Increased aromatase activity in transformed lymphoblastoid cell lines from patients with the familial aromatase excess syndrome and normal controls is associated with novel alternative splicing of the 5′-end of P450arom mRNA † 631

The human aromatase gene (P450arom) is widely expressed; genetic defects in alternative use of promoters and/or splicing of its first exon might be involved in the pathogenesis of disorders with altered aromatase activity. Our laboratory recently reported the clinical findings in 4 individuals, members of a large kindred with the familial aromatase excess syndrome (FAES). In the present study, we investigated the transcribed and translated products of the P450arom gene in peripheral blood and Epstein-Barr virus (EBV)-transformed lymphocytes from patients with FAES and normal individuals. Aromatase activity was present in lymphocytes and this was confirmed by Western analysis. Reverse transcriptase (RT)-PCR demonstrated that, from the known promoters of this gene, only the ovarian (PII) and fetal liver (PI.3) promoters were used in lymphocytes from patients with FAES and normal controls. Rapid amplification of cDNA 5′-end (5′-RACE) showed a novel exon (NE) being exclusively present in patients with FAES, while normal controls expressed both the known exons 1c and 1d (promoters PI.3 and PII, respectively) and part of NE: 5′actgtacaGCACCCTCTGAAG CAACAGGAGCTATAGATGACCTTTTAGG GGGGATTCTGTAATTTTTCTGTCCCTTTGATTTCCACAGGAC-3′[lower case: intron, and upper case exon 1d (PII) sequences, in bold the sequence of exon 1 used in EBV-transformed lymphoblasts, bold and underlined the sequence used exclusively by patients with FAES, and underlined the first part of exon 2 of the P450arom gene]. We conclude that aromatase expression is present in EBV-transformed lymphocytes from patients with FAES and normal controls and associated with the use of cryptic splice sites in the 5′-end of the P450 gene, defining novel first exons of this gene.