Invitrogen,Goettingen, Germany). For quantification of Ca²⁺ entry, the slope (delta ratio/s) and peak (delta ratio) were determined following re-addition of Ca²⁺. Experiments were performed with Ringer’s solution containing (in mM): 125 NaCl, 5 KCl, 1 CaCl₂, 32 HEPES, 2 Na₂HPO₄, 1.2 MgSO₄, 5 glucose, pH 7.4. Ca²⁺-free conditions were achieved by using Ca²⁺-free Ringer solution containing (in mM): 125 NaCl, 5 KCl, 1.2 MgSO₄, 2 Na₂HPO₄, 32 HEPES, 0.5 EGTA, 5 glucose, pH 7.4.

Statistical analysis

Data are provided as means ± SEM, n represents the number of independent experiments (i.e. in fluorescence experiments the number of dishes measured). Patient data are shown in scatter plots to illustrate the scatter of the data between patients. All data were tested for significance using unpaired t-test (Student’s t-test) or ANOVA. Results with p < 0.05 were considered statistically significant.

Ethical permission

The study was approved by the ethics committee of the University of Tuebingen (270/2011BO1) and has been executed in accordance with the Declaration of Helsinki. Both, volunteers and patients provided informed written consent. The data have been presented at a conference⁶⁶.

References

Blacher, J., Guerin, A. P., Pannier, B., Marchais, S. J. & London, G. M. Arterial calcifications, arterial stiffness, and cardiovascular risk in end-stage renal disease. Hypertension 38, 938–942 (2001).
Article CAS Google Scholar
London, G. M. et al. Arterial media calcification in end-stage renal disease: impact on all-cause and cardiovascular mortality. Nephrol. Dial. Transpl. 18, 1731–1740 (2003).
Article Google Scholar
Foley, R. N., Parfrey, P. S. & Sarnak, M. J. Epidemiology of cardiovascular disease in chronic renal disease. J. Am. Soc. Nephrol. 9, S16–23 (1998).
CAS PubMed Google Scholar
Mizobuchi, M., Towler, D. & Slatopolsky, E. Vascular calcification: the killer of patients with chronic kidney disease. J. Am. Soc. Nephrol. 20, 1453–1464, https://doi.org/10.1681/ASN.2008070692 (2009).
Article CAS PubMed Google Scholar
Kapustin, A. N. et al. Vascular smooth muscle cell calcification is mediated by regulated exosome secretion. Circ. Res. 116, 1312–1323, https://doi.org/10.1161/CIRCRESAHA.116.305012 (2015).
Article CAS PubMed Google Scholar
Lang, F., Ritz, E., Alesutan, I. & Voelkl, J. Impact of aldosterone on osteoinductive signaling and vascular calcification. Nephron Physiol. 128, 40–45, https://doi.org/10.1159/000368268 (2014).
Article CAS PubMed Google Scholar
Lang, F., Ritz, E., Voelkl, J. & Alesutan, I. Vascular calcification–is aldosterone a culprit? Nephrol. Dial. Transpl. 28, 1080–1084, https://doi.org/10.1093/ndt/gft041 (2013).
Article CAS Google Scholar
Steitz, S. A. et al. Smooth muscle cell phenotypic transition associated with calcification: upregulation of Cbfa1 and downregulation of smooth muscle lineage markers. Circ. Res. 89, 1147–1154 (2001).
Article CAS Google Scholar
Alesutan, I. et al. Inhibition of Phosphate-Induced Vascular Smooth Muscle Cell Osteo-/Chondrogenic Signaling and Calcification by Bafilomycin A1 and Methylamine. Kidney Blood Press. Res. 40, 490–499, https://doi.org/10.1159/000368524 (2015).
Article CAS PubMed Google Scholar
Feger, M. et al. Inhibitory effect of NH4Cl treatment on renal Tgfss1 signaling following unilateral ureteral obstruction. Cell Physiol. Biochem. 37, 955–964, https://doi.org/10.1159/000430222 (2015).
Article CAS PubMed Google Scholar
Lang, F., Guelinckx, I., Lemetais, G. & Melander, O. Two Liters a Day Keep the Doctor Away? Considerations on the Pathophysiology of Suboptimal Fluid Intake in the Common Population. Kidney Blood Press. Res. 42, 483–494, https://doi.org/10.1159/000479640 (2017).
Article CAS PubMed Google Scholar
Leibrock, C. B. et al. NH₄Cl Treatment Prevents Tissue Calcification in Klotho Deficiency. J. Am. Soc. Nephrol. 26, 2423–2433, https://doi.org/10.1681/ASN.2014030230 (2015).
Article CAS PubMed PubMed Central Google Scholar
Handler, J. S. & Kwon, H. M. Transcriptional regulation by changes in tonicity. Kidney Int. 60, 408–411, https://doi.org/10.1046/j.1523-1755.2001.060002408.x (2001).
Article CAS PubMed Google Scholar
Zhou, X. How do kinases contribute to tonicity-dependent regulation of the transcription factor NFAT5? World J. Nephrol. 5, 20–32, https://doi.org/10.5527/wjn.v5.i1.20 (2016).
Article PubMed PubMed Central Google Scholar
Hernandez-Ochoa, E. O. et al. Elevated extracellular glucose and uncontrolled type 1 diabetes enhance NFAT5 signaling and disrupt the transverse tubular network in mouse skeletal muscle. Exp. Biol. Med. 237, 1068–1083, https://doi.org/10.1258/ebm.2012.012052 (2012).
Article CAS Google Scholar
Neuhofer, W. Role of NFAT5 in inflammatory disorders associated with osmotic stress. Curr. Genomics 11, 584–590, https://doi.org/10.2174/138920210793360961 (2010).
Article CAS PubMed PubMed Central Google Scholar
Chen, S. et al. Tonicity-dependent induction of Sgk1 expression has a potential role in dehydration-induced natriuresis in rodents. J. Clin. Invest. 119, 1647–1658, https://doi.org/10.1172/JCI35314 (2009).
Article CAS PubMed PubMed Central Google Scholar
Lang, F. & Shumilina, E. Regulation of ion channels by the serum- and glucocorticoid-inducible kinase SGK1. FASEB J. 27, 3–12, https://doi.org/10.1096/fj.12-218230 (2013).
Article CAS PubMed Google Scholar
Braun, A. et al. Orai1 (CRACM1) is the platelet SOC channel and essential for pathological thrombus formation. Blood 113, 2056–2063 (2009).
Article CAS Google Scholar
Lang, F., Munzer, P., Gawaz, M. & Borst, O. Regulation of STIM1/Orai1-dependent Ca2+ signalling in platelets. Thrombosis Haemost. 110, 925–930, https://doi.org/10.1160/th13-02-0176 (2013).
Article CAS Google Scholar
Eylenstein, A. et al. Stimulation of Ca2+-channel Orai1/STIM1 by serum- and glucocorticoid-inducible kinase 1 (SGK1). FASEB J. 25, 2012–2021 (2011).
Article CAS Google Scholar
Borst, O. et al. The serum- and glucocorticoid-inducible kinase 1 (SGK1) influences platelet calcium signaling and function by regulation of Orai1 expression in megakaryocytes. Blood 119, 251–261, https://doi.org/10.1182/blood-2011-06-359976 (2012).
Article CAS PubMed Google Scholar
Lang, F., Gawaz, M. & Borst, O. The serum- & glucocorticoid-inducible kinase in the regulation of platelet function. Acta physiologica 213, 181–190, https://doi.org/10.1111/apha.12334 (2015).
Article CAS PubMed Google Scholar
Borst, O. et al. Pivotal role of serum- and glucocorticoid-inducible kinase 1 in vascular inflammation and atherogenesis. Arterioscler. Thromb. Vasc. Biol. 35, 547–557, https://doi.org/10.1161/ATVBAHA.114.304454 (2015).
Article CAS PubMed Google Scholar
Lang, F. & Voelkl, J. Therapeutic potential of serum and glucocorticoid inducible kinase inhibition. Expert. Opin. investigational drugs 22, 701–714, https://doi.org/10.1517/13543784.2013.778971 (2013).
Article CAS Google Scholar
Balduini, A. et al. In vitro megakaryocyte differentiation and proplatelet formation in Ph-negative classical myeloproliferative neoplasms: distinct patterns in the different clinical phenotypes. PLoS One 6, e21015, https://doi.org/10.1371/journal.pone.0021015 (2011).
Article ADS CAS PubMed PubMed Central Google Scholar
Golfier, S. et al. Shaping of terminal megakaryocyte differentiation and proplatelet development by sphingosine-1-phosphate receptor S1P4. FASEB J. 24, 4701–4710, https://doi.org/10.1096/fj.09-141473 (2010).
Article CAS PubMed Google Scholar
Sahu, I. et al. NFAT5-sensitive Orai1 expression and store-operated Ca(2+) entry in megakaryocytes. FASEB J. 31, 3439–3448, https://doi.org/10.1096/fj.201601211R (2017).
Article CAS PubMed Google Scholar
Glosse, P. et al. AMP-activated kinase is a regulator of fibroblast growth factor 23 production. Kidney Int. 94, 491–501, https://doi.org/10.1016/j.kint.2018.03.006 (2018).
Article CAS PubMed Google Scholar
Parekh, A. B. Store-operated CRAC channels: function in health and disease. Nat.Rev.Drug Discov. 9, 399–410 (2010).
Article CAS Google Scholar
Berna-Erro, A., Jardin, I., Smani, T. & Rosado, J. A. Regulation of Platelet Function by Orai, STIM and TRP. Adv. Exp. Med. Biol. 898, 157–181, https://doi.org/10.1007/978-3-319-26974-0_8 (2016).
Article CAS PubMed Google Scholar
Moody, W. E., Edwards, N. C., Chue, C. D., Ferro, C. J. & Townend, J. N. Arterial disease in chronic kidney disease. Heart 99, 365–372, https://doi.org/10.1136/heartjnl-2012-302818 (2013).
Article CAS PubMed Google Scholar
Webster, A. C., Nagler, E. V., Morton, R. L. & Masson, P. Chronic Kidney Disease. Lancet 389, 1238–1252, https://doi.org/10.1016/S0140-6736(16)32064-5 (2017).
Article PubMed Google Scholar
Renga, B. & Scavizzi, F. Platelets and cardiovascular risk. Acta Cardiol. 72, 2–8, https://doi.org/10.1080/00015385.2017.1281560 (2017).
Article PubMed Google Scholar
Prakriya, M. et al. Orai1 is an essential pore subunit of the CRAC channel. Nat. 443, 230–233 (2006).
Article ADS CAS Google Scholar
Putney, J. W. Jr. New molecular players in capacitative Ca2+ entry. J. Cell Sci. 120, 1959–1965, https://doi.org/10.1242/jcs.03462 (2007).
Article CAS PubMed PubMed Central Google Scholar
Vig, M. et al. CRACM1 is a plasma membrane protein essential for store-operated Ca2+ entry. Sci. 312, 1220–1223 (2006).
Article ADS CAS Google Scholar
Yeromin, A. V. et al. Molecular identification of the CRAC channel by altered ion selectivity in a mutant of Orai. Nat. 443, 226–229, https://doi.org/10.1038/nature05108 (2006).
Article ADS CAS Google Scholar
Zhang, S. L. et al. Store-dependent and -independent modes regulating Ca2+ release-activated Ca2+ channel activity of human Orai1 and Orai3. J. Biol. Chem. 283, 17662–17671, https://doi.org/10.1074/jbc.M801536200 (2008).
Article CAS PubMed PubMed Central Google Scholar
Fahrner, M. et al. Mechanistic view on domains mediating STIM1-Orai coupling. Immunol. Rev. 231, 99–112, https://doi.org/10.1111/j.1600-065X.2009.00815.x (2009).
Article PubMed Google Scholar
Peinelt, C. et al. Amplification of CRAC current by STIM1 and CRACM1 (Orai1). Nat. Cell Biol. 8, 771–773, https://doi.org/10.1038/ncb1435 (2006).
Article CAS PubMed PubMed Central Google Scholar
Penna, A. et al. The CRAC channel consists of a tetramer formed by Stim-induced dimerization of Orai dimers. Nat. 456, 116–120, https://doi.org/10.1038/nature07338 (2008).
Article ADS CAS Google Scholar
Smyth, J. T. et al. Activation and regulation of store-operated calcium entry. J. Cell Mol. Med. 14, 2337–2349, https://doi.org/10.1111/j.1582-4934.2010.01168.x (2010).
Article CAS PubMed PubMed Central Google Scholar
Zhang, S. L. et al. STIM1 is a Ca2+ sensor that activates CRAC channels and migrates from the Ca2+ store to the plasma membrane. Nat. 437, 902–905, https://doi.org/10.1038/nature04147 (2005).
Article ADS CAS Google Scholar
Becchetti, A. & Arcangeli, A. Integrins and ion channels in cell migration: implications for neuronal development, wound healing and metastatic spread. Adv. Exp. Med. Biol. 674, 107–123 (2010).
Article CAS Google Scholar
Burgoyne, R. D. Neuronal calcium sensor proteins: generating diversity in neuronal Ca2+ signalling. Nat. Rev. Neurosci. 8, 182–193, https://doi.org/10.1038/nrn2093 (2007).
Article CAS PubMed PubMed Central Google Scholar
Orrenius, S., Zhivotovsky, B. & Nicotera, P. Regulation of cell death: the calcium-apoptosis link. Nat. Rev. Mol. Cell Biol. 4, 552–565, https://doi.org/10.1038/nrm1150 (2003).
Article CAS PubMed Google Scholar
Roderick, H. L. & Cook, S. J. Ca2+ signalling checkpoints in cancer: remodelling Ca2+ for cancer cell proliferation and survival. Nat. Rev. Cancer 8, 361–375, https://doi.org/10.1038/nrc2374 (2008).
Article CAS PubMed Google Scholar
Salter, R. D. & Watkins, S. C. Dendritic cell altered states: what role for calcium? Immunol. Rev. 231, 278–288, https://doi.org/10.1111/j.1600-065X.2009.00806.x (2009).
Article CAS PubMed Google Scholar
Hwang, D. Y. et al. Genetic polymorphisms of ORAI1 and chronic kidney disease in Taiwanese population. Biomed. Res. Int. 2014, 290863, https://doi.org/10.1155/2014/290863 (2014).
Article CAS PubMed PubMed Central Google Scholar
Shaw, P. J. & Feske, S. Regulation of lymphocyte function by ORAI and STIM proteins in infection and autoimmunity. J. Physiol. 590, 4157–4167, https://doi.org/10.1113/jphysiol.2012.233221 (2012).
Article CAS PubMed PubMed Central Google Scholar
Bergmeier, W., Weidinger, C., Zee, I. & Feske, S. Emerging roles of store-operated Ca(2)(+) entry through STIM and ORAI proteins in immunity, hemostasis and cancer. Channels 7, 379–391, https://doi.org/10.4161/chan.24302 (2013).
Article CAS PubMed PubMed Central Google Scholar
Capiod, T. The need for calcium channels in cell proliferation. Recent. Pat. Anticancer. Drug. Discov. 8, 4–17 (2013).
Article CAS Google Scholar
Courjaret, R. & Machaca, K. STIM and Orai in cellular proliferation and division. Front. Biosci. 4, 331–341 (2012).
Article Google Scholar
Moccia, F. et al. Store-dependent Ca(2+) entry in endothelial progenitor cells as a perspective tool to enhance cell-based therapy and adverse tumour vascularization. Curr. Med. Chem. 19, 5802–5818 (2012).
Article CAS Google Scholar
Prevarskaya, N., Skryma, R. & Shuba, Y. Calcium in tumour metastasis: new roles for known actors. Nat. Rev. Cancer 11, 609–618, https://doi.org/10.1038/nrc3105 (2011).
Article CAS PubMed Google Scholar
Giachelli, C. M. et al. Vascular calcification and inorganic phosphate. Am. J. Kidney Dis. 38, S34–37, https://doi.org/10.1053/ajkd.2001.27394 (2001).
Article CAS PubMed Google Scholar
Moe, S. M. & Chen, N. X. Pathophysiology of vascular calcification in chronic kidney disease. Circ. Res. 95, 560–567, https://doi.org/10.1161/01.RES.0000141775.67189.98 (2004).
Article CAS PubMed Google Scholar
Shioi, A. et al. Beta-glycerophosphate accelerates calcification in cultured bovine vascular smooth muscle cells. Arterioscler. Thromb. Vasc. Biol. 15, 2003–2009, https://doi.org/10.1161/01.atv.15.11.2003 (1995).
Article CAS PubMed Google Scholar
Abdelazeem, K. N. M. et al. Upregulation of Orai1 and STIM1 expression as well as store-operated Ca(2+) entry in ovary carcinoma cells by placental growth factor. Biochem. Biophys. Res. Commun. 512, 467–472, https://doi.org/10.1016/j.bbrc.2019.03.025 (2019).
Article CAS PubMed Google Scholar
Ma, K. et al. Phosphate-induced ORAI1 expression and store-operated Ca(2+) entry in aortic smooth muscle cells. J. Mol. Med. 97, 1465–1475, https://doi.org/10.1007/s00109-019-01824-7 (2019).
Article CAS PubMed Google Scholar
Zhang, S. et al. Epigallocatechin-3-gallate (EGCG) up-regulates miR-15b expression thus attenuating store operated calcium entry (SOCE) into murine CD4+ T cells and human leukaemic T cell lymphoblasts. Oncotarget 8, 89500 (2017).
PubMed PubMed Central Google Scholar
Pelzl, L. et al. Lithium Sensitive ORAI1 Expression, Store Operated Ca(2+) Entry and Suicidal Death of Neurons in Chorea-Acanthocytosis. Sci. Rep. 7, 6457, https://doi.org/10.1038/s41598-017-06451-1 (2017).
Article ADS CAS PubMed PubMed Central Google Scholar
Sukkar, B. et al. Inhibition of Lithium Sensitive Orai1/ STIM1 Expression and Store Operated Ca2+ Entry in Chorea-Acanthocytosis Neurons by NF-kappaB Inhibitor Wogonin. Cell Physiol. Biochem. 51, 278–289, https://doi.org/10.1159/000495229 (2018).
Article CAS PubMed Google Scholar
Schmid, E. et al. SGK3 regulates Ca(2+) entry and migration of dendritic cells. Cell Physiol. Biochem. 30, 1423–1435, https://doi.org/10.1159/000343330 (2012).
Article CAS PubMed PubMed Central Google Scholar
Pelzl, L. et al. Phosphate-induced ORAI1 Expression and Store Operated Ca2+ Entry in Megakaryocytes. Hamostaseologie 39, SY05-02-AB, https://doi.org/10.1055/s-0039-1680097 (2019).

Download references

Acknowledgements

The authors gratefully acknowledge the meticulous preparation of the manuscript by Lejla Subasic. This work has been supported in part by the European Union Seventh Framework Programme (FP7/2007-2013), Systems Biology to Identify Molecular Targets for Vascular Disease Treatment (SysVasc, HEALTH-2013 603288), by grants from the Deutsche Forschungsgemeinschaft (DFG), La315-15 to FL, project number 374031971 – TRR 240 to MG, and Klinische Forschergruppe KFO-274 “Platelets - Molecular Mechanisms and Translational Implications”, from the Council of Scientific & Industrial Research (CSIR-SRF) fellowship, Government of India and Deutscher Akademischer Austauschdienst (DAAD) bi-nationally supervised PhD Fellowship to I.S. HC is supported by the Chinese Scholarship Council, TM and AB by the Deutsche Akademische Austausch-Dienst (DAAD). The study was supported by the Deutsche Forschungsgemeinschaft and Open Access Publishing Fund of Tuebingen University. The sponsor(s) had no role in study design, the collection, analysis and interpretation of data, in the writing of the report, and in the decision to submit the article for publication.

Author information

These authors contributed equally: Lisann Pelzl and Itishri Sahu.

Authors and Affiliations

Transfusion Medicine, Medical Faculty, Eberhard Karl University Tuebingen, Tuebingen, Germany
Lisann Pelzl, Irene Marini, Flaviana Rigoni & Tamam Bakchoul
Department of Internal Medicine III, Eberhard Karl University Tuebingen, Tuebingen, Germany
Itishri Sahu, Ke Ma, David Heinzmann, Abdulla Al Mamun Bhuyan, Tamer al-Maghout, Basma Sukkar, Yamini Sharma, Hang Cao & Meinrad Gawaz
Department of Biochemistry, School of Life Sciences, University of Hyderabad, Hyderabad, 500046, India
Itishri Sahu & Ravi Gutti
Department of Internal Medicine IV, Eberhard Karl University Tuebingen, Tuebingen, Germany
Ferruh Artunc
Institute for Physiology, Johannes Kepler University, Linz, Austria
Jakob Voelkl
DZHK (German Centre for Cardiovascular Research), partner site Berlin, Berlin, Germany
Jakob Voelkl & Burkert Pieske
Department of Nephrology and Medical Intensive Care, Charité University Medicine, Berlin, Germany
Jakob Voelkl
Berlin Institute of Health (BIH), Berlin, and Department of Internal Medicine and Cardiology, German Heart Center Berlin (DHZB), Berlin, Germany
Burkert Pieske
Centre for Clinical Transfusion Medicine, University Hospital of Tuebingen, Tuebingen, Germany
Tamam Bakchoul
Department of Vegetative and Clinical Physiology, Eberhard Karl University Tuebingen, Tuebingen, Germany
Florian Lang
Department of Internal Medicine and Cardiology, Campus Virchow Klinikum, Charité University Medicine, Berlin, Germany
Jakob Voelkl & Burkert Pieske

Authors

Lisann Pelzl
View author publications
You can also search for this author in PubMed Google Scholar
Itishri Sahu
View author publications
You can also search for this author in PubMed Google Scholar
Ke Ma
View author publications
You can also search for this author in PubMed Google Scholar
David Heinzmann
View author publications
You can also search for this author in PubMed Google Scholar
Abdulla Al Mamun Bhuyan
View author publications
You can also search for this author in PubMed Google Scholar
Tamer al-Maghout
View author publications
You can also search for this author in PubMed Google Scholar
Basma Sukkar
View author publications
You can also search for this author in PubMed Google Scholar
Yamini Sharma
View author publications
You can also search for this author in PubMed Google Scholar
Irene Marini
View author publications
You can also search for this author in PubMed Google Scholar
Flaviana Rigoni
View author publications
You can also search for this author in PubMed Google Scholar
Ferruh Artunc
View author publications
You can also search for this author in PubMed Google Scholar
Hang Cao
View author publications
You can also search for this author in PubMed Google Scholar
Ravi Gutti
View author publications
You can also search for this author in PubMed Google Scholar
Jakob Voelkl
View author publications
You can also search for this author in PubMed Google Scholar
Burkert Pieske
View author publications
You can also search for this author in PubMed Google Scholar
Meinrad Gawaz
View author publications
You can also search for this author in PubMed Google Scholar
Tamam Bakchoul
View author publications
You can also search for this author in PubMed Google Scholar
Florian Lang
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

F.L., J.V., B.P., T.B., R.G. and M.G. designed research, L.P., I.S., K.M., D.H., A.B., T.M., I.M., F.R., B.S., Y.S. and H.C. performed experiments, I.S., L.P. and F.L. analysed and interpreted the data; F.L. drafted the manuscript. All authors corrected and approved the manuscript.

Corresponding author

Correspondence to Florian Lang.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

supplementary information.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Pelzl, L., Sahu, I., Ma, K. et al. Beta-Glycerophosphate-Induced ORAI1 Expression and Store Operated Ca²⁺ Entry in Megakaryocytes. Sci Rep 10, 1728 (2020). https://doi.org/10.1038/s41598-020-58384-x

Download citation

Received: 15 April 2019
Accepted: 03 January 2020
Published: 03 February 2020
DOI: https://doi.org/10.1038/s41598-020-58384-x

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.