Abstract

Understanding how distributed neuronal circuits integrate sensory information and generate behavior is a central goal of neuroscience. However, it has been difficult to study neuronal networks at single-cell resolution across the entire adult brain in vertebrates because of their size and opacity. We address this challenge here by introducing the fish Danionella translucida to neuroscience as a potential model organism. This teleost remains small and transparent even in adulthood, when neural circuits and behavior have matured. Despite having the smallest known adult vertebrate brain, D. translucida displays a rich set of complex behaviors, including courtship, shoaling, schooling, and acoustic communication. In order to carry out optical measurements and perturbations of neural activity with genetically encoded tools, we established CRISPR–Cas9 genome editing and Tol2 transgenesis techniques. These features make D. translucida a promising model organism for the study of adult vertebrate brain function at single-cell resolution.

Access optionsAccess options

Rent or Buy article

Get time limited or full article access on ReadCube.

from$8.99

All prices are NET prices.

Data availability

Anatomical datasets are available at a GIN repository provided by the German Neuroinformatics Node22 at https://doid.gin.g-node.org/230a07ec2dd35f087f152e6e83a81e4b. Sequence alignment data have been deposited in the NCBI SRA database with the accession number SRP136594.

Additional information

Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  1. 1.

    Betzig, E. et al. Imaging intracellular fluorescent proteins at nanometer resolution. Science 313, 1642–1645 (2006).

  2. 2.

    Bouchard, M. B. et al. Swept confocally-aligned planar excitation (SCAPE) microscopy for high speed volumetric imaging of behaving organisms. Nat. Photonics 9, 113–119 (2015).

  3. 3.

    Tian, L. et al. Imaging neural activity in worms, flies and mice with improved GCaMP calcium indicators. Nat. Methods 6, 875–881 (2009).

  4. 4.

    Chen, T.-W. et al. Ultrasensitive fluorescent proteins for imaging neuronal activity. Nature 499, 295–300 (2013).

  5. 5.

    Packer, A. M., Roska, B. & Häusser, M. Targeting neurons and photons for optogenetics. Nat. Neurosci. 16, 805–815 (2013).

  6. 6.

    Ji, N., Freeman, J. & Smith, S. L. Technologies for imaging neural activity in large volumes. Nat. Neurosci. 19, 1154–1164 (2016).

  7. 7.

    Chan, K. Y. et al. Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems. Nat. Neurosci. 20, 1172–1179 (2017).

  8. 8.

    Friedrich, R. W., Jacobson, G. A. & Zhu, P. Circuit neuroscience in zebrafish. Curr. Biol. 20, R371–R381 (2010).

  9. 9.

    O’Malley, D. M., Kao, Y. H. & Fetcho, J. R. Imaging the functional organization of zebrafish hindbrain segments during escape behaviors. Neuron 17, 1145–1155 (1996).

  10. 10.

    Orger, M. B., Kampff, A. R., Severi, K. E., Bollmann, J. H. & Engert, F. Control of visually guided behavior by distinct populations of spinal projection neurons. Nat. Neurosci. 11, 327–333 (2008).

  11. 11.

    Ahrens, M. B. et al. Brain-wide neuronal dynamics during motor adaptation in zebrafish. Nature 485, 471–477 (2012).

  12. 12.

    Panier, T. et al. Fast functional imaging of multiple brain regions in intact zebrafish larvae using selective plane illumination microscopy. Front. Neural Circuits 7, 65 (2013).

  13. 13.

    Portugues, R., Feierstein, C. E., Engert, F. & Orger, M. B. Whole-brain activity maps reveal stereotyped, distributed networks for visuomotor behavior. Neuron 81, 1328–1343 (2014).

  14. 14.

    Dunn, T. W. et al. Brain-wide mapping of neural activity controlling zebrafish exploratory locomotion. eLife 5, e12741 (2016).

  15. 15.

    Naumann, E. A. et al. From whole-brain data to functional circuit models: the zebrafish optomotor response. Cell 167, 947–960 (2016).

  16. 16.

    Hildebrand, D. G. C. et al. Whole-brain serial-section electron microscopy in larval zebrafish. Nature 545, 345–349 (2017).

  17. 17.

    Roberts, T. R. Danionella translucida, a new genus and species of cyprinid fish from Burma, one of the smallest living vertebrates. Environ. Biol. Fishes 16, 231–241 (1986).

  18. 18.

    Britz, R. Danionella mirifica, a new species of miniature fish from the upper Myanmar (Ostariophysi: Cyprinidae). Ichthyol. Explor. Freshw. 14, 217–222 (2003).

  19. 19.

    Britz, R. Danionella priapus, a new species of miniature cyprinid fish from West Bengal, India (Teleostei: Cypriniformes: Cyprinidae). Zootaxa 2277, 53–60 (2009).

  20. 20.

    Britz, R., Conway, K. W. & Rüber, L. Spectacular morphological novelty in a miniature cyprinid fish, Danionella dracula n. sp. Proc. Biol. Sci. 276, 2179–2186 (2009).

  21. 21.

    Britz, R. & Conway, K. W. Danionella dracula, an escape from the cypriniform Bauplan via developmental truncation? J. Morphol. 277, 147–166 (2015).

  22. 22.

    Schulze, L. et al. Dataset: transparent Danionella translucida as a genetically tractable vertebrate brain model. G-Node https://doid.gin.g-node.org/230a07ec2dd35f087f152e6e83a81e4b/ (2018).

  23. 23.

    Hinsch, K. & Zupanc, G. K. H. Generation and long-term persistence of new neurons in the adult zebrafish brain: a quantitative analysis. Neuroscience 146, 679–696 (2007).

  24. 24.

    Bauchot, M. L., Ridet, J. M. & Diagne, M. Encephalization in Gobioidei (Teleostei). Gyoruigaku Zasshi 36, 63–74 (1989).

  25. 25.

    van Dongen, P. A. M. in The Central Nervous System of Vertebrates (eds Nieuwenhuys, R., ten Donkelaar, H. J. & Nicholson, C.) 2099–2134 (Springer, Berlin, Heidelberg, 1998).

  26. 26.

    Pitcher, T. J. The Behaviour of Teleost Fishes (Springer Science & Business Media, Berlin, Heidelberg, 2012).

  27. 27.

    Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome. Biol. 8, S7 (2007).

  28. 28.

    Rupprecht, P., Prendergast, A., Wyart, C. & Friedrich, R. W. Remote z-scanning with a macroscopic voice coil motor for fast 3D multiphoton laser scanning microscopy. Biomed. Opt. Express 7, 1656–1671 (2016).

  29. 29.

    Jao, L.-E., Wente, S. R. & Chen, W. Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc. Natl Acad. Sci. USA 110, 13904–13909 (2013).

  30. 30.

    Di Donato, V. et al. 2C-Cas9: a versatile tool for clonal analysis of gene function. Genome Res. 26, 681–692 (2016).

  31. 31.

    Bradbury, J. W. & Vehrencamp, S. L. Principles of Animal Communication (Sinauer Associates, Sunderland, MA, 2011).

  32. 32.

    Parmentier, E. & Fine, M. L. in Vertebrate Sound Production and Acoustic Communication (eds Suthers, R. A. et al.) 19–49 (Springer, Cham, 2016).

  33. 33.

    Grothe, B., Carr, C. E., Casseday, J. H., Fritzsch, B. & Köppl, C. in Evolution of the Vertebrate Auditory System (eds Manley, G. A., Popper, A. N. & Fay, R. R.) 289–359 (Springer, New York, 2004).

  34. 34.

    Mueller, T. What is the thalamus in zebrafish? Front. Neurosci. 6, 64 (2012).

  35. 35.

    McCormick, C. A. & Wallace, A. C. Otolith end organ projections to auditory neurons in the descending octaval nucleus of the goldfish, Carassius auratus: a confocal analysis. Brain Behav. Evol. 80, 41–63 (2012).

  36. 36.

    Chagnaud, B. P., Engelmann, J., Fritzsch, B., Glover, J. C. & Straka, H. Sensing external and self-motion with hair cells: a comparison of the lateral line and vestibular systems from a developmental and evolutionary perspective. Brain Behav. Evol. 90, 98–116 (2017).

  37. 37.

    Straka, H. & Baker, R. Vestibular blueprint in early vertebrates. Front. Neural Circuits 7, 182 (2013).

  38. 38.

    Duncan, J. S. & Fritzsch, B. Evolution of sound and balance perception: innovations that aggregate single hair cells into the ear and transform a gravistatic sensor into the organ of corti. Anat. Rec. (Hoboken) 295, 1760–1774 (2012).

  39. 39.

    Ji, N., Milkie, D. E. & Betzig, E. Adaptive optics via pupil segmentation for high-resolution imaging in biological tissues. Nat. Methods 7, 141–147 (2010).

  40. 40.

    Wang, C. et al. Multiplexed aberration measurement for deep tissue imaging in vivo. Nat. Methods 11, 1037–1040 (2014).

  41. 41.

    Wang, K. et al. Direct wavefront sensing for high-resolution in vivo imaging in scattering tissue. Nat. Commun. 6, 7276 (2015).

  42. 42.

    Papadopoulos, I. N., Jouhanneau, J.-S., Poulet, J. F. A. & Judkewitz, B. Scattering compensation by focus scanning holographic aberration probing (F-SHARP). Nat. Photonics 11, 116–123 (2017).

  43. 43.

    Horton, N. G. et al. In vivo three-photon microscopy of subcortical structures within an intact mouse brain. Nat. Photonics 7, 205–209 (2013).

  44. 44.

    Ouzounov, D. G. et al. In vivo three-photon imaging of activity of GCaMP6-labeled neurons deep in intact mouse brain. Nat. Methods 14, 388–390 (2017).

  45. 45.

    Denk, W. & Horstmann, H. Serial block-face scanning electron microscopy to reconstruct three-dimensional tissue nanostructure. PLoS Biol. 2, e329 (2004).

  46. 46.

    Denk, W., Briggman, K. L. & Helmstaedter, M. Structural neurobiology: missing link to a mechanistic understanding of neural computation. Nat. Rev. Neurosci. 13, 351–358 (2012).

  47. 47.

    Rein, K., Zöckler, M., Mader, M. T., Grübel, C. & Heisenberg, M. The Drosophila standard brain. Curr. Biol. 12, 227–231 (2002).

  48. 48.

    Zheng, Z. et al. A complete electron microscopy volume of the brain of adult Drosophila melanogaster. bioRxiv Preprint at https://www.biorxiv.org/content/early/2017/06/13/140905 (2017).

  49. 49.

    Smith, T. E. Notebook on spatial data analysis. University of Pennsylvania School of Engineering and Applied Science https://www.seas.upenn.edu/~ese502/#notebook (2016).

  50. 50.

    Todd, B. S. & Andrews, D. C. The identification of peaks in physiological signals. Comput. Biomed. Res. 32, 322–335 (1999).

  51. 51.

    Martins, S. et al. Toward an integrated zebrafish health management program supporting cancer and neuroscience research. Zebrafish 13, S47–S55 (2016).

  52. 52.

    Aronesty, E. Comparison of sequencing utility programs. Open Bioinforma. J. 2013, 1–8 (2013).

  53. 53.

    Yates, A. et al. Ensembl 2016. Nucleic Acids Res. 44, D710–D716 (2016).

  54. 54.

    Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).

  55. 55.

    Robinson, J. T. et al. Integrative Genomics Viewer. Nat. Biotechnol. 29, 24–26 (2011).

  56. 56.

    Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B. & Valen, E. CHOPCHOPv2: a web tool for the next generation of CRISPR genome engineering. Nucleic Acids Res. 44, W272–W276 (2016).

Download references

Acknowledgements

We thank M. Brecht, C. Wyart, R. Britz, E. Naumann, M. Hoffmann and E. Bobrov for helpful discussions and critical reading of this manuscript. We are grateful to P. Liptrot, P. Dixon, O. Deters and other members of the Danionin aquarist community for advice on Danionella husbandry. A. Prendergast and C. Wyart (ICM, Paris, France) advised us on the Tol2 strategy and kindly provided the NeuroD:GCaMP6f DNA construct before publication. S. Luna and R. Froese (FishBase Project) kindly shared a digital copy of the FishBase brain data. We thank S. Mueller and the MRI core facility at the Charité for providing their services and expertise. We acknowledge funding by the Einstein Foundation Berlin, the DFG (EXC 257 NeuroCure), and the Human Frontiers Science Program. B.J. is a recipient of a Starting Grant from the European Research Council (ERC-2016-StG-714560) and the Alfried Krupp Prize for Young University Teachers, awarded by the Alfried Krupp von Bohlen und Halbach-Stiftung.

Author information

Author notes

  1. These authors contributed equally: Lisanne Schulze and Jörg Henninger.

Affiliations

  1. Einstein Center for Neurosciences, NeuroCure Cluster of Excellence, Charité–Universitätsmedizin Berlin, Berlin, Germany

    • Lisanne Schulze
    • , Jörg Henninger
    • , Mykola Kadobianskyi
    • , Thomas Chaigne
    • , Ana Isabel Faustino
    • , Nahid Hakiy
    • , Markus Schuelke
    •  & Benjamin Judkewitz
  2. Institut Curie, PSL Research University, INSERM U934, CNRS UMR3215, SU Sorbonne University, Paris, France

    • Shahad Albadri
    •  & Filippo Del Bene
  3. Brain and Mind Research Institute, Faculty of Medicine, University of Ottawa, Ottawa, ON, Canada

    • Leonard Maler
  4. Humboldt University, Berlin, Germany

    • Benjamin Judkewitz

Authors

  1. Search for Lisanne Schulze in:

  2. Search for Jörg Henninger in:

  3. Search for Mykola Kadobianskyi in:

  4. Search for Thomas Chaigne in:

  5. Search for Ana Isabel Faustino in:

  6. Search for Nahid Hakiy in:

  7. Search for Shahad Albadri in:

  8. Search for Markus Schuelke in:

  9. Search for Leonard Maler in:

  10. Search for Filippo Del Bene in:

  11. Search for Benjamin Judkewitz in:

Contributions

B.J., L.S. and J.H. conceived the project; L.S., J.H., T.C., M.K., N.H., A.I.F., F.D.B. and B.J. developed the methodology; J.H., M.K., T.C. and B.J. developed software; J.H., T.C., M.K., L.S., S.A., L.M. and B.J. conducted analyses; L.S., J.H., A.I.F., M.K., S.A. and N.H. conducted experiments; N.H. provided resources; B.J. and J.H. wrote the manuscript, with help from M.K., L.S., A.I.F. and T.C.; M.S., L.M. and F.D.B. supervised specific aspects of the study; and B.J. provided overall supervision for the entire study.

Competing interests

The authors declare no competing interests.

Corresponding author

Correspondence to Benjamin Judkewitz.

Integrated supplementary information

  1. Supplementary Figure 1 Shoaling and schooling in the dark.

    A) Nearest-neighbor distances of fish swimming in the dark (blue). Bootstrapped distribution is shown in red. The mean distance under the assumption of spatial randomness (see Methods) is shown as a gray line; n = 12 fish. B) Distribution of fish orientations relative to the mean orientation of all fish for each frame during schooling, n = 12 fish. Note that subtraction of the mean direction causes a general bias towards zero that is also evident in the shuffled data curves.

  2. Supplementary Figure 2 Temporal structure of Danionella translucida vocalizations.

    A) Histogram of burst durations. B) Histogram of inter-burst intervals. C) Histogram of durations of vocalization clusters. D) Histogram of the number of pulses per burst cluster. Red dotted lines indicate 95-percentiles. Data extracted from 24 h of recording of a community tank with about 30 fish, n = 2.2 million pulses.

  3. Supplementary Figure 3 Link between vocalization and male–male aggression.

    To test whether vocalizations may be linked to male aggression-driven behaviors, we monitored a group of four males in a small, shallow tank (24 × 24 cm) using audio and video recordings during a period of frequent vocalization (10 am-1 pm). (A) Still image of two males engaged in fighting behavior. Scale bar: 1 cm. (B) Detected periods of vocalization and fighting over the course of 3 h. Fighting episodes were labeled manually without listening to the audio track and vocalization episodes were detected using software. (C) Analysis of the co-occurrence of fighting and vocalizations. We quantified the conditional probabilities P(vocalization|fighting) and P(fighting|vocalization), indicated by the dashed lines in red and blue, which were significantly higher than in temporally shuffled data (p « 1e-5, one-sided one-sample Student’s t-test, n = 20000, distributions indicated by continuous lines in the respective colors). This analysis was repeated for two more groups of males (1 h each) with similar results.

  4. Supplementary Figure 4 Danionella translucida short-read alignment.

    Screenshot of Danionella translucida short read alignment to the zebrafish reference genome (GRCz10), as viewed with the freely available program IGV. The underlying data is being published alongside this publication.

  5. Supplementary Figure 5 Confirmation of successful genome editing.

    Left panel: Alignment of wild-type DT tyr sequence (WT, yellow highlight, top) and mutated sequences derived from the co-injection of the tyr gRNA 1 and 2 at their respective target sites. gRNA sequences and PAM are underlined in purple for reference. Right panel: PCR analysis of a pool of 3 dfp non-injected (WT) and injected embryos with gRNA pairs. A wild-type band could be detected for all conditions at the expected size and shorter bands around 500 base pairs (bp) could also be observed, indicative of large deletions (large Δ) generated by the co-injection of the gRNA pairs. gRNAs 1 and 2 were used for the quantification of knock-out efficiency and for the line generation. Additional injections of gRNAs A (5’-GCTCTGAAGAGCTTCTTGAG-3’), B (ACGATGGCACAGATGGGCAA), C (TGTGGGGTCCAATCAGGTCG) and D (AGCTTTCCTCCCCTGGCACC) also led to genomic deletions. PCR analysis was repeated 3 independent times.

Supplementary Information

  1. Supplementary Text and Figures

    Supplementary Figures 1–5

  2. Reporting Summary

  3. Supplementary Video 1

    Compressed histology video. Registered series of Nissl-stained transverse sections (8 µm thickness) of the Danionella translucida head.

  4. Supplementary Video 2

    3D MRI video. Rotating maximum intensity projection of high-resolution 35 µm MRI of Danionella translucida.

  5. Supplementary Video 3

    Courtship video. Danionella translucida courtship at 0.2× the original speed.

  6. Supplementary Video 4

    Fighting behavior between males. Movie of 4 Danionella translucida males displaying fighting behavior as quantified in Supplementary Fig. 3.

  7. Supplementary Audio 1

    Sound recordings shown in Fig. 2e. Short sequence of Danionella translucida vocalizations.

  8. Supplementary Audio 2

    Sound recordings shown in Fig. 2f. Sequence of Danionella translucida vocalizations.

About this article

Publication history

Received

Accepted

Published

DOI

https://doi.org/10.1038/s41592-018-0144-6