Correction to: Scientific Reports https://doi.org/10.1038/s41598-019-41202-4, published online 20 March 2019
This article contains an error in the Supplementary Information file in Supplementary Table S1, where the sequence of the I3E4 morpholino contains a duplicated base:
“CGAACAGCTGAACGGCAAAATAAAAC”
should read:
“CGACAGCTGAACGGCAAAATAAAAC”
Author information
Authors and Affiliations
Corresponding author
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Cianciolo Cosentino, C., Berto, A., Pelletier, S. et al. Author Correction: Moderate Nucleoporin 133 deficiency leads to glomerular damage in zebrafish. Sci Rep 10, 756 (2020). https://doi.org/10.1038/s41598-020-57829-7
Published:
DOI: https://doi.org/10.1038/s41598-020-57829-7
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.