Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Huntingtin gene repeat size variations affect risk of lifetime depression

Abstract

Huntington disease (HD) is a severe neuropsychiatric disorder caused by a cytosine-adenine-guanine (CAG) repeat expansion in the HTT gene. Although HD is frequently complicated by depression, it is still unknown to what extent common HTT CAG repeat size variations in the normal range could affect depression risk in the general population. Using binary logistic regression, we assessed the association between HTT CAG repeat size and depression risk in two well-characterized Dutch cohorts─the Netherlands Study of Depression and Anxiety and the Netherlands Study of Depression in Older Persons─including 2165 depressed and 1058 non-depressed persons. In both cohorts, separately as well as combined, there was a significant non-linear association between the risk of lifetime depression and HTT CAG repeat size in which both relatively short and relatively large alleles were associated with an increased risk of depression (β = −0.292 and β = 0.006 for the linear and the quadratic term, respectively; both P < 0.01 after adjustment for the effects of sex, age, and education level). The odds of lifetime depression were lowest in persons with a HTT CAG repeat size of 21 (odds ratio: 0.71, 95% confidence interval: 0.52 to 0.98) compared to the average odds in the total cohort. In conclusion, lifetime depression risk was higher with both relatively short and relatively large HTT CAG repeat sizes in the normal range. Our study provides important proof-of-principle that repeat polymorphisms can act as hitherto unappreciated but complex genetic modifiers of depression.

Introduction

Depression is one of the most common psychiatric disorders with a lifetime prevalence of about 15%1. Depression is accompanied by substantial morbidity and mortality and, according to the World Health Organization, it is currently the leading cause of disability worldwide with an estimated 350 million people affected globally2. In order to devise more effective therapeutic and preventive strategies, a better understanding of its pathogenesis is crucial. A vital step in elucidating the pathogenesis of depression is to gain more insight into its underlying genetic determinants. However, despite an estimated heritability of between 30 and 50 percent of major depression, genome-wide association studies (GWAS) have only had limited success3. Although recently a number of single-nucleotide polymorphisms (SNPs) contributing to risk of depression were identified in GWAS involving tens of thousands of subjects, the effect sizes were very small and the inevitably large group sizes harbor risks of bias due to both phenotypic as well as genetic heterogeneity4,5.

One of the causes of the ‘‘missing heritability’’ problem of depression may be that, aside from SNPs, GWAS are unsuitable for detecting the contribution of other important genetic polymorphisms, in particular variably expanded DNA repeat sequences6,7,8. Expansions of simple repeat sequences in genomic DNA have been associated with many hereditary disorders9, but their association with common diseases is largely unknown. Among expanded repeat disorders polyglutamine diseases are the most prevalent9,10. These diseases are characterized by a trinucleotide (cytosine-adenine-guanine (CAG)) repeat expansion in the translated regions of otherwise unrelated genes, resulting in proteins with expanded polyglutamine domains10. The most common polyglutamine disease is Huntington disease (HD), a debilitating neurodegenerative disorder characterized by motor impairment, cognitive decline as well as severe neuropsychiatric disturbances of which depression is one of the most prevalent11,12,13. It is caused by a CAG repeat expansion in the Huntingtin (HTT) gene14. HTT alleles containing 40 or more CAG repeats lead invariably to HD, whereas alleles with 36 to 39 repeats have incomplete penetrance. Larger mutant CAG repeat size is associated with lower age-of-onset and faster disease progression15,16,17. Interestingly, mice transgenic for the HD gene also exhibit depression-like behavior indicating that CAG repeat size variations in this gene directly affect neuronal substrates underlying mood regulation18,19,20.

Recently, it was shown that subjects with HTT alleles containing CAG repeat lengths in the upper normal range (i.e., the intermediate range with 27–35 repeats) experienced significantly more depressive symptoms, including apathy and suicidal ideation, compared to control subjects21,22,23. Moreover, a case–control study in patients with major depression estimated the prevalence of incompletely penetrant HTT alleles (36 to 39 CAG repeats) at about 3 in 1000, whereas alleles in this range were absent in the control group24. However, it is still unknown to what extent more common length variations in the CAG repeat tract of the HTT gene, ranging from 6 to 35 trinucleotides, could affect lifetime depression risk. In the current study, we, therefore, aimed to assess the contribution of the whole spectrum of HTT CAG repeat length variations to depression susceptibility using data from two well-characterized Dutch cohorts: The Netherlands Study of Depression and Anxiety and the Netherlands Study of Depression in Older Persons25,26.

Methods and materials

Cohort 1

The Netherlands Study of Depression and Anxiety (NESDA) is a cohort study among 2981 participants aged 18–65 years25. Participants were recruited from the general population, general practices, and mental health care institutes. This cohort includes 1973 subjects with a lifetime diagnosis of major depressive disorder (MDD) and/or dysthymia (with MDD diagnosed in 1925 of these participants), 635 subjects with a lifetime anxiety disorder without lifetime depression and 373 healthy controls without (a history of) psychopathology25. Diagnoses were made according to the Diagnostic and Statistical Manual of Mental Disorders Fourth Edition (DSM-IV) criteria using the Composite Interview Diagnostic Instrument27. Due to insufficient DNA material for some subjects we genotyped a total of 2738 participants (including 1808 depressed and 930 non-depressed persons) from this cohort; however, the lacking DNA samples were missing completely at random.

Cohort 2

The Netherlands Study of Depression in Older Persons (NESDO) is a cohort study among 510 people aged 60–93 years recruited from both general practices and mental health care institutes26. The cohort consists of 378 depressed (including 360 patients with MDD) and 132 persons (without a history of) psychopathology. In NESDO the same methods were applied as in NESDA for diagnosing depression26. Due to insufficient DNA material for some subjects we genotyped a total of 485 participants (including 357 depressed and 128 non-depressed persons) from this cohort; however, the lacking DNA samples were missing completely at random.

Cohort 3

For external validation of our findings we extracted data from a previously published study assessing the role of incompletely penetrant HTT alleles in patients with MDD24. This study included data on the distribution of HTT CAG repeat lengths of 2986 chromosomes from MDD patients and 4007 control chromosomes24. Because we could not retrieve the raw data, data extraction was performed from the published article using WebPlotDigitizer (version 3.10)28.

Genotyping

We used a similar genotyping protocol as described previously29. In brief, a polymerase chain reaction (PCR) was performed in a TProfessional thermocycler (Biometra, Westburg) with labeled primers flanking the CAG stretch of HTT (primer 1: ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC, primer 2: GGCGGTGGCGGCTGTTGCTGCTGC) (Biolegio)30. The PCR was performed using 10 ng of genomic DNA, 1x OneTaq mastermix (New England Biolabs, OneTaq Hot start with GC Buffer master mix), 1.5 µL of primer Mix A or B (table A) and Aqua B. Braun water to a final volume of 15 µL. The PCR was performed with 30 cycles of 30 s denaturation at 94 ˚C, 1 min annealing at 60 ˚C and 2 min elongation at 68 ˚C preceded by 5 min of initial denaturation at 94 ˚C and followed by a final 5 min elongation at 68 ˚C. Every PCR included a negative control without genomic DNA, a reference sample of CEPH 1347-02 genomic DNA and two positive control samples with predetermined 17/17 and 23/27 HTT CAG repeats. The PCR products were run on either an ABI 3730 or an ABI 3130 automatic DNA sequencer (Applied Biosystems) and analyzed using the GeneMarker software version 2.4.0. All assessments were done with cases and controls randomized on plates and blinding with respect to disease status information.

Statistical analysis

All data are displayed as means and 95% confidence intervals unless otherwise specified. In order to assess whether HTT CAG repeat size is associated with risk of lifetime depression we used binary logistic regression analysis. First, to evaluate the presence of potential interaction effects between the two HTT alleles or non-linear effects of HTT CAG repeat size variations we used a model with the presence of lifetime depression (i.e., MDD and/or dysthymia) as the dependent variable and HTT CAG repeat sizes in both alleles, a quadratic term for each allele as well as a product term of the two alleles as explanatory variables. As in this model only the quadratic term of the longer allele appeared to be significantly associated with depression, we reduced the model to contain only a main and a quadratic term for the longer allele as independent variables. Exclusion of the shorter allele hardly influenced the parameter estimates of the longer allele. Therefore, for the sake of simplicity, from here onwards we will take HTT to mean the longer of the two alleles of each individual. We also adjusted the results for the effects of sex, age and education level (coded as ‘‘basic’’, ‘intermediate’ and ‘‘high’’25,26) in order to assess whether the effect of HTT CAG repeat size is independent of these well-established risk factors for depression. The Nagelkerke R 2 was used to assess the proportion of variability explained by the predictors in the model29. In order to account for potential effects of points with high leverage or influential points all statistical significance tests were based on robust estimators of standard errors. Moreover, in order to analytically assess whether there were any influential points of relevance that might have affected our analyses, we also calculated the Cook’s distance, which indicated no major issues with influential points. Furthermore, in order to assure that the results were not unduly affected in case of deviations from model assumptions and explore associations further, we also applied a non-parametric method by calculating odds ratios for a lifetime diagnosis of depression per HTT CAG repeat size (collating alleles with repeat sizes of ≤ 16 or ≥ 27 due to their relatively low frequency) compared to the odds of lifetime depression in the total cohort using the Fisher’s exact test. All tests were two-sided and significance level was set at P < 0.05. All analyses were performed in SPSS version 23.0 (IBM SPSS Statistics for Windows, IBM Corp).

Results

HTT CAG repeat size variations influence risk of lifetime depression

The distribution of the HTT CAG repeat size in the combined cohorts 1 and 2 is displayed in Fig. 1. In cohort 1 there was a significant association between the risk of lifetime depression and HTT CAG repeat size in which the association was best represented by a model including a quadratic term for HTT CAG repeat size (β = −0.239 and β = 0.005 for the linear and the quadratic term, respectively; both P ≤ 0.044). Adjusting the analysis for the effects of sex, age, and education level hardly changed the results (β = −0.249 and β = 0.005 for the linear and the quadratic term, respectively; both P ≤ 0.040). Similarly, in cohort 2 there was a significant quadratic association between the risk of lifetime depression and HTT CAG repeat size (β = −0.626 and P = 0.054 for the linear term; β = 0.015 and P = 0.045 for the quadratic term), which became slightly more pronounced after adjustment for the effects of sex, age and education level (β = −0.788 and β = 0.019 for the linear and the quadratic term, respectively; both P ≤ 0.034).

Fig. 1: Distribution of HTT CAG repeat sizes
figure1

The figure displays the frequency distribution of the number of CAG repeats in the HTT gene in 2165 subjects with and 1058 subjects without a lifetime depression diagnosis, respectively

Combining individual data from all subjects from both cohorts further increased the statistical significance of the results (β = −0.292 and β = 0.006 for the linear and the quadratic term, respectively; both P ≤ 0.009) after adjustment for the effects of sex, age, and education level, indicating that the effect of HTT on lifetime depression is independent of these risk factors (Fig. 2). Additional adjustment for cohort (i.e., NESDA or NESDO) hardly changed the statistical significance of the findings (P ≤ 0.008 for the linear and the quadratic term associated with HTT CAG repeat size). To evaluate whether the effect of HTT CAG repeat size is different for men and women, we also tested for the interaction between sex and HTT CAG repeat size. However, there was not a statistically significant interaction effect between sex and either the linear term (P = 0.077) or the quadratic term (P = 0.069) associated with HTT CAG repeat size, indicating that the effect of HTT CAG repeat size on depression susceptibility is the same for both men and women. Since our control group included people with anxiety disorders without co-morbid depression, we also performed a sensitivity analysis by excluding these subjects from the control group. This procedure did not materially change the parameter estimates or their statistical significance (β = −0.363 and β = 0.008 for the linear and the quadratic term, respectively; both P ≤ 0.006). Comparing the odds ratios of lifetime depression per HTT CAG category corroborated the results from the regression analysis and indicated that the risk of lifetime depression is lowest in individuals with a HTT CAG repeat size around 21 CAG repeats and increases with both lower and higher sizes of the CAG tract in this gene (Table 1 and Fig. 3). The Nagelkerke R 2 associated with a model with only a linear and a quadratic term for HTT CAG repeat size was 0.003, indicating that HTT CAG repeat size variations can account for 0.3% of the genetic variability of lifetime depression on the observed probability scale. We also derived the R 2 on the liability scale as described previously31. Assuming that depression has a lifetime prevalence of about 15% in the Netherlands32 and adjusting for the oversampling of patients with depression in our cohort, the R 2 on the liability scale was 0.004, indicating that HTT CAG repeat size polymorphisms can account for approximately 0.4% of depression heritability.

Fig. 2: HTT CAG repeat size is non-linearly associated with lifetime depression risk
figure2

The red line indicates the model predicted mean odds ratio for lifetime depression for each HTT CAG repeat size (adjusted for age, sex, and education level): Both subjects with a relatively low and a relatively high repeat size have a higher odds of developing depression compared to the odds of depression in the total group. Error bars indicate ± standard error. Please note that there was only one subject (with depression) who had a HTT CAG repeat size of 14 in the longer allele, therefore, no standard error could be calculated for this CAG repeat category. Please also note that the logistic model estimates of odds ratios for lifetime depression are slightly different from those presented in Table 1 as these estimates are obtained using data from all participants simultaneously, whereas the estimates in Table 1 are calculated for each subgroup of HTT CAG repeat size separately

Table 1 Distribution of the CAG repeat sizes in the longer HTT allele
Fig. 3: HTT CAG repeat size influences depression risk
figure3

The odds of a diagnosis of lifetime depression is non-linearly associated with CAG repeat size in the longer HTT allele: Both subjects with a relatively low and a relatively high repeat size have a higher risk of developing depression compared to the odds of depression in the total group. Error bars indicate ± standard error. *P < 0.05 by the Fisher’s exact test in comparison to the odds of lifetime depression in the total cohort

Calculation of odds ratios based on data from cohort 3 confirmed a non-linear association between the risk of MDD and the number of CAG repeats in the HTT gene (Supplementary Fig. 1). However, because the data were reported on a chromosome level, and not on an individual level24, it was not possible to assess the effect of the shorter and the longer HTT allele separately in this cohort. In addition, because we could not reliably extract the frequency of individual allele categories with relatively rare repeat sizes of < 16 or > 27 from the article describing this cohort, we unfortunately could not perform a regression analysis. For comparison, however, we also analyzed our own data on chromosome level (i.e., comparing 4330 and 2116 chromosomes from patients with depression and controls, respectively): This analysis again confirmed a quadratic association between HTT CAG repeat size and risk of lifetime depression (β = −0.136 and β = 0.003 for the linear and the quadratic term, respectively; both P ≤ 0.023).

The prevalence of intermediate and incompletely penetrant HTT alleles

In the combined cohorts 1 and 2, two individuals in the group with lifetime depression had a HTT CAG repeat size in the incompletely penetrant range (both with 37 repeats): one diagnosed with MDD and the other with dysthymia. HD was, however, not diagnosed at the time of assessment in either of them at the ages of 57 and 58 years, respectively. None of the subjects in the comparison group had an HTT CAG repeat size in the mutant range. The proportion of alleles with 27 CAG repeats or larger was 0.053 (95% confidence interval: 0.045 to 0.061) and did not differ between participants with depression and those without (P = 0.933).

Discussion

To the best of our knowledge this is the first account of an association between CAG repeat size variations in the normal range of the HTT gene and risk of lifetime depression. Although previously associations have been reported between HTT CAG repeat size variations and depression risk, these studies focused either on the intermediate (i.e., 27–35 CAGs) or the incompletely penetrant (i.e., 36–39 CAGs) range21,22,23,24. Importantly, we found a non-linear relationship between CAG repeat size in the longer HTT allele and risk of lifetime depression in which both relatively short and relatively large alleles were associated with an increased risk of depression as compared to alleles containing around 21 to 24 repeats. Furthermore, in accord with a previous study we found HTT alleles in the incomplete penetrance range only in patients with depression while these were absent in the comparison group suggesting that some cases with depression in the general population might possibly be due to incipient HD24.

The presence of a curvilinear association between HTT CAG repeat size in the normal range and depression risk is intriguing as it suggests an optimal range of CAG repeat sizes in the HTT gene supporting the idea that polymorphic tandem repeats could act as genetic ‘‘tuning knobs’’ for evolutionary processes33. It is well-known that very long CAG repeat expansions in the HTT gene are associated with HD, which is accompanied by substantial neuropsychiatric disturbances of which depression is one of the most prevalent12,13. However, to date no disorders have been formally associated with very short CAG repeat tracts in the HTT gene. Although deletion of a terminal band on the short arm of chromosome 4, the region which contains the HTT gene, results in a distinct neurodevelopmental disorder known as the Wolf-Hirschorn syndrome and has been instrumental in localizing the HTT gene, this deletion concerns multiple genes and has not been associated with interruptions of the CAG repeat tract in the HTT gene34. In accord with our findings most population studies have found a minimum number of nine CAG repeats in exon 1 of HTT 24,35,36,37, suggesting selection against alleles with very small number of repeats. In this regard, it is also noteworthy that there is a ‘‘cliff’’ in the frequency distribution of HTT CAG repeat sizes between 16 and 17 repeats in our cohorts (Fig. 1), indicating that HTT alleles with less than 17 repeats are much less prevalent and, therefore, might be associated with a survival disadvantage. Moreover, a recent study also found that chromosomes from patients with bipolar disorder contained HTT alleles with significantly shorter CAG tracts than control chromosomes36. Although our cohort did not include patients with bipolar disorder, these findings are well in line with our results and suggest that both relative extremes in short and long HTT CAG tracts within the normal range could predispose to mood disturbances. Moreover, while depression is very prevalent among HD mutation carriers38, the relation between HTT CAG repeat size variations in either the expanded or the normal range with depression risk has not been systematically investigated before in HD patients or premanifest mutation carriers. Our findings, therefore, suggest that it would also be interesting to investigate the role HTT CAG repeat size variations as potential modifiers of depression in HD mutation carriers.

We can only speculate about the mechanisms that could account for the association between HTT CAG repeat size variations and risk of depression. Huntingtin is essential for normal embryonic development as targeted disruption of its encoding gene is lethal in mice39. Although huntingtin is expressed in many organs, its expression is highest in the brain40. Huntingtin is in fact critical for the development of the central nervous system since decreased levels lead to reduced neurogenesis and profound malformations of the cortex and striatum40. As the expression of huntingtin is modulated by its polyglutamine tract40,41, the effect of HTT CAG repeat size variations on depression might be due to altered endogenous levels of huntingtin. Importantly, huntingtin is a key regulator of brain-derived neurotrophic factor (BDNF)41. Reduced levels of BDNF have been consistently associated with depression, whereas normalization of BDNF levels has been reported following antidepressant treatment42. However, we did not have data on blood or cerebrospinal fluid levels of BDNF in our participants, therefore, whether small variations in HTT CAG repeat size in the normal range could affect HTT or BDNF gene expression remains to be investigated. Another mechanism that might account for the association between HTT CAG repeat size variations and risk of depression is the polyglutamine-length-dependent interaction of huntingtin with a large number of other proteins40,43, including several key transcription factors and co-activators such as cAMP response element-binding protein (CREB) and CREB-binding protein. These proteins are crucial for neuronal function and synaptic plasticity, disturbances of which have been implicated in depression pathogenesis44. Interestingly, mice with a targeted deletion of the CAG repeat tract of the HD gene exhibited defects in learning and memory, further suggesting an important role for the polyglumatine tract of huntingtin in central nervous system function45. Finally, altered regulation of the hypothalamic-pituitary-adrenal axis, which has been involved in the pathogenesis of both HD and major depression might play a role46,47,48,49,50. Although the precise cellular pathways through which HTT CAG repeat polymorphisms could affect mood remain to be elucidated, there are recent preliminary data showing an association between HTT CAG repeat size variations across the normal range and brain structure in healthy adults and children51,52, suggesting direct structural modulation of the brain as an underlying mechanism.

There are certain limitations to our study. First, a potential limitation of our study is that we only used samples from two Dutch cohorts in our main analyses. Although by analyzing a homogenous population we minimized the impact of population stratification, this might have consequences for the generalizability of our findings. However, analysis of data extracted from a previous publication based on samples from American participants confirmed our findings and suggests that the association between HTT CAG repeat size and depression susceptibility is also likely to exist in other populations. Second, there was a large difference in the age distribution between the two cohorts in our study (i.e., 18–65 and 60–93 years in the NESDA and NESDO cohort, respectively). It is of course possible that some of the younger individuals who have not suffered from depression yet will go on to develop depression in the future. However, it is unlikely that this might have affected our findings as we found the same non-linear association between HTT CAG repeat size and the odds of depression in both cohorts. Moreover, the results remained similar when we adjusted for age in the combined cohort. Therefore, our findings indicate that the association between HTT CAG repeat size and depression is independent of age. Third, although we did not have long-term follow-up data, it would be interesting to follow-up participants with HTT alleles in the incomplete penetrance range to assess whether, and when, they go on to develop the full spectrum of HD signs and symptoms. And finally, given our relatively limited sample size, our primary analysis was based on the results of the binary logistic regression including all the data available, however, fluctuating odds ratios per CAG repeat size (Table 1 and Fig. 3) might reflect a more complex relationship, which warrants further evaluation in larger cohorts in the future.

In conclusion, we found a non-linear association between CAG repeat size in the HTT gene and risk of lifetime depression in which lifetime depression risk increased with both relatively short and relatively large alleles compared to alleles with CAG repeat sizes near the center of the distribution. Our study provides important proof-of-principle that repeat polymorphisms could act as complex genetic modifiers of depression and thus may at least partly account for its ‘‘missing heritability’’.

References

  1. 1.

    Hasin, D. S., Goodwin, R. D., Stinson, F. S. & Grant, B. F. Epidemiology of major depressive disorder: results from the National Epidemiologic Survey on Alcoholism and Related Conditions. Arch. Gen. Psychiatr. 62, 1097–1106 (2005).

    Article  PubMed  Google Scholar 

  2. 2.

    Marcus M., Yasamy M. T., Van Ommeren M., Chisholm D., Saxena S. Depression: A Global Public Health Concern, Vol. 1, 2 pp. (WHO Department of Mental Health and Substance Abuse, Geneva, Switzerland (2012).

  3. 3.

    Ripke, S. et al. A mega-analysis of genome-wide association studies for major depressive disorder. Mol. Psychiatr. 18, 497–511 (2013).

    Article  CAS  Google Scholar 

  4. 4.

    CONVERGE_consortium. Sparse whole-genome sequencing identifies two loci for major depressive disorder. Nature 523, 588–591 (2015).

    Article  PubMed Central  CAS  Google Scholar 

  5. 5.

    Okbay, A., Baselmans, B. M., De Neve, J. E., Turley, P. & Nivard, M. G. Genetic variants associated with subjective well-being, depressive symptoms, and neuroticism identified through genome-wide analyses. Nature 48, 624–633 (2016).

    CAS  Google Scholar 

  6. 6.

    Hannan, A. J. TRPing up the genome: Tandem repeat polymorphisms as dynamic sources of genetic variability in health and disease. Discov. Med. 10, 314–321 (2010).

    PubMed  Google Scholar 

  7. 7.

    Hannan, A. J. Tandem repeat polymorphisms: modulators of disease susceptibility and candidates for ‘missing heritability’. Trends Genet. 26, 59–65 (2010).

    Article  PubMed  CAS  Google Scholar 

  8. 8.

    Manolio, T. A. Genomewide association studies and assessment of the risk of disease. N. Engl. J. Med. 363, 166–176 (2010).

    Article  PubMed  CAS  Google Scholar 

  9. 9.

    Mirkin, S. M. Expandable DNA repeats and human disease. Nature 447, 932–940 (2007).

    Article  PubMed  CAS  Google Scholar 

  10. 10.

    Shao, J. & Diamond, M. I. Polyglutamine diseases: emerging concepts in pathogenesis and therapy. Hum. Mol. Genet. 16, R115–R123 (2007).

    Article  PubMed  CAS  Google Scholar 

  11. 11.

    van Duijn, E. et al. Neuropsychiatric symptoms in a European Huntington’s disease cohort (REGISTRY). J. Neurol. Neurosurg. Psychiatr. 85, 1411–1418 (2014).

    Article  Google Scholar 

  12. 12.

    Moulton, C. D., Hopkins, C. W. & Bevan-Jones, W. R. Systematic review of pharmacological treatments for depressive symptoms in Huntington’s disease. Mov. Disord. 29, 1556–1561 (2014).

    Article  PubMed  CAS  Google Scholar 

  13. 13.

    Pla, P., Orvoen, S., Saudou, F., David, D. J. & Humbert, S. Mood disorders in Huntington’s disease: from behavior to cellular and molecular mechanisms. Front. Behav. Neurosci. 8, 135 (2014).

    Article  PubMed  PubMed Central  Google Scholar 

  14. 14.

    The Huntington’s Disease Collaborative Research Group. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington’s disease chromosomes. Cell 72, 971–983 (1993).

    Article  Google Scholar 

  15. 15.

    Langbehn, D. R., Brinkman, R. R., Falush, D., Paulsen, J. S. & Hayden, M. R. A new model for prediction of the age of onset and penetrance for Huntington’s disease based on CAG length. Clin. Genet. 65, 267–277 (2004).

    Article  PubMed  CAS  Google Scholar 

  16. 16.

    Aziz, N. A. et al. Weight loss in Huntington disease increases with higher CAG repeat number. Neurology. 71, 1506–1513 (2008).

    Article  PubMed  CAS  Google Scholar 

  17. 17.

    Aziz, N. A. et al. Normal and mutant HTT interact to affect clinical severity and progression in Huntington disease. Neurology. 73, 1280–1285 (2009).

    Article  PubMed  CAS  Google Scholar 

  18. 18.

    Grote, H. E. et al. Cognitive disorders and neurogenesis deficits in Huntington’s disease mice are rescued by fluoxetine. Eur. J. Neurosci. 22, 2081–2088 (2005).

    Article  PubMed  Google Scholar 

  19. 19.

    Pang, T. Y., Du, X., Zajac, M. S., Howard, M. L. & Hannan, A. J. Altered serotonin receptor expression is associated with depression-related behavior in the R6/1 transgenic mouse model of Huntington’s disease. Hum. Mol. Genet. 18, 753–766 (2009).

    Article  PubMed  CAS  Google Scholar 

  20. 20.

    Pouladi, M. A. et al. Prevention of depressive behaviour in the YAC128 mouse model of Huntington disease by mutation at residue 586 of huntingtin. Brain 132, 919–932 (2009).

    Article  PubMed  Google Scholar 

  21. 21.

    Killoran, A. et al. Characterization of the Huntington intermediate CAG repeat expansion phenotype in PHAROS. Neurology 80, 2022–2027 (2013).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  22. 22.

    Feigin, A. Redefining the genetic risk for Huntington disease. Neurology 80, 2004–2005 (2013).

    Article  PubMed  Google Scholar 

  23. 23.

    Hogarth, P. Huntington disease: How many repeats does it take? Neurology 80, e241–e243 (2013).

    Article  PubMed  Google Scholar 

  24. 24.

    Perlis, R. H. et al. Prevalence of incompletely penetrant Huntington’s disease alleles among individuals with major depressive disorder. Am. J. Psychiatr. 167, 574–579 (2010).

    Article  PubMed  PubMed Central  Google Scholar 

  25. 25.

    Penninx, B. W. et al. The Netherlands Study of Depression and Anxiety (NESDA): rationale, objectives and methods. Int. J. Methods Psychiatr. Res. 17, 121–140 (2008).

    Article  PubMed  Google Scholar 

  26. 26.

    Comijs, H. C. et al. The Netherlands study of depression in older persons (NESDO); a prospective cohort study. BMC Res. Notes 4, 524 (2011).

    Article  PubMed  PubMed Central  Google Scholar 

  27. 27.

    Wittchen, H. U. et al. Cross-cultural feasibility, reliability and sources of variance of the Composite International Diagnostic Interview (CIDI). The Multicentre WHO/ADAMHA Field Trials. Br. J. Psychiatr. 159, 645–653 (1991). 658.

    Article  CAS  Google Scholar 

  28. 28.

    WebPlotDigitizer. Available online: http://arohatgi.info/WebPlotDigitizer/. http://arohatgi.info/WebPlotDigitizer, (2016).

  29. 29.

    Gardiner, S. L. et al. Large normal-range TBP and ATXN7 CAG repeat lengths are associated with increased lifetime risk of depression. Transl. Psychiatr. 7, e1143 (2017).

    Article  CAS  Google Scholar 

  30. 30.

    Warner, J. P., Barron, L. H. & Brock, D. J. A new polymerase chain reaction (PCR) assay for the trinucleotide repeat that is unstable and expanded on Huntington’s disease chromosomes. Mol. Cell. Probes 7, 235–239 (1993).

    Article  PubMed  CAS  Google Scholar 

  31. 31.

    Lee, S. H., Goddard, M. E., Wray, N. R. & Visscher, P. M. A better coefficient of determination for genetic profile analysis. Genet. Epidemiol. 36, 214–224 (2012).

    Article  PubMed  Google Scholar 

  32. 32.

    Andrade, L. et al. The epidemiology of major depressive episodes: results from the International Consortium of Psychiatric Epidemiology (ICPE) Surveys. Int. J. Methods Psychiatr. Res. 12, 3–21 (2003).

    Article  PubMed  Google Scholar 

  33. 33.

    Hannan A. J. Tandem Repeat Polymorphisms: Genetic Plasticity, Neural Diversity and Disease, (Landes Bioscience and Springer Science, New York, 2012).

  34. 34.

    Gusella, J. F. et al. Deletion of Huntington’s disease-linked G8 (D4S10) locus in Wolf-Hirschhorn syndrome. Nature 318, 75–78 (1985).

    Article  PubMed  CAS  Google Scholar 

  35. 35.

    Lee J.M. et al. CAG repeat expansion in Huntington disease determines age at onset in a fully dominant fashion. Neurology 78, 690–695 (2012).

  36. 36.

    Ramos, E. M. et al. Prevalence of Huntington’s disease gene CAG trinucleotide repeat alleles in patients with bipolar disorder. Bipolar. Disord. 17, 403–408 (2015).

    Article  PubMed  CAS  Google Scholar 

  37. 37.

    Ramos, E. M. et al. Prevalence of Huntington’s disease gene CAG repeat alleles in sporadic amyotrophic lateral sclerosis patients. Amyotroph. Lateral Scler. 13, 265–269 (2012).

    Article  PubMed  CAS  Google Scholar 

  38. 38.

    Eddy, C. M., Parkinson, E. G. & Rickards, H. E. Changes in mental state and behaviour in Huntington’s disease. Lancet Psychiatr. 3, 1079–1086 (2016).

    Article  Google Scholar 

  39. 39.

    Nasir, J. et al. Targeted disruption of the Huntington’s disease gene results in embryonic lethality and behavioral and morphological changes in heterozygotes. Cell 81, 811–823 (1995).

    Article  PubMed  CAS  Google Scholar 

  40. 40.

    Zuccato, C., Valenza, M. & Cattaneo, E. Molecular mechanisms and potential therapeutical targets in Huntington’s disease. Physiol. Rev. 90, 905–981 (2010).

    Article  PubMed  CAS  Google Scholar 

  41. 41.

    Cattaneo, E., Zuccato, C. & Tartari, M. Normal huntingtin function: an alternative approach to Huntington’s disease. Nat. Rev. Neurosci. 6, 919–930 (2005).

    Article  PubMed  CAS  Google Scholar 

  42. 42.

    Molendijk, M. L. et al. Serum BDNF concentrations as peripheral manifestations of depression: evidence from a systematic review and meta-analyses on 179 associations (N=9484). Mol. Psychiatr. 19, 791–800 (2014).

    Article  CAS  Google Scholar 

  43. 43.

    Langfelder P. et al. Integrated genomics and proteomics define huntingtin CAG length-dependent networks in mice. Nat. Neurosci. 19, 623-633 (2016).

  44. 44.

    Marsden, W. N. Synaptic plasticity in depression: molecular, cellular and functional correlates. Prog. Neuropsychopharmacol. Biol. Psychiatr. 43, 168–184 (2013).

    Article  CAS  Google Scholar 

  45. 45.

    Clabough, E. B. & Zeitlin, S. O. Deletion of the triplet repeat encoding polyglutamine within the mouse Huntington’s disease gene results in subtle behavioral/motor phenotypes in vivo and elevated levels of ATP with cellular senescence in vitro. Hum. Mol. Genet. 15, 607–623 (2006).

    Article  PubMed  CAS  Google Scholar 

  46. 46.

    Penninx, B. W. et al. Late-life depressive symptoms are associated with both hyperactivity and hypoactivity of the hypothalamo-pituitary-adrenal axis. Am. J. Geriatr. Psychiatr. 15, 522–529 (2007).

    Article  Google Scholar 

  47. 47.

    Rhebergen, D. et al. Hypothalamic-pituitary-adrenal axis activity in older persons with and without a depressive disorder. Psychoneuroendocrinology 51, 341–350 (2015).

    Article  PubMed  CAS  Google Scholar 

  48. 48.

    Aziz, N. A. et al. Increased hypothalamic-pituitary-adrenal axis activity in Huntington’s disease. J. Clin. Endocrinol. Metab. 94, 1223–1228 (2009).

    Article  PubMed  CAS  Google Scholar 

  49. 49.

    Du, X. et al. Environmental enrichment rescues female-specific hyperactivity of the hypothalamic-pituitary-adrenal axis in a model of Huntington’s disease. Trans. Psychiatr. 2, e133 (2012).

    Article  CAS  Google Scholar 

  50. 50.

    Shirbin, C. A. et al. Cortisol and depression in pre-diagnosed and early stage Huntington’s disease. Psychoneuroendocrinology 38, 2439–2447 (2013).

    Article  PubMed  CAS  Google Scholar 

  51. 51.

    Muhlau, M. et al. Variation within the Huntington’s disease gene influences normal brain structure. PLoS ONE 7, e29809 (2012).

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  52. 52.

    Lee, J. K. et al. Sex-specific effects of the Huntington gene on normal neurodevelopment. J. Neurosci. Res. 95, 398–408 (2017).

    Article  PubMed  CAS  Google Scholar 

Download references

Acknowledgements

This study was supported by a VENI-grant (#91615080) from the Netherlands Organization of Scientific Research and a seed fund (#570) from the European Huntington Disease Network (to N.A. Aziz). The infrastructure for the NESDA study (www.nesda.nl) has been funded through the Geestkracht program of the Netherlands Organization for Health Research and Development (Zon-Mw, grant number 10-000-1002) and participating universities (VU University Medical Center, Leiden University Medical Center, University Medical Center Groningen). The infrastructure for the NESDO study (http://nesdo.amstad.nl) is funded through the Fonds NutsOhra (project 0701-065), Stichting tot Steun VCVGZ, NARSAD The Brain and Behavior Research Fund (grant ID 41080), and the participating universities and mental health care organizations (VU University Medical Center, Leiden University Medical Center, University Medical Center Groningen, UMC St. Radboud, and GGZ inGeest, GG Net, GGZ Nijmegen, GGZ Rivierduinen, Lentis, and Parnassia).The funders of the study had no role in study design, data collection, data analysis, data interpretation, or writing of the report .

Authors’ contributions

N.A.A., M.J.v.B. and R.C.vd.M. designed the study analysis plan. B.W.J.H.P., H.C.C., and G.v.G provided data and DNA samples. M.J.v.B. and M.W.B. conducted the genotyping experiments. N.A.A. and S.L.G. analyzed the data and wrote the first draft of the manuscript. All authors critically revised the manuscript for important intellectual content and approved the submitted version.

Author information

Affiliations

Authors

Corresponding author

Correspondence to N. Ahmad Aziz.

Ethics declarations

Competing interests

The authors declare that they have no competing financial interests.

Additional information

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Gardiner, S.L., van Belzen, M.J., Boogaard, M.W. et al. Huntingtin gene repeat size variations affect risk of lifetime depression. Transl Psychiatry 7, 1277 (2017). https://doi.org/10.1038/s41398-017-0042-1

Download citation

Further reading

Search

Quick links