Abstract
Through their action on DNA replication, anticancer chemotherapies could increase the basal mutation rate in bacteria and increase the risk of selecting antibiotic resistant mutants. We investigated the impact of several drugs on a beta-lactamase model using KPC-type carbapenemase-producing Enterobacteriaceae. We studied the impact of anticancer chemotherapies used in pediatric hematologic malignancies on 7 clinical isolates of Enterobacteriaceae producing KPC-type carbapenemases. We compared the mutation rates from cultures with/without chemotherapy on ceftazidime-avibactam, rifampicin and ceftazidime-avibactam combined with meropenem media. Mechanisms of ceftazidime-avibactam resistance were explored on a subset of mutants. After exposure to some cytotoxic molecules, the bacterial mutation rates leading to ceftazidime-avibactam and to rifampicin resistance increased up to 104-fold while we observed no emergence of resistant mutants (frequency of <10−10) on a meropenem combined with ceftazidime-avibactam media. Compared to the parental strains, an increased susceptibility to meropenem was observed in the ceftazidime-avibactam resistant mutants. The blaKPC genes of ceftazidime-avibactam mutants harbored either mutations, deletions or insertions, especially in the region encoding the Ω-loop of the KPC-type carbapenemase. Anticancer chemotherapy can increase the mutation rates of bacteria accelerating the extension of KPC-type carbapenemases towards ceftazidime-avibactam, one of the last resort antimicrobial chemotherapy.
Similar content being viewed by others
Introduction
Patients treated with anticancer chemotherapy drugs (ACD) are vulnerable to infectious diseases due to immunosuppression and to the direct impact of ACD on their intestinal microbiota1,2. Some anticancer drugs like mitomycin C are known to have a bacteriostatic or bactericidal effect3,4,5,6 and can also be mutagenic on bacteria3. It is suggested that the dysbiosis can participate to intestinal mucositis7 that enhances the risk of bacterial translocation to the blood, requiring an antibiotic therapy, which may in turn favor the emergence of antibiotic resistant bacteria. The growing carriage of Carbapenem-Resistant Enterobacteriaceae (CRE) increases the risk of invasive infections with these resistant bacteria responsible for a mortality rate over 30%8. Klebsiella pneumoniae carbapenemase (KPC) was described for the first time in 19969. It is now a common carbapenem resistance mechanism among Enterobacteriaceae in the USA, Israel, Asia, Latin America, and South Europe, reaching a prevalence rate of 66.5% among K. pneumoniae isolated in Greece10,11. Carbapenem-resistant K. pneumoniae bacteremia are responsible for 73% of 30-day mortality in cancer patients12. The recent combination ceftazidime-avibactam (CZA) has been approved in 2015 in the USA and in 2016 in Europe13,14. CZA demonstrates excellent in vitro activity against CRE of KPC-type, and is associated with a decreased mortality rate in treated patient8,15. Its efficacy, broad antibacterial spectrum and safety, led to an increase in its use, notably for immunosuppressed patients treated with ACD16. Unfortunately, some mutations in blaKPC or in genes encoding porins lead to resistance to CZA, thus limiting the benefit of this last resort strategy13,17,18. Moreover, several ACD interfere with DNA replication and increase the mutation rate of eukaryotic cells. It has been showed in vitro that anticancer chemotherapy drugs could enhance the emergence of antibiotic-resistant pathogenic bacteria, mostly through activation of the SOS response2,19. The alkylating agent dacarbazine, the topoisomerase inhibitors epirubicin and daunorubicin, and the pyrimidine analogue azacitidine were shown to accelerate the bacterial evolution19. We thus hypothesized that ACD treatment could accelerate the modification of beta-lactamase spectrum and thus the emergence of CZA-resistant mutant in KPC-producing Enterobacteriaceae.
In this study, we investigated the impact of several ACD on beta-lactamase evolution. We chose to evaluate the emergence of CZA-resistant mutants in KPC-producing Enterobacteriaceae. We subsequently evaluated an antimicrobial combination to limit the emergence of resistant mutants to this last resort antibiotic. Last, we sequenced and cloned the blaKPC genes of the CZA-resistant mutants to identify the mutations accounting for the enhance resistance to CZA.
Results
Mutation rate
The culture of Enterobacter cloacae KPC-3 (RD26) and E. coli KPC-2 (RD29) with ACD modified the frequency of resistant mutants to CZA and rifampicin in a variable manner depending on the isolates and the cytotoxic molecules. Resistance to rifampicin is a classical model used to evaluate mutation rates20,21. Control conditions without chemotherapy molecule showed that the strains have a normal mutational rate against rifampicin20. Compared to the control culture without ACD, the frequency of emergence of rifampicin-resistant mutants and of CZA-resistant mutants increased up to 104 and to 103 after exposure to some cytotoxic molecules (Fig. 1 and Supplementary Table S1).
In details, the frequency of emergence of CZA-resistant mutants from E. cloacae RD26 significantly increased after incubation with azacitidine (p = 0.0006), dacarbazine (p = 0.003), and mitoxantrone (p = 0.008). Azacitidine had the highest impact on mutation rates with an increase up to 103-fold. Dacarbazine (p = 0.002) and mitoxantrone (p = 0.04) significantly increased the frequency of CZA-resistant mutants from E. coli KPC-2 (isolate RD29), up to 103-fold increase for dacarbazine (Supplementary Table S2).
Dacarbazine increased the rate of rifampicin-resistant mutants (p = 0.005), with a maximum of 104-fold increase (Supplementary Tables S1 and S2) for E. coli RD29. Azacitidine also had a significant impact for both strains (p = 0.001 for E. cloacae RD26, and p = 0.003 for E. coli RD29) (Supplementary Tables S1 and S2) while mitoxantrone, cyclophosphamide, daunorubicin, mercaptopurine and cytarabine had no significant effect.
Concerning meropenem, whatever the ACD used with the RD26 isolate, no mutation rate could be determined since confluent growth was observed at the concentration used. However, no resistant mutant was observed on the medium with CZA combined with meropenem and therefore the mutation rate is <10−10 (Supplementary Tables S1 and S2).
Confirmation of the ACD impact on the mutation rate with azacitidine as an example, on 5 other strains
In order to evaluate the capability of ACD, and especially azacitidine which is one of the most used molecules in pediatric hematologic malignancies, to increase mutation rate of different species or isolates, five non-related clinical isolates of different sequence types of K. pneumoniae (Supplementary Tables S3 and S4) were tested against azacitidine 0.5 mg/L. Similar results with increased frequencies of rifampicin- and CZA-resistant mutants were observed but no resistant mutant on the medium combining meropenem and CZA.
Confirmation of the ACD impact on the MIC increase by comparing parental isolates with transformants
The MICs of CZA on nine CZA-resistant mutants derivatives of RD26 selected randomly were 4- to 16-times higher than that of their parental isolate. This resulted in some MICs incompatible with therapeutic use. In contrast, the meropenem MIC decreased subsequently, from 16 mg/L with the parental isolate to 0.094–2 mg/L in the CZA-resistant mutants. The MIC of meropenem combined with CZA stayed very low (≤0.064 mg/L). MICs of CZA, meropenem, and meropenem/CZA performed on E. coli Top 10 carrying the blaKPC genes borne in the plasmid pBR322 gave similar results. A similar level of blaKPC mRNA transcription was observed for the recombinant mutants compared to their recombinant parental strain (Supplementary Table 5) suggesting similar KPC expression. Resistance to CZA was therefore very likely to be due to blaKPC gene alteration (Table 1). To explore the blaKPC gene mutation, we sequenced it in these nine RD26 CZA-resistant mutants as well as in seven transformants of E. coli. These revealed eithers point mutations, deletions, or insertions in the region of the omega-loop of the KPC (Table 1). Indeed, two mutants carried the mutation R164P, two mutants were mutated in position 179 (D179H and D179Y), and one mutant carried the mutation T243M. We also observed mutations leading to the insertion of 5 amino acids (SAIPG) between G175 and D176, of three amino acids (DDK) between K273 and Y274 and to the deletions of three amino acids (ARD) between D176 and T180 and of two amino acids (GV) between C238 and Y241 (Table 1).
Discussion
We showed here that certain ACD can stimulate the bacterial mutagenesis and can lead to mutations in blaKPC. Some of these mutations were previously shown to increase the catalytic efficiency of KPC towards ceftazidime resulting in the failure of ceftazidime-avibactam22,23.
Anticancer drugs can have genotoxic effects24 and thus stress the bacteria, through their impact on DNA and cell division. Stress activates the SOS response that increases the mutation rates of bacteria19,21,25. CZA may offer a significant advance over antimicrobials agents which may keep in vitro activity against CRE, such as colistin, fosfomycin, and tigecycline but which are limited by concerns over efficiency and/or toxicity16. Although CZA is considered as one of the last resort treatment in case of infection with KPC-producing strains8 its use may lead to the selection of resistant mutants in patients15,17. Reports on the emergence of CZA-resistant CRE soon after its launch led to the publication of a worrying report on rapid risk assessment in June 2018 by the European Centre for Disease prevention and Control26.
In this study, we observed that when bacteria are incubated with certain ACD such as azacitidine or dacarbazine, the increase frequency of resistant mutants (up to 10−6) and their high MIC to CZA are particularly worrying as it could lead to the treatment’s failure in case of severe infection.
As E. cloacae RD26 was not susceptible to meropenem, CZA would have been an option for the treatment in case of infection. Hence, we observed confluent growth on the medium containing meropenem at therapeutic concentration. A valuable result to point out is the absence of selection of cross-resistant mutants to the association CZA-meropenem. Indeed, whatever the mutation rate after a culture with ACD and selection on antibiotic medium, we found no emergence of resistance to this association at threshold detection of 10−10. This is of importance as it widens the therapeutic possibilities to reduce the risk of selection of resistant mutants. Avibactam protects meropenem from hydrolysis by the KPC ß-lactamase and restores the ceftazidime activity in the case of production of ESBL or AmpC ß-lactamases. Furthermore, a tradeoff between carbapenemase activity and resistance to CZA has already been described and was confirmed by our MIC results (Table 1) suggesting that the association meropenem with CZA is an optimal therapy to counteract the carbapenemase activity of the KPC ß-lactamase, and enables the meropenem and ceftazidime activity15,22,23,27,28,29. The association of meropenem and vaborbactam is promising but not yet available worldwide.
The sequencing of blaKPC of CZA-resistant mutants identified point mutations, insertions, or deletions. Some of these have already been described after in vivo or in vitro selection13,27,30. These include mutations in position 164 and 179 which are located in the Ω-loop of this class A ß-lactamase. The Ω-loop (residues 164–179) is a hot spot for substitutions that extend the substrate spectrum of many class A enzymes. It contains Glu166 and Asn170, two essential residues required for priming a water molecule for deacylation of the ß-lactam. Mutations in the Ω-loop can modify salt bridge (in particular between Arg164 and Asp179) and thus enhances the flexibility of the loop allowing a better binding and hydrolysis of ceftazidime. Similarly, insertions or deletions that occur in the Ω-loop modify its structure and steric bulk22,23,29 and thus modify the access of ceftazidime. The effect of methionine for threonine substitution at position 243 is unclear27 as well as deletions of 2 amino acids (GV) between C238 and Y241. Due to the proximity with β3-strand (positions 234 to 242), these mutations could increase flexibility of the β3 strand and allow the aminothiazole ring of ceftazidime to sink deeper into the active site upon binding. Finally, the effect of the insertion of 3 amino-acid (DDK) between positions 273 and 274 is not known, but its spatial proximity to the active site is probably significant31.
Given the high mutation rates and potential clinical implications of therapeutic failure, it seems therefore reasonable to consider an association such as CZA with meropenem in the event of treatment of a severe infection by a KPC-producing Enterobacteriaceae in a patient treated with ACD and especially with dacarbazine, azacitidine, and mitoxantrone.
One of the biggest difficulties in carrying out this study was to choose the concentrations of chemotherapy molecules. Indeed, there are few data on therapeutic concentrations in pediatrics and to our knowledge none on concentrations obtained in stool. We therefore chose concentrations compatible with the blood concentrations19,32,33. We hypothesized that the diffusion of ACD in the intestinal compartment could increase the diversity of intestinal microbial population by modifying the basal mutation rate. Resistant mutants can then be selected after an antibiotic treatment, even not administered concomitantly with the ACD treatment. This remains to be evaluated in vivo.
In conclusion, using two KPC-producing Enterobacteriaceae strains as a model, we found that in vitro incubation with certain ACD (i.e. azacitidine, dacarbazine, mitoxantrone) enhance the bacterial mutagenesis and the subsequent emergence of antibiotic-resistant mutants. We confirmed the capability of azacitidine to generate high rates of mutants on five different sequence types of KPC-producing K. pneumoniae. Further studies including a larger number of bacterial isolates and cytotoxic molecules should be considered as well as in vivo assays.
Considering the rapid evolution of antibiotic resistance and the importance of beta-lactams in therapeutic arsenal, it seems essential to identify all factors that contribute to the evolution of antimicrobial resistance. Using KPC beta-lactamase, our study is an in vitro example that some ACD can increase mutational rate leading to CZA resistance. This observation challenges the therapeutic management of patients when dealing with KPC-type carbapenemase producing Enterobacteriaceae.
Methods
Bacterial isolates
In a first part, we studied two multiresistant Enterobacteriaceae producing KPC-type carbapenemases: a clinical isolate of Enterobacter cloacae harboring blaKPC-3 (RD26) and of Escherichia coli harboring blaKPC-2 (RD29). MICs determined by the E-test® method (bioMérieux, France) on Mueller Hinton agar (MHA) were of 16, and 0.25 mg/L for meropenem, and 4 and 0.5 mg/L for CZA for RD26 and RD29, respectively.
In a second part, we studied five multiresistant KPC-producing K. pneumoniae clinical isolates: RD27 (blaKPC-3), DD34 (blaKPC-2), DD36 (blaKPC-2), DD37 (blaKPC-2), and DD38 (blaKPC-3) whose MIC to meropenem were of >32, 6, 16, 6, and 1 mg/L and to CZA of 8, 4, 2, 1, and 4 mg/L respectively.
Genome sequencing and analysis
The DNA of all isolates was extracted using the MOBIO kit (Qiagen) after an overnight growth in Luria-Bertani (LB) broth. The Nextera XT kit (Illumina, San Diego, California, USA) was used to prepare libraries. Sequencing was performed on a MiniSeq 2 × 150 cycles (Illumina technology). The SPAdes assembler was used to construct assemblies. Contigs <500 bp were removed. We performed multilocus sequence typing (MLST)34, identification of acquired resistance genes by using ResFinder 3.035 and SerotypeFinder 1.136.
The quality of the sequencing data was estimated using standard metrics. Mean N50 was of 266,195 bp and mean coverage was of 84. Quality sequencing data are summarized in Supplementary Table S4. Raw sequences of the 7 isolates were deposited in GenBank under BioProject number: PRJNA542787. Whole genome sequencing shows that E. coli was of ST131 and serotype O16 and had both blaKPC-2 and blaTEM-1, E. cloacae had the blaKPC-3, blaOXA-9 and blaTEM-1 and the 5 K. pneumoniae were respectively of ST-258, ST-11, ST-101, ST-307 and ST-512 and produced either blaKPC-2 or blaKPC-3 (Supplementary Table S4).
Determination of mutant frequencies
Mid-log cultures of either E. coli RD29 or E. cloacae RD26 in MH broth was diluted to 10−4 and cultured overnight with and without ACD. We evaluated seven ACD used in pediatric hematologic malignancies at concentrations close to the plasmatic concentrations33. The pyrimidine antagonist cytarabine was used at 0.5 mg/L37. The two antimetabolites azacitidine and mercaptopurine were used at 0.5 and 30 mg/L, respectively38,39. The two alkylating drugs cyclophosphamide and dacarbazine were used at 2.5 and 10 mg/L40,41,42. The topoisomerase inhibitor daunorubicin was used at 50 mg/L37. The anthracenedione mitoxantrone was used at 5 mg/L43.
We evaluated the basal mutation rate of the tested bacteria by plating appropriate dilutions of overnight cultures on MHA and MHA containing rifampicin (RMP) at 50 mg/L. The frequency of emergence of antibiotic-resistant mutants was calculated20,21 by plating overnight cultures on MHA and MHA containing 4 MIC of CZA (4:1 ratio) or meropenem (20 mg/l). We also evaluated the frequency of emergence of E. cloacae resistant to the combination CZA (4 MIC) – meropenem (MEM) 20 mg/l. This concentration of meropenem is compatible with the serum concentration obtained by continuous infusion of meropenem and above the MIC of the isolates44. All tests were done four times independently. In order to confirm and extend our results, five KPC-producing clinical isolates of K. pneumoniae of different ST were submitted to azacitidine on five independent experiments. The frequency of resistant mutants was then calculated as the number of resistant colonies divided by the number of plated cells. The results are expressed as the ratios of the mutant frequency with ACD on mutant frequency without ACD.
MIC determination
MICs against CZA, MEM and MEM in combination with CZA were assessed with the E-test® method (bioMérieux, France) according the manufacturer’s recommendations. To determine the MIC of MEM combined to CZA, one CZA strip was placed on MHA for 30 min, then removed, and a MEM strip was placed on top of the gradient of the CZA45. The value at which the inhibition zone intersected the scale on the MEM E-test strip was considered as the MIC of MEM combined to CZA.
Identification of mutations involved in the resistance to CZA
To identify the mutations leading to the resistance to CZA, blaKPC of nine randomly selected mutants was PCR amplified using a high-fidelity polymerase (Pfu DNA polymerase) and sequenced with the primers KPC-F (5′ TCACTGTATCGCCGTCTAGTTCT-3′) and KPC-R (5′-ATCCCTCGAGCGCGAGTCTA-3′). (We did not search for mutations in the other bla genes that were present, nor in PBP’s (likely PBP3) that may also contribute to our results).
Construction of plasmids expressing blaKPC-3 and derivatives
pBR322 plasmid was used as template for PCR amplification of the whole plasmid except blaTEM using specific primers that also contained overlapping regions of 5′ and 3′ regions of blaKPC (for subsequent Gibson Assembly) of RD26 isolate. blaKPC was PCR amplified from the DNA extracts of RD26 and some of its CZA-resistant derivatives (RD26-2, -3, -5, -6, -7, -8, and -9) with specific primers that also contained overlapping regions of 5′ and 3′ regions of pBR322 plasmid. PCR products were purified with a 1-h digestion with DpnI enzyme to remove the matrix DNA and by a gel purification (QIAquick Gel Extraction Kit, Qiagen). Resulting DNA was quantified using Qubit™ dsDNA HS Assay Kit (Thermofisher). Gibson reaction was carried out using a molar ratio of 1:1 backbone: insert in a total of 20 µl reaction mix and incubated at 50 °C for 1 hour.
The total volume of Gibson reaction was dialysed against distilled water for 30 min. One µl was then electroporated in 15 µl of One Shot™ TOP10 Electrocomp™ E. coli (Invitrogen) and then incubated in 500 µl of LB broth for 1 hour at 37 °C with shaking at 250 rpm. The transformants were plated on LB agar plates containing 10 mg/l tetracycline and further incubated overnight at 37 °C. Transformants obtained were PCR amplified using a high-fidelity Pfu DNA polymerase and sequenced with the primers pbr322-KPC-F GTCTGACAGTTACTGCCCGTTGA and pbr322-KPC-R AGGAAGAGTATGTCACTGTATCGCC.
Quantitative reverse transcription-PCR (RT-PCR)
RNA from a Mueller Hinton broth culture was extracted with the Direct-zol RNA kit followed by a DNAse treatment (zymoresearch, Irvine, USA) as specified by the manufacturer.
Transcriptome analysis was performed using 10 ng of total RNA on 3 genes: blaKPC, dinB a previously described housekeeping gene used for normalization46 and tetA, a pBR322 plasmidic gene coding for tetracyclin resistance also used for normalization. We used the following primers: KPC (F-CGCGGAACCATTCGCTAAAC, R-AGCCCTTGAATGAGCTGCAC), dinB (F-GCGCGATATCCCTATTGCTA, R-AGGCTTCTTTGTAGGCGTCA)47 and tetA (F- ATGCAGGAGTCGCATAAGGGAG, R- TCGCCGAAAATGACCCAGAG). The KAPA SYBR® FAST One-Step kit was used for PCR. Reverse transcription and amplification were performed with an LC480 Light Cycler (Roche®) in one step with the following cycling parameters: 30 min at 42 °C for reverse transcription, 3 minutes at 95 °C for reverse transcriptase inactivation and Taq activation followed by 45 cycles of 10 seconds at 95 °C, 20 seconds at 64 °C and 1 second at 72 °C. Assays were performed in triplicates. The cycle threshold (Ct) was automatically determined by using the Second Derivative Maximum Method included in the LC480 software. For each isolate, a mean Ct was calculated using the 3 replicates. The fold change in gene expression comparing mutants and pBR322-RD26 was calculated by using the 2−ΔΔCt method48.
Statistical analysis
The mutants frequencies were analyzed with the Fluctuation AnaLysis CalculatOR (FALCOR)49 program. We used the Ma-Sandri-Sarkar Maximum Likelihood Estimator (MSS-MLE) method; validated in low replication models50; followed by a Student’s t-test to conduct the statistical analysis. The chosen significance threshold was 0.05 for all tests.
Accession numbers
Whole genome sequencing data were submitted to NCBI under SRA accession: PRJNA542787. blaKPC genes were submitted to GenBank under accession numbers: RD26-3 MN091856; RD26-6 MN091857; RD26-7 MN091858; RD26-9 MN091859.
Data availability
All data generated or analysed during this study are included in this published article (and its Supplementary Information Files).
References
van Vliet, M. J. et al. Chemotherapy treatment in pediatric patients with acute myeloid leukemia receiving antimicrobial prophylaxis leads to a relative increase of colonization with potentially pathogenic bacteria in the gut. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 49, 262–270 (2009).
Papanicolas, L. E., Gordon, D. L., Wesselingh, S. L. & Rogers, G. B. Not Just Antibiotics: Is cancer chemotherapy driving antimicrobial resistance? Trends Microbiol. 26, 393–400 (2018).
Michel, J., Jacobs, J. Y. & Sacks, T. Bactericidal effect of combinations of antimicrobial drugs and antineoplastic antibiotics against gram-negative bacilli. Antimicrob. Agents Chemother. 16, 761–766 (1979).
Nyhlén, A., Ljungberg, B., Nilsson-Ehle, I. & Odenholt, I. Bactericidal effect of combinations of antibiotic and antineoplastic agents against Staphylococcus aureus and Escherichia coli. Chemotherapy 48, 71–77 (2002).
Jacobs, J. Y., Michel, J. & Sacks, T. Bactericidal effect of combinations of antimicrobial drugs and antineoplastic antibiotics against Staphylococcus aureus. Antimicrob. Agents Chemother. 15, 580–586 (1979).
Moody, M. R. et al. Effect of two cancer chemotherapeutic agents on the antibacterial activity of three antimicrobial agents. Antimicrob. Agents Chemother. 14, 737–742 (1978).
van Vliet, M. J., Harmsen, H. J. M., de Bont, E. S. J. M. & Tissing, W. J. E. The role of intestinal microbiota in the development and severity of chemotherapy-induced mucositis. PLoS Pathog. 6, e1000879 (2010).
Tumbarello, M. et al. Efficacy of ceftazidime-avibactam salvage therapy in patients with infections caused by KPC-producing Klebsiella pneumoniae. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am., https://doi.org/10.1093/cid/ciy492 (2018).
Yigit, H. et al. Novel carbapenem-hydrolyzing β-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob. Agents Chemother. 45, 1151–1161 (2001).
Logan, L. K. & Weinstein, R. A. The epidemiology of carbapenem-resistant Enterobacteriaceae: The impact and evolution of a global menace. J. Infect. Dis. 215, S28–S36 (2017).
Nordmann, P., Naas, T. & Poirel, L. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg. Infect. Dis. 17, 1791–1798 (2011).
Freire, M. P. et al. Infection with Klebsiella pneumoniae carbapenemase (KPC)-producing Klebsiella pneumoniae in cancer patients. Eur. J. Clin. Microbiol. Infect. Dis. Off. Publ. Eur. Soc. Clin. Microbiol. 34, 277–286 (2015).
Livermore, D. M. et al. In vitro selection of ceftazidime-avibactam resistance in Enterobacteriaceae with KPC-3 carbapenemase. Antimicrob. Agents Chemother. 59, 5324–5330 (2015).
Mosley, J. F. et al. Ceftazidime-avibactam (Avycaz). Pharm. Ther. 41, 479–483 (2016).
Pogue, J. M., Bonomo, R. A. & Kaye, K. S. Ceftazidime/avibactam, Meropenem/vaborbactam or both? Clinical and formulary considerations. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am., https://doi.org/10.1093/cid/ciy576 (2018).
Castón, J. J. et al. Clinical efficacy of ceftazidime/avibactam versus other active agents for the treatment of bacteremia due to carbapenemase-producing Enterobacteriaceae in hematologic patients. Int. J. Infect. Dis. IJID Off. Publ. Int. Soc. Infect. Dis. 59, 118–123 (2017).
Shields, R. K. et al. Clinical outcomes, drug toxicity, and emergence of ceftazidime-avibactam resistance among patients treated for carbapenem-resistant Enterobacteriaceae infections. Clin. Infect. Dis. 63, 1615–1618 (2016).
Gaibani, P. et al. In vivo evolution of resistant subpopulations of KPC-producing Klebsiella pneumoniae during ceftazidime/avibactam treatment. J. Antimicrob. Chemother. 73, 1525–1529 (2018).
Meunier, A. et al. Enhanced emergence of antibiotic-resistant pathogenic bacteria after in vitro induction with cancer chemotherapy drugs. J. Antimicrob. Chemother. 74, 1572–1577 (2019).
Matic, I. et al. Highly variable mutation rates in commensal and pathogenic Escherichia coli. Science 277, 1833–1834 (1997).
Bjedov, I. et al. Stress-induced mutagenesis in bacteria. Science 300, 1404–1409 (2003).
Barnes, M. D. et al. Klebsiella pneumoniae carbapenemase-2 (KPC-2), Substitutions at ambler position Asp179, and resistance to ceftazidime-avibactam: unique antibiotic-resistant phenotypes emerge from β-lactamase protein engineering. mBio 8 (2017).
Winkler, M. L., Papp-Wallace, K. M. & Bonomo, R. A. Activity of ceftazidime/avibactam against isogenic strains of Escherichia coli containing KPC and SHV β-lactamases with single amino acid substitutions in the Ω-loop. J. Antimicrob. Chemother. 70, 2279–2286 (2015).
Toolaram, A. P., Kümmerer, K. & Schneider, M. Environmental risk assessment of anti-cancer drugs and their transformation products: A focus on their genotoxicity characterization-state of knowledge and short comings. Mutat. Res. Rev. Mutat. Res. pii: S1383-5742, 00003–00009 (2014).
Tenaillon, O., Denamur, E. & Matic, I. Evolutionary significance of stress-induced mutagenesis in bacteria. Trends Microbiol. 12, 264–270 (2004).
Rapid risk assessment: Emergence of resistance to ceftazidime-avibactam in carbapenem-resistant Enterobacteriaceae, http://ecdc.europa.eu/en/publications-data/rapid-risk-assessment-emergence-resistance-ceftazidime-avibactam-carbapenem (2018).
Haidar, G. et al. Mutations in blaKPC-3 that confer ceftazidime-avibactam resistance encode novel KPC-3 variants that function as extended-spectrum β-lactamases. Antimicrob. Agents Chemother. 61, e02534–16 (2017).
Compain, F. & Arthur, M. Impaired inhibition by avibactam and resistance to the ceftazidime-avibactam combination due to the D179Y substitution in the KPC-2 β-lactamase. Antimicrob. Agents Chemother. 61, e00451–17 (2017).
Petrosino, J. F. & Palzkill, T. Systematic mutagenesis of the active site omega loop of TEM-1 beta-lactamase. J. Bacteriol. 178, 1821–1828 (1996).
Shields, R. K. et al. In vitro selection of meropenem resistance among Ceftazidime-Avibactam-resistant, Meropenem-susceptible Klebsiella pneumoniae isolates with variant KPC-3 carbapenemases. Antimicrob. Agents Chemother. 61, e00079–17 (2017).
Naas, T., Dortet, L. & Iorga, B. I. Structural and Functional Aspects of Class A Carbapenemases. Curr. Drug Targets 17, 1006–1028 (2016).
Liston, D. R. & Davis, M. Clinically relevant concentrations of anticancer drugs: a guide for nonclinical studies. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 23, 3489–3498 (2017).
Evans, W. E. et al. Pharmacokinetics of anticancer drugs in children. Drug Metab. Rev. 14, 847–886 (1983).
Wirth, T. et al. Sex and virulence in Escherichia coli: an evolutionary perspective. Mol. Microbiol. 60, 1136–1151 (2006).
Zankari, E. et al. Identification of acquired antimicrobial resistance genes. J. Antimicrob. Chemother. 67, 2640–2644 (2012).
Joensen, K. G., Tetzschner, A. M. M., Iguchi, A., Aarestrup, F. M. & Scheutz, F. Rapid and easy in silico serotyping of Escherichia coli isolates by use of whole-genome sequencing data. J. Clin. Microbiol. 53, 2410–2426 (2015).
Carol, H. et al. Efficacy of CPX-351, (cytarabine:daunorubicin) liposome injection, against acute lymphoblastic leukemia (ALL) xenograft models of the Pediatric Preclinical Testing Program. Pediatr. Blood Cancer 62, 65–71 (2015).
Laille, E. et al. Pharmacokinetics of different formulations of oral azacitidine (CC-486) and the effect of food and modified gastric pH on pharmacokinetics in subjects with hematologic malignancies. J. Clin. Pharmacol. 54, 630–639 (2014).
Lönnerholm, G., Kreuger, A., Lindström, B. & Myrdal, U. Oral mercaptopurine in childhood leukemia: influence of food intake on bioavailability. Pediatr. Hematol. Oncol. 6, 105–112 (1989).
Baudry, E. et al. Cyclophosphamide dose adjustment based on body weight and albuminemia in elderly patients treated with R-mini-CHOP. Cancer Chemother. Pharmacol. 83, 775–785 (2019).
Struck, R. F. et al. Plasma Pharmacokinetics of Cyclophosphamide and Its Cytotoxic Metabolites after Intravenous versus Oral Administration in a Randomized, Crossover Trial. Cancer Res. 47, 2723–2726 (1987).
Brendel, E. et al. Pharmacokinetic results of a phase I trial of sorafenib in combination with dacarbazine in patients with advanced solid tumors. Cancer Chemother. Pharmacol. 68, 53–61 (2011).
Richard, B. et al. Pharmacokinetics of mitoxantrone in cancer patients treated by high-dose chemotherapy and autologous bone marrow transplantation. Br. J. Cancer 65, 399–404 (1992).
Thalhammer, F. et al. Continuous infusion versus intermittent administration of meropenem in critically ill patients. J. Antimicrob. Chemother. 43, 523–527 (1999).
Bingen, E. et al. In vitro interaction between cefixime and amoxicillin-clavulanate against extended-spectrum-beta-lactamase-producing Escherichia coli causing urinary tract infection. J. Clin. Microbiol. 50, 2540–2541 (2012).
Le Gall, T., Darlu, P., Escobar-Páramo, P., Picard, B. & Denamur, E. Selection-driven transcriptome polymorphism in Escherichia coli/Shigella species. Genome Res. 15, 260–268 (2005).
Lemaître, C., Bidet, P., Bingen, E. & Bonacorsi, S. Transcriptional analysis of the Escherichia coli ColV-Ia plasmid pS88 during growth in human serum and urine. BMC Microbiol. 12, 115 (2012).
Schmittgen, T. D. & Livak, K. J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101–1108 (2008).
Hall, B. M., Ma, C.-X., Liang, P. & Singh, K. K. Fluctuation analysis CalculatOR: a web tool for the determination of mutation rate using Luria-Delbruck fluctuation analysis. Bioinforma. Oxf. Engl. 25, 1564–1565 (2009).
Couce, A. & Blázquez, J. Estimating mutation rates in low-replication experiments. Mutat. Res. Mol. Mech. Mutagen. 714, 26–32 (2011).
Acknowledgements
We thank Hervé Jacquier for his careful reading of the manuscript. This work was supported by the “Fondation ARC, pour la Recherche pour le Cancer” [Grant No. M2R20170505715]. The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication. This study was partially supported by a grant from the ‘Fondation pour la Recherche Médicale’ to Erick Denamur (Equipe FRM 2016, Grant Number DEQ. 20161136698).
Author information
Authors and Affiliations
Contributions
C.A.H. and A.Bi. performed all experiments. S.B., D.H., A.Ba., M.F., T.S., R.T., C.D., O.T. made critical revisions and arguments for the paper. C.A.H., S.B., D.H., O.T. and A.Bi. analyzed the results and wrote the manuscript. All authors reviewed and approved the final manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Hobson, C.A., Bonacorsi, S., Hocquet, D. et al. Impact of anticancer chemotherapy on the extension of beta-lactamase spectrum: an example with KPC-type carbapenemase activity towards ceftazidime-avibactam. Sci Rep 10, 589 (2020). https://doi.org/10.1038/s41598-020-57505-w
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41598-020-57505-w
This article is cited by
-
The interplay between anticancer challenges and the microbial communities from the gut
European Journal of Clinical Microbiology & Infectious Diseases (2022)
Comments
By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.