Genomic structure and localisation within a linkage hotspot of Disrupted In Schizophrenia 1, a gene disrupted by a translocation segregating with schizophrenia

Article metrics

Abstract

Two overlapping and antiparallel genes on chromosome 1, Disrupted In Schizophrenia 1 and 2 (DISC1 and DISC2), are disrupted by a (1;11)(q42.1;q14.3) translocation which segregates with schizophrenia through at least four generations of a large Scottish family. Consequently, these genes are worthy of further investigation as candidate genes potentially involved in the aetiology of major psychiatric illness. We have constructed a contiguous clone map of PACs and cosmids extending across at least 400 kb of the chromosome 1 translocation breakpoint region and this has provided the basis for examination of the genomic structure of DISC1. The gene consists of thirteen exons, estimated to extend across at least 300 kb of DNA. The antisense gene DISC2 overlaps with exon 9. Exon 11 contains an alternative splice site that removes 66 nucleotides from the open reading frame. The final intron of DISC1 belongs to the rare AT-AC class of introns. We have also mapped marker DIS251 in close proximity to DISC1, localising the gene within a critical region identified by several independent studies. Information regarding the structure of the DISC1 gene will facilitate assessment of its involvement in the aetiology of major mental illness in psychotic individuals unrelated to carriers of the translocation.

Introduction

Schizophrenia is a devastating disease affecting approximately 1% of the population world-wide. There is substantial evidence from twin, family and adoption studies for a significant genetic component in schizophrenia1 and this has fuelled the search for genes involved in psychosis. We are studying a large Scottish family in which a balanced (1;11)(q42.1,q14.3) translocation segregates with schizophrenia and related major psychiatric disorders2 through several generations, with a maximum LOD score of 6.0 (Blackwood et al, in preparation). Of more than 77 family members karyotyped, approximately half carry the balanced translocation, and approximately half of these carriers have been diagnosed with a major psychiatric disorder. We therefore hypothesise that the rearrangement has affected gene expression, leading to the psychiatric disorders in the family.

On chromosome 11 the translocation took place in a region of the genome where the density of genes is apparently low, and despite careful scrutiny, no genes have thus far been identified at the breakpoint.345 This suggests that the rearrangement probably does not affect any genes on this chromosome. However, on chromosome 1, two genes have been identified, DISC1 (accession numbers AF222980 and AB007926) and DISC2 (accession number AF222981), which are directly disrupted by the translocation.6 DISC1 is disrupted within an intron, with the result that a proportion of the coding sequence has been translocated to chromosome 11, while the translocation breakpoint is located within DISC2 transcribed sequence. The sequence of DISC2 is incomplete, with approximately 15 kb of cDNA sequence obtained so far. Analysis of DISC2 sequence suggests that the gene specifies a non-coding RNA molecule transcribed in the opposite direction from DISC1.6 DISC1 may therefore be a member of the expanding class of structural genes whose expression is regulated by an antisense RNA gene.789

DISC1 is predicted to encode a large protein with a globular N-terminal domain(s) and helical C-terminal domain.6 The helical tail is predicted to form a coiled-coil structure when the protein multimerises. This structure is present in a variety of proteins required for development and functioning of the nervous system.6

If the derived chromosome 1 produces any DISC1 protein at all, the translocation is predicted to remove part of the helical region, thus reducing the capacity of DISC1 protein to fold correctly, to form coiled-coils and to multimerise. It is therefore likely that DISC1 function is reduced in carriers of the translocation and that this may form the basis of the susceptibility to psychiatric disorders in this family.

Further work is now required to assess the candidacy of DISC1 and DISC2 as susceptibility genes for psychosis. We have therefore investigated the genomic structure of DISC1, and identified nearby polymorphic markers in order to provide the basis for a comprehensive assessment of this gene as a candidate.

Materials and methods

Contig construction

Genomic clones from the region were isolated from a PAC library, RPC11,10 distributed by the United Kingdom Human Genome Mapping Project Resource Centre, and a chromosome 1 cosmid library, provided by the Resource Centre of the German Human Genome Project at the Max-Planck-Institute for Molecular Genetics. Contig construction essentially required three phases. Initially, genomic clones were identified by screening libraries with sequence flanking the breakpoint, or with several cDNA fragments from DISC1 (data not shown). Overlaps between the clones were then determined by end sequencing using oligonucleotides bordering the cosmid and PAC vector cloning sites (data not shown). Pairs of primers were designed from the resulting sequence and overlapping clones identified by PCR (data not shown). For verification, the PCR products were hybridised to Southern blots of digested PAC and cosmid DNA (data not shown). Finally, remaining gaps in the contig were filled by further rounds of library screening using PCR products generated from clone ends. In addition, cosmid ICRFc112B0519Q6 was used to screen the PAC library. This identified PAC 135-G6 and extended the contig in the proximal direction. Two markers, D1S251 and D1S1621, have been mapped on this contig. D1S251 was mapped by PCR as described (http://carbon. wi.mit.edu:8000/cgi-bin/contig/stsinfo/408), while the location of D1S1621 immediately distal to the breakpoint has been reported elsewhere.6 The locations of DISC1 exons 1–3 and 5–13 and of all the expressed sequence tags (ESTs) with respect to the cosmids and PACs were determined by hybridisation of oligonucleotides (not shown) to digested cosmid and PAC DNA. ESTs J and K are located extremely close together such that their order with respect to the contig could not be determined by hybridisation. DISC1 exon 4 is known to be present in cosmid ICRFc112D2299QD4, but was not otherwise mapped for technical reasons.

Splice site identification

Direct cosmid sequencing utilising primers designed from the DISC1 cDNA sequence was used to determine the intron/exon structure of DISC1. The resulting genomic sequence was aligned with the cDNA sequence using the GCG package of sequence analysis software (Wisconsin package version 9.1, Genetics Computer Group, Madison, WI, USA) and splice sites identified at the points of divergence (Table 1). Exons 1–3 and 5–13 were identified by this method. For technical reasons, exon 4 proved more difficult. A probe corresponding to nucleotides 1171–1321 (exon 4) of DISC1 hybridises to an EcoRI genomic fragment of approximately 4 kb. This fragment was subcloned from cosmid ICRFc112D2299QD4. The location of DISC1 exons 1–3 and 5–13 with respect to all the cosmids and PACs was confirmed by oligonucleotide hybridisation to digested cosmid and PAC DNA (data not shown) as indicated (Figure 1).

Table 1 DISC1 splice site sequences
Figure 1
figure1

Contiguous clone map of the chromosome 1 breakpoint region containing DISC1 and DISC2. Black boxes, DISC1 exons; shaded box, DISC2; letters marking vertical arrows, position of ESTs; light shaded horizontal lines, cosmids; dark shaded horizontal lines, PACs. Positions of the putative CpG island, putative translation start and stop sites, polyadenylation signals and alternative splice site are indicated. EST accession numbers: A = AA777274, B = AA361879, C = AA311762, D = Hs.96883 (DISC2), E = AA249072 (DISC2), F = W04811 (DISC2), G = D78808 (DISC2), H = N49833, I = W29023/AA093172, J and K = H71071/Z40262, M = AA610789, 13 = Hs.26985 (DISC1). ESTs J and K are located extremely close together such that their order with respect to the contig could not be determined by hybridisation. DISC1 exon 4 is known to be present in cosmid ICRFc112D2299QD4, but was not otherwise mapped. Cosmids used for FISH are boxed.

Cell culture

The lymphoblastoid cell line from an individual bearing the t(1;11)(q42.1;q14.3) translocation, and its culture conditions, have been described previously.11 On the derived chromosome 1, DNA has been lost from 1q42.1-qter and replaced with chromosome 11 material from 11q14.3-qter. The derived 11 chromosome is the reciprocal translocated chromosome.

Fluorescence in situ hybridisation (FISH)

Cosmids were mapped in relation to the chromosome 1 breakpoint using 2–7 day slides of metaphase chromosomes prepared from the translocation cell line by conventional methods. Cosmid DNA was labelled with dUTP-biotin by standard nick translation. FISH was carried out essentially as previously described.12 Slides were examined on a Leica (Milton Keynes, UK) microscope and suitable metaphases scanned with a BioRad (Hercules, CA, USA) MRC-600 confocal laser scanning system.

DNA preparation

Cosmid and PAC DNA was prepared by standard plasmid preparation methods.13 Prior to sequencing, cosmid and PAC DNA was subjected to a phenol/chloroform clean-up step, followed by ethanol precipitation. Alternatively, cosmid DNA was prepared using Qiagen (Crawley, UK) plasmid midi kits, followed by dialysis. Cosmid DNA prepared for sequencing was stored at 4°C. Plasmid DNA was prepared using Qiagen plasmid midi kits.

DNA sequencing

Cosmid end sequencing was carried out using primers 928 (aggcgcagaactggtaggtatg) and 929 (gctaaggatgg tttctagcgatg). PAC sequencing was carried out using primers SP6 (tactgtttttgcgatctgccgttt) and T7 (aatacgact cactatagggaga). For cosmids and PACs 0.5–1 μg of DNA was sequenced using ABI PRISM Big Dye terminator cycle sequencing ready reaction kits with 60 ng of primer. Plasmid DNA sequencing reactions were performed using ABI PRISM dRhodamine terminator cycle sequencing ready reaction kits and the products separated on an ABI 377 DNA sequencer (PE Applied Biosystems, Foster City, CA, USA), according to the manufacturer's instructions. The resulting sequence was analysed using the GCG package of sequence analysis software (Wisconsin package version 9.1, Genetics Computer Group). BLAST14 searches were carried out at the National Center for Biotechnology Information (http://www. ncbi.nlm.nih.gov/).

Polymerase chain reaction

PCR was carried out using AmpliTaq DNA polymerase (Perkin Elmer, Applied Biosystems). Each 50-μl reaction contained 1 unit of enzyme, 300 ng of each primer, 200 mM of each dNTP, 1.5 mM MgCl2, 50 mM KCl and 10 mM Tris-HCl pH 8.3. A probe corresponding to nucleotides 1177–1321 of DISC1 was prepared from cloned cDNA using primers acgttacaacaaagattagaa gacctgg and tgctgagtggccccacggcgcaag, with touchdown PCR (75–65°C) and 30 s denaturation at 94°C, 30 s synthesis at 72°C. Marker D1S251 was mapped by PCR using the standard cycling conditions for this marker.

Hybridisation

Standard procedures were used for Southern blotting and hybridisation.13 Probes were labelled with alpha 32P-dCTP by random priming using High Prime (Roche, Basel, Switzerland) and purified using NICK columns (Amersham Pharmacia Biotech, Little Chalfont, UK). Oligonucleotide probes were labelled with gamma 32P-dATP. Oligonucleotide hybridisations were carried out overnight at the appropriate temperature.

Results

Construction of a contiguous clone map

To investigate the genomic structure of DISC1 we first constructed a contiguous clone map spanning the chromosome 1 breakpoint (Figure 1). The complete contig is estimated to extend across at least 400 kb based on average PAC and cosmid sizes of 130 kb and 35 kb respectively.

Cosmid FISH was employed to confirm the orientation of the contig, and that it crosses the translocation breakpoint. Cosmids spanning the breakpoint, and located distal and proximal hybridised as predicted to chromosomes from the translocation cell line (Figure 2). Cosmid ICRFc11210142Q6 hybridises to the normal chromosome 1, and the derived 1 and derived 11 chromosomes (Figure 2a), indicating that it crosses the breakpoint. Hybridisation of cosmid ICRFc112 D1274QD4 to the normal chromosome 1 and derived 1 (Figure 2b), shows that it is located proximal to the breakpoint. Finally, the signal from cosmid ICRFc112G1395QD4 is visible on the normal chromosome 1 and the derived chromosome 11 (Figure 2c), demonstrating that this cosmid lies distal to the breakpoint.

Figure 2
figure2

FISH using chromosome 1 breakpoint cosmids and the translocation carrier-derived cell line. (a) ICRFc11210142Q6; (b) ICRFc112D1274Q6; (c) ICRFc112 G1395Q6. 1, normal chromosome 1; der 1, derived chromosome 1 where 1q42.1-ter has been replaced with 11q14.3-ter; der 11, reciprocal derived chromosome 11 carrying 1q42.1-ter in place of 11q14.3-ter.

Genomic structure of DISC1

The exon/intron structure of DISC1 was determined and the gene found to consist of thirteen exons extending across at least 300 kb of genomic DNA (Figure 1). The putative translation start and stop codons are located within exons 1 and 13 respectively. Exon 2 is unusually large at 980 nucleotides in length. Intron 9 is also particularly large, and is estimated to cover at least 100 kb of DNA, accounting for approximately one third of the total length of the gene. A region of 66 nucleotides is commonly deleted from some DISC1 transcripts, while maintaining the open reading frame.6 This arises from utilisation of an internal splice donor site within exon 11 and the normal splice acceptor site of the same exon. The final intron of DISC1 is a member of the extremely rare AT-AC class of introns.15 This intron possesses the consensus 5′ and 3′ splice site sequences, atatcctt and yccac respectively, as well as the consensus branchsite element, tccttaac, close to the 3′ splice site as shown in Table 1.

Two polymorphic markers are located in close proximity to the DISC1 gene (Figure 1). D1S251 is located proximal to the putative promoter region, while D1S1621 is located within intron 8, and adjacent to the translocation breakpoint as already noted.6 DISC2 so far consists of a single large exon in excess of 15 kb. This exon overlaps with exon 9 of DISC1 (Figure 1).

DISC1 is predicted to encode a protein with an N-terminal globular head consisting mainly of β-sheet, and a solvent-exposed C-terminal α-helical tail with the potential to form coiled-coils.6 The transition from β-sheet to α-helix occurs essentially at the boundary between exons 2 and 3. Exons 1 and 2 therefore encode the putative globular domain(s), while exons 3–13 encode the putative helical tail of DISC1. The translocation breakpoint lies within intron 8 of DISC1. The effect of the translocation is therefore to remove exons 9–13 to chromosome 11.

Identification of further transcribed sequences

Several miscellaneous sequences were generated from the ends of cosmids and PACs, and from sequence flanking the exons of DISC1 (Figure 1). These sequences, together with the sequence of cosmid ICRFc112I0142Q6 (accession number AF222987) were used to perform BLAST14 searches of Genbank and EMBL at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). Homologies to thirteen ESTs have been identified to date. Unigene cluster Hs.26985 (M, http://www.ncbi.nlm.nih.gov/ UniGene/Hs.Home.html) is derived from the 3′ UTR of DISC1. ESTs with accession numbers AA249072, W04811 and D78808, together with UniGene cluster Hs.96883 (E, F, G and D) are derived from DISC2.6 Eight ESTs have not yet been assigned to any known gene.

Discussion

We have elucidated the genomic structure of DISC1, a gene which we suggest may be involved in the aetiology of psychiatric illness because it is directly disrupted by a translocation segregating with major psychiatric illness26 (LOD = 6.0, Blackwood et al, in preparation). The gene is large, extending across an estimated 300 kb and consisting of 13 exons. There is an overlapping antisense gene (DISC2) that may be involved in regulating expression of DISC16 and eight ESTs, all located within the introns. While these ESTs may represent previously undetected genes, their location within DISC1 suggests that it is also possible that they represent alternatively spliced exons of the gene. Alternatively, some of the ESTs may represent DISC2 since the full extent of this gene is unknown.

Mapping of marker D1S251 next to DISC1 localises this gene within a region implicated in psychiatric illness by several studies. Notably, a critical region of approximately 4.1 cM containing several markers, including D1S251, and generating a maximum LOD score of 2.65 was identified in a recent study.16 Moreover, observations of positive linkage at 1q42.1 using D1S251 and the nearby marker D1S103 have also been obtained (Muir et al, in preparation).1718 Reports of susceptibility loci for psychiatric illness at 1q32 (LOD = 2.67)19 and 1q32.2–q41 (LOD = 3.82)20 are also intriguing due to their proximity to the DISC1 and DISC2 genes at 1q42.1.

Although DISC1 is a positional candidate gene, it is now necessary to assess it by means of mutation analysis and association studies in psychiatric patients unrelated to those carrying the translocation. DISC1 genomic structural information will facilitate searches for sequence alterations in the putative promoter region, exons and splice sites of psychiatric patients. The same regions can now also be scanned for single nucleotide polymorphisms in affected individuals and the general population in order that association studies can be carried out. Furthermore, our mapping of D1S251 in close proximity to, and D1S1621 within DISC1, provides further polymorphic sequences that may be useful in association studies.

References

  1. 1

    McGuffin P, Owen MJ, Farmer AE . Genetic basis of schizophrenia Lancet 1995 346: 678–682

  2. 2

    StClair D, Blackwood D, Muir W, Carothers A, Walker M, Spowart G et al. Association within a family of a balanced translocation with major mental illness Lancet 1990 336: 13–16

  3. 3

    Devon RS, Evans KL, Maule JC, Christie S, Anderson S, Brown J et al. Novel transcribed sequences neighbouring a translocation breakpoint associated with schizophrenia Am J Med Genet 1997 74: 82–90

  4. 4

    Millar JK, Brown J, Maule JC, Shibasaki Y, Christie S, Lawson D et al. A long-range restriction map across 3Mb of the chromosome 11 breakpoint region of a translocation linked to schizophrenia: localisation of the breakpoint and the search for neighbouring genes Psychiatr Genet 1998 8: 175–181

  5. 5

    Devon RS, Porteous DJ . Physical mapping of a glutamate receptor gene in relation to a balanced translocation associated with schizophrenia in a large Scottish family Psychiatr Genet 1997 7: 165–169

  6. 6

    Millar JK, Wilson-Annan JC, Anderson S, Christie S, Taylor MS, CAM Semple et al. Disruption of two novel genes by a translocation cosegregating with schizophrenia Hum Mol Genet 2000 9: 1415–1423

  7. 7

    Dolnick BJ . Naturally occuring antisense RNA Pharmacol Ther 1997 75: 179–184

  8. 8

    Knee R, Murphy PR . Regulation of gene expression by natural antisense RNA transcripts Neurochem Int 1997 31: 379–392

  9. 9

    Constancia M, Pickard B, Kelsey G, Reik W . Imprinting mechanisms Genome Res 1998 8: 881–900

  10. 10

    Ioannou PA, de Jong PJ . Construction of bacterial artificial chromosome libraries using the modified P1 (PAC) System In: Dracopoli NC, Haines JL, Korf BR, Moir DT, Morton CC, Seidman CE et al (eds). Current Protocols in Human Genetics John Wiley and Sons, New York 1996

  11. 11

    Fletcher JM, Evans K, Baillie D, Byrd P, Hanratty D, Leach S et al. Schizophrenia-associated chromosome 11q21 translocation: identification of flanking markers and development of chromosome 11q fragment hybrids as cloning and mapping resources Am J Hum Genet 1993 52: 478–490

  12. 12

    Evans KL, Brown J, Shibasaki Y, Devon RS, He L, Arveiler B et al. A contiguous clone map over 3 Mb on the long arm of chromosome 11 across a balanced translocation associated with schizophrenia Genomics 1995 28: 420–428

  13. 13

    Sambrook J, Fritsch EF, Maniatis T . Molecular Cloning. A Laboratory Manual CSH Laboratory Press, Cold Spring Harbor 1989

  14. 14

    Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller A et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs Nucleic Acids Res 1997 25: 3389–3402

  15. 15

    Tarn WY, Steitz JA . Pre-mRNA splicing: the discovery of a new spliceosome doubles the challenge Trends Biochem Sci 1997 22: 132–137

  16. 16

    Ekelund J, Lichtermann D, Hovatta L, Ellonen P, Suvisaari J, Terwilliger JD et al. Genome-wide scan for schizophrenia in the Finnish population: evidence for a locus on chromosome 7q22 Hum Mol Genet 2000 9: 1049–1057

  17. 17

    Gejman PV, Martinez M, Cao Q, Friedman E, Berrettini WH, Goldin LR et al. Linkage analysis of fifty-seven microsatellite loci to bipolar disorder Neuropsychopharmacology 1993 9: 31–40

  18. 18

    LaBuda MC, Maldonado M, Marshall D, Otten K, Gerhard DS . A follow-up report of a genome search for affective disorder predisposition loci in the Old Order Amish Am J Hum Genet 1996 59: 1343–1362

  19. 19

    Detera-Wadleigh SD, Badner JA, Berrettini WH, Yoshikawa T, Goldin LR, Turner G et al. A high-density genome scan detects evidence for a bipolar-disorder susceptibility locus on 13q32 and other potential loci on 1q32 and 18p11.2 Proc Natl Acad Sci 1999 96: 5604–5609

  20. 20

    Hovatta I, Varilo T, Suvisaari J, Terwilliger JD, Ollikainen V, Arajarvi R et al. A genome wide screen for schizophrenia genes in an isolated Finnish subpopulation, suggesting multiple susceptibility loci Am J Hum Genet 1999 65: 1114–1124

Download references

Acknowledgements

We thank Kathy Evans for many useful discussions and Caroline Lamb for her contribution to determining the splice site sequences of DISC1. This work was supported by the United Kingdom Medical Research Council and NV Organon.

Author information

Correspondence to J K Millar.

Rights and permissions

Reprints and Permissions

About this article

Keywords

  • DISC1
  • DISC2
  • AT-AC intron
  • schizophrenia

Further reading