Post-Transplant Events

Cytotoxic T-lymphocyte antigen 4 haplotype correlates with relapse and survival after allogeneic hematopoietic SCT

Article metrics

Abstract

CTLA-4 is a negative regulator of activated T cells and the association of CTLA-4 polymorphisms with autoimmune diseases and transplant outcome has been reported. We evaluated the effect of donor CTLA-4 polymorphisms on outcome after allogeneic hematopoietic SCT (HSCT). We analyzed 147 Japanese HLA-matched sibling recipients and their donors who had undergone allogeneic HSCT. Genotyping of three single-nucleotide polymorphisms in CTLA-4 (−318, +49, CT60) was performed using TaqMan-PCR. According to the international HapMap database, only these three CTLA-4 haplotypes, classified as C-G-G, C-A-A and T-A-G, are present in the Japanese population. In this study, percentage expression of the C-G-G, C-A-A and T-A-G haplotypes was 59.5, 30.6 and 9.9%, respectively. Recipients of the C-A-A haplotype donor showed a significantly lower risk of relapse (HR: 0.54, 95% CI: 0.30–0.97, P=0.040) and a trend toward higher OS (HR: 0.61, 95% CI: 0.36–1.0, P=0.054) than did recipients of a donor without the C-A-A haplotype. The presence or absence of the C-A-A haplotype did not affect GVHD or non-relapse mortality. As the presence of the C-A-A haplotype reduced relapse risk and improved survival after allogeneic HSCT, this CTLA-4 haplotype may provide useful information for donor selection.

Introduction

Allogeneic hematopoietic SCT (HSCT) has been established as an effective treatment for patients with hematological malignancies. GVHD caused by donor-derived T cells is one of the most common causes of morbidity and mortality after allogeneic HSCT.1 However, donor-derived T cells also mediate a GVL effect, which assists in the eradication of tumor cells.2 Control of alloimmune reactions and separation of the potent GVL effect from severe GVHD are therefore important for a successful outcome after allogeneic HSCT. Although optimal HLA matching between patients and donors is critical for the prevention of severe GVHD, this can still develop after HSCT from an HLA-identical sibling donor due to non-HLA gene polymorphisms.3, 4 Thus, the association of polymorphisms in genes encoding mHA,5, 6 cytokines,7, 8 chemokines9 and drug-metabolizing enzymes10 with transplant outcomes has been reported.

CTLA-4 is a receptor expressed on the surface of activated T cells, and is a homolog of CD28 that is responsible for T-cell activation. Although both CTLA-4 and CD28 bind the two ligands B7.1 (CD80) and B7.2 (CD86) expressed on APCs, CTLA-4 binds B7 molecules with higher affinity and avidity than CD28. CTLA-4 gene polymorphisms correlate with autoimmune diseases such as systemic lupus erythematosus,11, 12, 13 type 1 diabetes mellitus14, 15 and Graves’ disease.16 In addition, recent studies have shown an association of the CTLA-4 polymorphisms (−318 (rs5742909), +49 (rs231775) and CT60 (rs3087243)) with outcome after allogeneic HSCT.17, 18, 19 We therefore focused our study on these three polymorphisms, and analyzed the impact of donor genotypes and haplotypes in the Japanese population on outcome after HLA-identical sibling HSCT.

Patients and methods

Patients

The study population included adult Japanese patients who received hematopoietic stem cells from an HLA-identical sibling donor for the treatment of hematological malignancies at the Nagoya University Hospital and the Japanese Red Cross Nagoya First Hospital between 1987 and 2006. A total of 147 recipient-donor pairs were selected according to the following criteria: (1) DNA samples and clinical data were available; (2) an unmanipulated graft was transplanted; and (3) short-term MTX and CsA were used as GVHD prophylaxis. MTX was administered i.v. on day +1 (10 mg/m2) and on days +3 and +6 (7 mg/m2 each day). CsA was administered by i.v. infusion at a dose of 3.0 mg per kg at beginning on day −1.

Patient characteristics are summarized in Table 1. A total of 81 patients (55%) were classified as having standard-risk disease defined as acute leukemia in first CR, CML in first chronic phase and myelodysplastic syndrome with an international prognostic scoring system (IPSS) score of 1.0 or lower, whereas 66 patients (45%) had high-risk disease defined as disease of more advanced status than standard risk disease. Graft source was BM for 110 patients (75%) and peripheral blood for 37 patients (25%). Conditioning was myeloablative for 128 patients (87%) and reduced-intensity for 19 patients (13%).

Table 1 Patient characteristics

Informed consent was obtained from all patients and donors. The study was approved by the ethics committees at the Nagoya University Hospital, the Japanese Red Cross Nagoya First Hospital and the Tokai University School of Medicine.

CTLA-4 genotyping

Genomic DNA was obtained from donor peripheral blood or BM using the QIAamp DNA Blood Mini Kit (QIAGEN sciences, Germantown, MD, USA). The TaqMan PCR method was used to determine the three single-nucleotide polymorphism (SNP) genotypes of CTLA-4: −318 (rs5742909), +49 (rs231775) and CT60 (rs3087243). The respective primers and probes used for the TaqMan PCR were: −318 C/T, forward 5′-IndexTermAAATGAATTGGACTGGATGGT-3′ and reverse 5′-IndexTermTTACGAGAAAGGAAGCCGTG-3′, probe 5′-IndexTermGTCTCCACTTAGTTATCCAGATCCT[C/T]AAAGTGACATGAAGCTTCAGTTTC-3′; +49 A/G, forward 5′-IndexTermGCTCTACTTCCTGAAGACCT-3′ and reverse 5′-IndexTermAGTCTCACTCACCTTTGCAG-3′, probe 5′-IndexTermGCACAAGGCTCAGCTGAACCTGGCT[A/G]CCAGGACCTGGCCCTGCACTCTCCT-3′; CT60 A/G, forward 5′-IndexTermATCTGTGGTGGTCGTTTTCC-3′ and reverse 5’-IndexTermCCATGACAACTGTAATGCCTGT-3′, probe 5′-IndexTermTCTTCACCACTATTTGGGATATAAC[A/G]TGGGTTAACACAGACATAGCAGTCC3′.

PCR reactions were performed in a 10-μL reaction volume containing 1 × TaqMan Universal Master Mix (Applied Biosystems, Tokyo, Japan), 1 μmol of each primer, 1 μL of each probe and 1 μL of genomic DNA. Thermal cycle conditions were 95 °C for 10 min, 40 cycles of 92 °C for 15 s and 60 °C for 1 min. All PCR and endpoint fluorescent readings were analyzed using an ABI7900 sequence detection system (Applied Biosystems).

Statistical analysis

OS was calculated from the date of transplantation to the date of death using the Kaplan–Meier method, and P-values were calculated using a log-rank test. EFS was calculated from the date of transplantation to the date of death or relapse, whichever occurred first, and P-values were calculated using a log-rank test. Non-relapse mortality (NRM) was defined as mortality due to any cause other than relapse or disease progression. Cumulative incidences of NRM and relapse were estimated using Gray's test, with relapse and NRM, respectively, as a competing risk.

Acute GVHD was diagnosed and graded according to consensus criteria.20 Chronic GVHD was evaluated in patients who survived beyond day +100, and was categorized as limited or extensive.21 A multivariate Cox model was created for analysis of grade II-IV acute GVHD, grade III-IV acute GVHD, chronic GVHD, OS, NRM, relapse and EFS using stepwise selection at a significance level of 5%. Age, sex, disease risk, conditioning regimen and graft source were used as covariates, and those variables with a P-value of less than 0.2 in the univariate analysis were entered into the stepwise selection method. Hazard ratios of the CTLA-4 haplotype CAA were adjusted using these models. Analysis was carried out using STATA (StataCorp. 2007; Stata Statistical Software: Release 10.0. Special Edition. Stata Corporation, College Station, TX, USA). P-values of less than 0.05 were regarded as statistically significant, and P-values between 0.05 and 0.1 as suggesting a trend.

Results

Frequencies of CTLA-4 genotypes and haplotypes

Frequencies at which the three CTLA-4 SNPs were expressed in the 147 donors are listed in Table 2. The SNPs −318 (rs5742909), +49 (rs231775) and CT60 (rs3087243) were included in one haplotype block that was constructed using the international HapMap database. The haplotype analysis revealed only three haplotypes in the Japanese population: −318*C/+49*G/CT60*G (C-G-G), −318*C/+49*A/CT60*A (C-A-A) and −318*T/+49*A/CT60*G (T-A-G). In this cohort, the frequencies of the haplotype C-G-G, C-A-A and T-A-G were 59.5, 30.6 and 9.9%, respectively. All of the donors were distributed among the six haplotype combinations (Table 3).

Table 2 Frequency of CTLA-4 genotypes
Table 3 Frequencies of the CTLA-4 haplotype

Effect of the CTLA-4 haplotype C-A-A on transplant outcome

It has been shown that the donor −318 C allele is associated with a lower risk of relapse19 and that the donor CT60 AA genotype is associated with a lower risk of relapse and a higher OS.17 We therefore focused our analysis on the C-A-A haplotype, and examined the association between the C-A-A haplotype and the outcome after allogeneic HSCT.

The incidence of grade II-IV acute GVHD was 19% for all patients (Table 1). There was no significant difference between the cumulative incidences of grade II-IV acute GVHD in patients who received stem cells from a donor with the C-A-A haplotype (21%) or from a donor without the C-A-A haplotype (17%) (P=0.66) (Figure 1a).

Figure 1
figure1

Association of (a) the cumulative incidence of grade II-IV acute GVHD and (b) chronic GVHD in recipients of donors with (solid line) and without (dotted line) the CTLA-4 C-A-A haplotype.

Of 147 patients, 139 could be evaluated for chronic GVHD, and the incidence of chronic GVHD was 47% (Table 1). The incidence of chronic GVHD was not significantly different in the presence or absence of the C-A-A haplotype (51 vs 47%, P=0.81) (Figure 1b). Recipients of donors with the C-A-A haplotype showed a significantly lower incidence of relapse (28 vs 45%, P=0.049) and a higher OS (58 vs 36%, P=0.033) than recipients of donors without the C-A-A haplotype (Figures 2a and b). However, there was no significant difference in NRM between recipients of donors with or without the C-A-A haplotype (17% for both) (P=0.87).

Figure 2
figure2

The impact of donors with (solid line) or without (dotted line) the CTLA-4 haplotype C-A-A on the incidence of relapse (a) and the OS (b) in recipient.

Multivariate analyses showed that age >40 years was a risk factor for chronic GVHD, NRM, OS and EFS; that high-risk disease was a risk factor for relapse, OS and EFS; and that reduced intensity conditioning was a risk factor for chronic GVHD and relapse; and that PBSCT was a risk factor for acute and chronic GVHD. The hazard ratios of the C-A-A haplotype, adjusted by these factors, are listed in Table 4. The C-A-A haplotype was significantly associated with a lower relapse rate (HR: 0.54, 95%, CI: 0.30–0.97, P=0.040). Additionally, the group with the C-A-A haplotype exhibited trends toward higher OS (HR: 0.61, 95%, CI: 0.36–1.0, P=0.054) and EFS (HR: 0.67, 95%CI: 0.41–1.1, P=0.1), compared with the group without the C-A-A haplotype. The presence or absence of the C-A-A haplotype did not affect the incidence of acute or chronic GVHD or NRM.

Table 4 Effect of donor CTLA-4 haplotype on transplant outcome

Discussion

Our results highlight the impact of the donor CTLA-4 haplotype−318*C/+49*A/CT60*A (C-A-A) on outcome after allogeneic HSCT from an HLA-identical sibling.

It has been shown that the donor −318 C allele is associated with a lower risk of relapse19 and that the donor CT60 AA genotype correlates with a lower risk of relapse and a higher OS.17 Therefore, we focused on the C-A-A haplotype from three different haplotypes in the Japanese population, and examined the association between the C-A-A haplotype and the outcome after allogeneic HSCT. The presence of the CTLA-4 C-A-A haplotype exhibited a significantly lower incidence of relapse and a trend toward of a higher survival rate compared with the absence of the haplotype C-A-A, suggesting that the C-A-A haplotype might suppress the inhibitory function of CTLA-4 on tumor-reactive T cells and enhance the GVL effect.

The mechanism by which the C-A-A haplotype exerts its positive effects is still unclear. Several studies addressing the functional consequences of CTLA-4 SNP-318 and CT60 have been reported. The SNP−318 is located at the CTLA-4 promoter region, and the association of these alleles with promoter activity has been examined. Previous studies showed that the −318 C allele correlates with a lower promoter activity and a lower CTLA-4 expression than those observed with the −318 T allele.22, 23 The CTLA-4 gene is composed of four exons and has two isoforms: a full-length isoform (flCTLA-4) and a soluble form (sCTLA-4) that lacks exon 3, which encodes the transmembrane domain. Serum levels of sCTLA-4 increase in patients with various autoimmune diseases24, 25 and sCTLA-4 has the potential to bind to CD80/CD86,26, 27 suggesting that sCTLA-4 blocks the interaction of flCTLA-4 with CD80/CD86 and thereby enhances T-cell activation. It has been reported that the CT60 A allele is associated with a higher level of the sCTLA-4 mRNA than the CT60 G allele.17, 28 These results indicate that the −318 C allele and the CT60 A allele contribute to the reduction in CTLA-4 inhibitory function and to T-cell activation. However, association of the +49 A allele with a higher expression of CTLA-4 and augmentation of CTLA-4 inhibitory function has been reported.16, 29 Therefore, further investigation is required to elucidate the effect of the C-A-A haplotype on the anti-tumor activity of donor-derived T cells.

Although the C-A-A haplotype was associated with a low incidence of relapse, in this study it did not affect the incidence of GVHD, suggesting that the C-A-A haplotype may have the potential to separate GVL from GVHD responses. However, it might be because of our small cohort, as Perez-Garcia et al.17 demonstrated that the donor CT60 AA genotype was associated with an increased risk of grade II-IV acute GVHD in a large cohort of 536 donors. All of the patients in our study were Japanese, and many of them (75%) had received BM as a stem-cell graft. It is known that Japanese patients have a lower risk of developing acute GVHD,30 and that BMT is associated with a decrease in the development of acute GVHD.31 Thus, the ethnic population or the stem-cell source might also affect the association between CTLA-4 polymorphisms and the development of acute GVHD.

In summary, the presence of the CTLA-4 C-A-A haplotype reduced the risk of relapse and improved survival after allogeneic HSCT. Therefore, knowledge of the CTLA-4 haplotype may provide useful information for donor selection. The exact effect of the CTLA-4 C-A-A haplotype on transplant outcome should be determined in different cohorts with a substantially larger number of subjects.

References

  1. 1

    Ferrara JL, Deeg HJ . Graft-versus-host disease. N Engl J Med 1991; 324: 667–674.

  2. 2

    Horowitz MM, Gale RP, Sondel PM, Goldman JM, Kersey J, Kolb HJ et al. Graft-versus-leukemia reactions after bone marrow transplantation. Blood 1990; 75: 555–562.

  3. 3

    Dickinson AM . Non-HLA genetics and predicting outcome in HSCT. Int J Immunogenet 2008; 35: 375–380.

  4. 4

    Hansen JA, Petersdorf EW, Lin MT, Wang S, Chien JW, Storer B et al. Genetics of allogeneic hematopoietic cell transplantation. Role of HLA matching, functional variation in immune response genes. Immunol Res 2008; 41: 56–78.

  5. 5

    Goulmy E, Schipper R, Pool J, Blokland E, Falkenburg JH, Vossen J et al. Mismatches of minor histocompatibility antigens between HLA-identical donors and recipients and the development of graft-versus-host disease after bone marrow transplantation. N Engl J Med 1996; 334: 281–285.

  6. 6

    Nishida T, Akatsuka Y, Morishima Y, Hamajima N, Tsujimura K, Kuzushima K et al. Clinical relevance of a newly identified HLA-A24-restricted minor histocompatibility antigen epitope derived from BCL2A1, ACC-1, in patients receiving HLA genotypically matched unrelated bone marrow transplant. Br J Haematol 2004; 124: 629–635.

  7. 7

    Lin MT, Storer B, Martin PJ, Tseng LH, Gooley T, Chen PJ et al. Relation of an interleukin-10 promoter polymorphism to graft-versus-host disease and survival after hematopoietic-cell transplantation. N Engl J Med 2003; 349: 2201–2210.

  8. 8

    Keen LJ, DeFor TE, Bidwell JL, Davies SM, Bradley BA, Hows JM . Interleukin-10 and tumor necrosis factor alpha region haplotypes predict transplant-related mortality after unrelated donor stem cell transplantation. Blood 2004; 103: 3599–3602.

  9. 9

    Inamoto Y, Murata M, Katsumi A, Kuwatsuka Y, Tsujimura A, Ishikawa Y et al. Donor single nucleotide polymorphism in the CCR9 gene affects the incidence of skin GVHD. Bone Marrow Transplant 2010; 45: 363–369.

  10. 10

    Sugimoto K, Murata M, Onizuka M, Inamoto Y, Terakura S, Kuwatsuka Y et al. Decreased risk of acute graft-versus-host disease following allogeneic hematopoietic stem cell transplantation in patients with the 5,10-methylenetetrahydrofolate reductase 677TT genotype. Int J Hematol 2008; 87: 451–458.

  11. 11

    Ahmed S, Ihara K, Kanemitsu S, Nakashima H, Otsuka T, Tsuzaka K et al. Association of CTLA-4 but not CD28 gene polymorphisms with systemic lupus erythematosus in the Japanese population. Rheumatology (Oxford) 2001; 40: 662–667.

  12. 12

    Hudson LL, Rocca K, Song YW, Pandey JP . CTLA-4 gene polymorphisms in systemic lupus erythematosus: a highly significant association with a determinant in the promoter region. Hum Genet 2002; 111: 452–455.

  13. 13

    Lee YH, Harley JB, Nath SK . CTLA-4 polymorphisms and systemic lupus erythematosus (SLE): a meta-analysis. Hum Genet 2005; 116: 361–367.

  14. 14

    Haller K, Kisand K, Pisarev H, Salur L, Laisk T, Nemvalts V et al. Insulin gene VNTR, CTLA-4 +49A/G and HLA-DQB1 alleles distinguish latent autoimmune diabetes in adults from type 1 diabetes and from type 2 diabetes group. Tissue Antigens 2007; 69: 121–127.

  15. 15

    Balic I, Angel B, Codner E, Carrasco E, Perez-Bravo F . Association of CTLA-4 polymorphisms and clinical-immunologic characteristics at onset of type 1 diabetes mellitus in children. Hum Immunol 2009; 70: 116–120.

  16. 16

    Kouki T, Sawai Y, Gardine CA, Fisfalen ME, Alegre ML, DeGroot LJ . CTLA-4 gene polymorphism at position 49 in exon 1 reduces the inhibitory function of CTLA-4 and contributes to the pathogenesis of Graves’ disease. J Immunol 2000; 165: 6606–6611.

  17. 17

    Perez-Garcia A, De la Camara R, Roman-Gomez J, Jimenez-Velasco A, Encuentra M, Nieto JB et al. CTLA-4 polymorphisms and clinical outcome after allogeneic stem cell transplantation from HLA-identical sibling donors. Blood 2007; 110: 461–467.

  18. 18

    Azarian M, Busson M, Lepage V, Charron D, Toubert A, Loiseau P et al. Donor CTLA-4 +49 A/G*GG genotype is associated with chronic GVHD after HLA-identical haematopoietic stem-cell transplantations. Blood 2007; 110: 4623–4624.

  19. 19

    Wu J, Tang JL, Wu SJ, Lio HY, Yang YC . Functional polymorphism of CTLA-4 and ICOS genes in allogeneic hematopoietic stem cell transplantation. Clin Chim Acta 2009; 403: 229–233.

  20. 20

    Przepiorka D, Weisdorf D, Martin P, Klingemann HG, Beatty P, Hows J et al. 1994 Consensus Conference on Acute GVHD Grading. Bone Marrow Transplant 1995; 15: 825–828.

  21. 21

    Shulman HM, Sullivan KM, Weiden PL, McDonald GB, Striker GE, Sale GE et al. Chronic graft-versus-host syndrome in man. A long-term clinicopathologic study of 20 Seattle patients. Am J Med 1980; 69: 204–217.

  22. 22

    Ligers A, Teleshova N, Masterman T, Huang WX, Hillert J . CTLA-4 gene expression is influenced by promoter and exon 1 polymorphisms. Genes Immun 2001; 2: 145–152.

  23. 23

    Wang XB, Zhao X, Giscombe R, Lefvert AK . A CTLA-4 gene polymorphism at position −318 in the promoter region affects the expression of protein. Genes Immun 2002; 3: 233–234.

  24. 24

    Sato S, Fujimoto M, Hasegawa M, Komura K, Yanaba K, Hayakawa I et al. Serum soluble CTLA-4 levels are increased in diffuse cutaneous systemic sclerosis. Rheumatology (Oxford) 2004; 43: 1261–1266.

  25. 25

    Wong CK, Lit LC, Tam LS, Li EK, Lam CW . Aberrant production of soluble costimulatory molecules CTLA-4, CD28, CD80 and CD86 in patients with systemic lupus erythematosus. Rheumatology (Oxford) 2005; 44: 989–994.

  26. 26

    Oaks MK, Hallett KM, Penwell RT, Stauber EC, Warren SJ, Tector AJ . A native soluble form of CTLA-4. Cell Immunol 2000; 201: 144–153.

  27. 27

    Saverino D, Brizzolara R, Simone R, Chiappori A, Milintenda-Floriani F, Pesce G et al. Soluble CTLA-4 in autoimmune thyroid diseases: relationship with clinical status and possible role in the immune response dysregulation. Clin Immunol 2007; 123: 190–198.

  28. 28

    Ueda H, Howson JM, Esposito L, Heward J, Snook H, Chamberlain G et al. Association of the T-cell regulatory gene CTLA4 with susceptibility to autoimmune disease. Nature 2003; 423: 506–511.

  29. 29

    Mäurer M, Loserth S, Kolb-Mäurer A, Ponath A, Wiese A, Kruse N et al. A polymorphism in the human cytotoxic T-lymphocyte antigen 4 (CTLA4) gene (exon 1 +49) alters T-cell activation. Immunogenetics 2002; 54: 1–8.

  30. 30

    Oh H, Loberiza Jr FR, Zhang MJ, Ringden O, Akiyama H, Asai T et al. Comparison of graft-versus-host-disease and survival after HLA-identical sibling bone marrow transplantation in ethnic populations. Blood 2005; 105: 1408–1416.

  31. 31

    Stem Cell Trialists’ Collaborative Group. Allogeneic peripheral blood stem-cell compared with bone marrow transplantation in the management of hematologic malignancies: an individual patient data meta-analysis of nine randomized trials. J Clin Oncol 2005; 23: 5074–5087.

Download references

Acknowledgements

This study was supported in part by a Grant-in-Aid for Scientific Research (20890096) from Japan Society for the Promotion of Science, and a Health and Labour Science Research Grant (Research on Human Genome and Tissue Engineering) from the Ministry of Health, Labour and Welfare of Japan.

Author information

Correspondence to T Nishida.

Ethics declarations

Competing interests

The authors declare no conflict of interest.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Murase, M., Nishida, T., Onizuka, M. et al. Cytotoxic T-lymphocyte antigen 4 haplotype correlates with relapse and survival after allogeneic hematopoietic SCT. Bone Marrow Transplant 46, 1444–1449 (2011) doi:10.1038/bmt.2010.319

Download citation

Keywords

  • cytotoxic T-lymphocyte antigen 4
  • single-nucleotide polymorphism
  • haplotype
  • Japanese population
  • allogeneic hematopoietic SCT

Further reading