Molecular Cytogenetics

NUP98 rearrangements in hematopoietic malignancies: a study of the Groupe Francophone de Cytogénétique Hématologique

Article metrics

Abstract

The NUP98 gene is fused with 19 different partner genes in various human hematopoietic malignancies. In order to gain additional clinico-hematological data and to identify new partners of NUP98, the Groupe Francophone de Cytogénétique Hématologique (GFCH) collected cases of hematological malignancies where a 11p15 rearrangement was detected. Fluorescence in situ hybridization (FISH) analysis showed that 35% of these patients (23/66) carried a rearrangement of the NUP98 locus. Genes of the HOXA cluster and the nuclear-receptor set domain (NSD) genes were frequently fused to NUP98, mainly in de novo myeloid malignancies whereas the DDX10 and TOP1 genes were equally rearranged in de novo and in therapy-related myeloid proliferations. Involvement of ADD3 and C6ORF80 genes were detected, respectively, in myeloid disorders and in T-cell acute lymphoblastic leukemia (T-ALL), whereas the RAP1GDS1 gene was fused to NUP98 in T-ALL. Three new chromosomal breakpoints: 3q22.1, 7p15 (in a localization distinct from the HOXA locus) and Xq28 were detected in rearrangements with the NUP98 gene locus. The present study as well as a review of the 73 cases previously reported in the literature allowed us to delineate some chromosomal, clinical and molecular features of patients carrying a NUP98 gene rearrangements.

Introduction

The first rearrangement of the NUP98 gene in hematopoietic malignancy was reported in 1996 by Nakamura et al. and Borrow et al. in a study of the rare but recurrent translocation t(7;11)(p15;p15),1, 2 Subsequently, it was shown that NUP98, like MLL, ETV6 and RUNX1, is the target of rare and various chromosomal rearrangements associated with childhood and adult de novo and therapy related, myeloid and lymphoblastic T-cell acute leukemias. Until now, NUP98 has been found rearranged with 19 different partner genes resulting in in-frame fusion genes subclassified into three groups. The first group is composed of nine genes coding for homeodomain proteins, seven homeotic genes (HOXA9, HOXA11, HOXA13, HOXC11, HOXC13, HOXD11 and HOXD13),3, 4, 5 and two class-2 homeobox genes (PRRX1 and PRRX2).6, 7 The second group comprises eight nuclear nonhomeotic genes: the lens epithelium-derived growth factor (LEDGF),8, 9, 10, 11 the nuclear-receptor binding set domain genes (NSD1),12, 13, 14, 15, 16 and NSD3,17 the helicase DDX10,18, 19, 20, 21 the topoisomerase TOP1,22, 23, 24, 25, 26 and TOP2B genes,27 the FN1 gene28 and the C6orf80 gene.29 The third group is composed of two genes, respectively, RAP1GDS130, 31 and ADD332 encoding two cytoplamic proteins and fused to NUP98 in T-ALLs.

The NUP98 gene, maps to chromosome 11p15.4, is 122 kb long and is located 3.6 Mb from the telomere on the short arm of chromosome 11. It is composed of 33 exons and codes for a Nup98–Nup96 precursor of 1729 amino acids, which after cleavage generates the Nup98 protein (860 amino-acids coded by the 18 first NUP98 exons) and Nup96 protein (849 amino-acids coded by the last 15 exons). Both belong to the nucleopore complex (NPC). Nup98 is dynamically associated with NPC and shuttles between the nucleus and the cytoplasm transporting protein and RNA through its N-terminal 524 amino acid part containing 37 FG and GLFG repeats and a Gle2 site that allows karyophorins and RNA transporting protein binding.33, 34, 35

All NUP98 disruptions, which have been studied at the molecular level, generate a NUP98-partner gene fusion transcript whereas the reciprocal transcript, partner/NUP98, is not always present. Thereby, it is the NUP98/partner gene, situated on the derivative chromosome 11, that codes for the oncogenic hybrid protein. All NUP98 gene breakpoints are located between introns 8 and 16. The hybrid protein always contains the Nup98 N-terminal GLFG domain fused to some domain of the partner protein and, the expression of the fusion gene is dependent on the 5′ regulatory NUP98 expression region. Kasper et al. demonstrated that the GFLG domain, in the Nup98-Hoxa9, was essential for the leukemic process because of its ability to recruit coactivators such as Cbp/p300.36 In the same experiment, they also demonstrated the importance of the homeodomain of Hoxa9 in the cell transforming ability. If homeoproteins are clearly implicated in hematopoiesis, the role of the other partner genes in hematopoiesis is not known. The study of their function as well as the description of new NUP98 partner genes will help in the understanding of hematopoietic and leukemic pathways.

In order to find new partners genes of NUP98, the Groupe Francophone de Cytogénétique Hématologique (GFCH) decided to screen 66 patients with various hematopoietic malignancies and a 11p15 rearrangement. Twenty-three (35%) of these patients exhibited chromosomal abnormalities involving NUP98. Three new chromosomal breakpoints were detected in chromosomal bands rearranged with the NUP98 locus. Moreover, an analysis of our results as well as those published in the literature allowed us to further delineate some chromosomal, clinical and molecular features of patients carrying a NUP98 gene rearrangements.

Materials and methods

Patients

Karyotypes of 71 patients with various hematological malignancies associated with a 11p15 chromosomal anomaly were reviewed during two workshops by the members of the Groupe Francophone de Cytogénétique Hématologique. Only 66 patients with a chromosomal pellet were selected for FISH screening to detect a NUP98 disruption: 41 had a de novo myeloid disorder, 10 had received therapy and developed a treatment-related acute myeloid leukemia (t-AML) or myelodysplastic syndrome (t-MDS), five had a T-cell malignancy (four T-ALL, one Sézary syndrome), eight developed a B-cell neoplasm (three B-ALL, two chronic lymphocytic leukemias, two diffuse large B-cell lymphoma, one multiple myeloma), one had a biphenotypic leukemia and one had an unclassifiable acute leukemia. In the group of de novo myeloid malignancies, five had a chronic myeloproliferative disorder (two chronic myelogenous leukemias, one essential thrombocythemia, two Ph-negative chronic myeloproliferative disorders), five had a myelodysplastic syndrome and 31 AML: six AML with multilineage dysplasia, two minimally differentiated AML (AML-M0 according to the French-American-British FAB Classification), five AML without maturation (AML-M1), four AML with maturation (AML-M2), seven acute myelomonocytic leukemias (AML-M4), six acute monocytic leukemias (AML-M5), one acute erythroid leukemia (AML-M6), Patients’general data and history can be obtained upon request to serge.romana@nck.aphp.fr.

Fish studies

For detection of NUP98 rearrangements, dual color FISH experiments were performed with a ‘NUP98 probe’ composed of two contiguous BAC clones: RP11-120E20, labeled with Rhodamine-dUTP and RP11-258P13, labeled with FITC-dUTP (see Figure 1a).

Figure 1
figure1

FISH experiments. (a) Schematic representation of the ‘NUP98 probe’. (b) Screening for NUP98 disruption with the ‘NUP98 probe’: RP11-120E20 labeled in FITC (green) and RP11-258P13 labeled in Rhodamine d-UTP (red). Example of patient 17 with a NUP98 disruption due to a recurring t(3;11)(q21;p15) translocation: a strong signal, located on the normal chromosome 11 (arrow head), a green signal on the der(3) chromosome (arrow) and a strong green signal colocalized with a faint red signal on the der(11) chromosome (arrow) (due to the asymetric splitting of the RP11-120E20) are observed. (cm): Detection of NUP98/partner gene fusions by FISH. The two NUP98 BAC probes were labeled by FITC d-UTP (green) and the partner gene probe by Rhodamine d-UTP (red). Arrows indicate the derivative chromosomes. (c) A t(7;11) translocation with NUP98/HOXA; (d) a t(7;11) translocation without HOXA locus rearrangement; (e) an inv(11) inversion with NUP98/DDX10; (f) a t(11;11) translocation with NUP98/DDX10; (g) an ins(11) insertion with NUP98/DDX10; (h) a t(4;11) translocation with NUP98/RAP1GDS1; (i) a t(11;20) translocation with NUP98/TOP1; (j) a t(10;11) translocation with NUP98/ADD3; (k) a t(9;11) with NUP98/PRRX2; (l) a t(6;11) translocation with NUP98/C6ORF80 and (m) a t(X;11)(q28;p15) translocation. For this last patient (no. 17), the NUP98 probe is labeled with FITC and the telomeric probe RP11-479B17 is labeled with rhodamine.

Dual color FISH experiments were performed to characterize the NUP98 fusion partners. For this purpose, we designed BAC and PAC clones spanning loci of the NUP98 partners on the basis of the karyotype and the results of the NUP98 rearrangement FISH screening. For the HOXA complex, we used three PAC clones (RP1-170O19 (AC004080), RP5-1200I23 (AC004996) and RP5-1103I5 (AC004009)) spanning the HOXA3 to the HOXA13 loci. For all the other gene loci, we chose one or two BAC clones covering the entire gene loci (http://genome.ucsc.edu/): RP11-486H4 and RP11-724M22 for RAP1GDS1 gene, RP11-801G16 and RP11-700F9 for DDX10 gene, RP11-350N15 and 675F6 for NSD1, RP11-333B24 for NSD3, RP11-111H12 and 126O24 for TOP1, RP11-641C1 and RP11-702L24 for ADD3, RP11-206H24 for PRRX2 and RP11-900M13 for C6orf80. The BAC RP11-479B17 was used as probe for the telomeric Xqtel. BAC DNA was extracted with QIAfilter Plamid Maxi-Kit (Qiagen) following the manufacturer's instructions and labeled by nick translation with spectrum orange and spectrum green dUTP (Vysis Inc., Downers Grove, IL, USA). Hybridization was performed as described previously.37 The images were captured by a Sensys camera (Photometrics Ltd, Tucson, AZ, USA) and processed with a QFISH software (Leica).

RT–PCR analysis

For patients nos. 1, 2, 3, 12, 13, 15, 19, 61 and 66 we obtained viable bone marrow cells from which total RNA could be extracted and RT–PCR experiments performed. Primer sequences used for these experiments are listed in Figure 2. The PCR products were purified and sequenced.

Figure 2
figure2

PCR experiments. (a) RT-PCR: Patient 15: NUP98 exon13/TOP1 exon 8: tgtcagaccctaagaagaaggaagag – gatggtaaattgaaaaaacccaagaa . Patient 70 and No 3: NUP98 exon 14/DDX10 exon 7: gccaatggagcattcatgcccaa – cacccctgccactttggaaca . Patient 12: NUP98 exon 12/HOXA9 exon 2: tttggagccccccaggccccagtag – ttgatagaaaaaacaacccagcgaa . Patient 1: NUP98 exon 11/RAP1GDS1 exon 2: gggcttggtggtgcaggatttggaacag – atacggaaacaagtgaaaaaatcaa . (b) Quantitative RT-PCR: Detection of NUP98/NSD1 fusion (curve with dots) and NUP98/NSD3 fusion (curve with squares). (c) Oligonucleotide primer sequences: NUP98-1 was used for the amplification of NUP98/HOXA9, NUP98/HOXA11 and NUP98/HOXA13; NUP98-2 was used for the amplification of NUP98/TOP1; NUP98-3 was used for the amplification of NUP98/RAP1GDS1; NUP98-4 was used for the amplification of NUP98/DDX10; NUP98-5 was used for the amplification of NUP98/NSD3and NUP98-6 was used for the amplification of NUP98/NSD1.

Quantitative RT–PCR (Q RT–PCR)

cDNA from patients no. 5 and 13 carrying a t(5;11;12)(q35;p15;q24) translocation and a t(8;11)(p11;p15) translocation, respectively, were amplified with a forward primer specific to NUP98 and two reverse primers specific for NSD1 and NSD3 (see Figure 2), in the presence of the qPCR Master Mix for SYBR green I (Eurogentec, Liege, Belgium). After a denaturation step (10 min at 95°C), 45 cycles of amplification (10 s at 95°C followed by 1 min at 60°C) were performed on a Stratagene MX3000p instrument. For each cycle, data were collected at the end of the extension step. Fluorescence recorded was then plotted against the number of cycles.

Results

NUP98 rearrangements

Dual color FISH experiments using the ‘NUP98 probe’ detected a disruption of the NUP98 gene (see Figure 2b) in 23 patients (35%) (Table 1, GFCH patients). Fourteen patients (60%) were female, four (17%) were children, 11 (48%) had a de novo AML/MDS and eight (35%) a treatment-related AML/MDS. T-ALL was diagnosed in four patients (17%). In the present series no NUP98 rearrangement was found in B-lymphoid malignancies or in chronic myeloproliferative disorders.

Table 1 Clinical and cytogenetic characteristics of 96 patients with rearrangements involving NUP98

A comparison of the karyotypes of patients with and without NUP98 a rearrangement showed that karyotypes with a NUP98 rearrangement were always simple in the stemlines (less than four chromosomal abnormalities), whereas the karyotypes of patients without NUP98 rearrangement were mainly complex. These karyotypes can be obtained upon request to serge.romana@nck.aphp.fr

NUP98 partners detection

Dual color FISH experiments, RT–PCR and RQ–PR were performed to identify the NUP98 partner genes (see Figure 1c-m for FISH results and Figure 2a for RT–PCR and 2b for RQ–PCR). The rearrangements were subdivided into three classes.

Recurrent chromosomal abnormalities involving NUP98

As expected, recurrent chromosomal translocations already described by others were found in the samples studied. A t(7;11)(p15;p15.4). translocation was found in seven patients (nos. 6–9, 11–12, 61): four cases with a de novo acute myelomonocytic leukemia, two with AML with maturation and only one therapy-related AML. In six of the seven patients, dual FISH using a NUP98 probe and a HOXA probe indicated the classical fusion between the two loci (Figure 1c) with a double yellow colocalization on the two derivative chromosomes 7 and 11 besides normal green and red signals, respectively, on the unrearranged chromosomes. Owing to the shortage of material, we could amplify a NUP98 exon 12/HOXA9 exon 1b transcript fusion only in patient 12 (Figure 2a). In patient 61 (Figure 1d), the HOXA signal probe was located on both chromosomes 7, whereas the NUP98 probe generated one signal on the unrearranged chromosome 11, one on the derivative 11 and a third signal colocalized with the HOXA probe on the derivative chromosome 7. Specific RT–PCR did not detect a NUP98/HOXA9, nor NUP98/HOXA11, nor a NUP98/HOXA13 fusion genes in this case. We deduced that a new chromosomal 7p15 breakpoint was involved.

Various chromosome rearrangements involving 11p15 and 11q22 suggesting a NUP98/DDX10 fusion gene were detected in four cases: two cases (no. 4 and 70) with a classical inv(11)(p15q22) inversion, one case (no. 2) with a t(11;11)(p15;q22) translocation and one case (no. 3) with an ins(11)(q22;p11p15) insertion. In the two first cases, dual color FISH experiments with BACs overlapping the DDX10 locus as well as the NUP98 locus confirmed the karyotypic abnormality with a double colocalization on the inverted chromosome 11 (Figure 1e). The same FISH experiment in patient 2 showed a colocalization of signals on the two derivative chromosomes 11 confirming the diagnostic of t(11,11)(p15;q22) translocation (Figure 1f). In patient 3, an ins(11)(q?p11p15.4) insertion was suspected because the der(11) appeared as an acrocentric chromosome. The NUP98 probe generated two signals on the der(11), one on the telomeric part of the small arm and one near the extremity of the long arm. On the other hand, the DDX10 probe generated a signal fused with the telomeric NUP98 11q signal and one, more centromeric, on the der(11)(q22) chromosome (Figure 1g). This combination of signals corresponds to an inverted insertion of the p11p15.4 bands into the DDX10 locus on 11q22. For patients 2 and 3, RT–PCR amplified a NUP98 exon14/DDX10 exon 7 transcript fusion (Figure 2a). These NUP98/DDX10 fusion genes were associated with an acute monocytic leukemia (patient no. 3), an acute myelomonocytic leukemia (patient no. 4), a therapy-related MDS (patient no. 2) and a therapy-related AML (patient no. 70).

A translocation t(4;11)(q21;p15) was observed in patients 4 and 66, both having an T-ALL. By dual color FISH experiments, only interphase nuclei could be analysed in these two patients. Figure 1h shows the signals observed: one red signal coming from the normal RAP1GDS1 locus hybridization, two green signals and a colocalized signal. As the two BACs chosen for RAP1GDS1 detection cover the middle and the 3′ part of the gene and because the classical RAP1GDS1 t(4;11) breakpoint is located in intron 1, we deduced that the signal colocalization represented the NUP98/RAP1GDS1 fusion gene located on the der(11). This was confirmed by specific RT–PCR experiments that showed a NUP98/RAP1GDS1 transcript fusion in both patients (Figure 2a). As a result of material degradation, we could not sequence patient 66 amplification product.

A translocation t(11;20)(p15;q11) was found in two patients: patient 15 with an AML without maturation and patient 16 with a therapy-related AML. Dual color FISH showed a double colocalization signal indicating a NUP98/TOP1 and its reciprocal TOP1/NUP98 fusion (Figure 1i). RT–PCR confirmed this result in patient 15 (Figure 2a).

Patient 5 having a biphenotypic acute leukemia (BAL) presented a t(5;11;12)(q35;p15.4;q24) translocation. FISH could not be performed but RQ–PCR revealed a NUP98/NSD1 fusion transcript (Figure 2b).

Emerging recurrent chromosomal rearrangements

Four translocations can now be classified as recurrent abnormalities since we add a second example to a chromosomal rearrangement reported previously.

A t(8;11)(p11.2;p15. 4) translocation described once by Rosati et al.17 in 2002, was detected in patient 13 and was associated with a therapy-related MDS. This suggested a NUP98/NSD3 fusion that was confirmed by RQ–PCR (Figure 2b).

A t(10;11)(q24;p15) translocation described by Lahortiga et al.32 was found in patient 14 who had a therapy-related AML. With dual color FISH we could demonstrate a NUP98/ADD3 fusion. Indeed, a colocalization of the NUP98 and the ADD3 probes was seen on the der(11). However, no colocalized signal was detected on the der(10) because of the lack of the ADD3 signal on this chromosome. We deduced that the der(10) was bearing a 5ADD3 gene deletion (Figure 1j).

A t(9;11)(q34;p15) translocation first described in 2005 by Gervais et al.,7 was found in patient 18 suffering from a therapy-related leukemia. We used a BAC spanning the PRRX2 gene locus in dual color FISH experiments with the ‘NUP98 probe’ and we detected a double colocalization signal on the two derivative chromosomes indicating a NUP98/PRRX2 fusion (Figure 1k)

A t(6;11)(q21–22;p15) translocation was detected in patient 19 with T-ALL. We found that the BAC RP11-900M13 containing the C6orf80 gene locus was split by the translocation. Dual color FISH experiments with the ‘NUP98 probe’ and BAC RP11-900M13 detected a double colocalization indicating a recombination between the two genes and relocalized the chromosomal 6 breakpoint to 6q24.1 (Figure 1l). Southern blot analysis demonstrated a fusion between NUP98 intron 13 and C6orf80 intron 2 and a specific RT–PCR amplified a fusion between NUP98 exon 13 and C96orf80 exon 2 (A Petit, personal communication). Although this analysis was in progress, Tosi et al. described recently the same fusion gene in a patient who presented with an acute megakaryocytic leukemia (AML-M7).29

New chromosomal rearrangements invloving NUP98

Finally, two new translocations disrupting the NUP98 locus were found in the present study: a t(3;11)(q12.2;p15.4) translocation in two patients, with T-ALL (patient 20) and a MDS (patient 71), and a t(X;11)(q28;p15) translocation in patient 17 having a therapy-related AML. This patient showed a t(5;12) as the only one chromosomal abnormality observed in the stemline and an add(11)(p15) chromosome in two sidelines. FISH with the ‘NUP98 probe’ showed a split NUP98 signal with one signal on the der(11) chromosome and one on a chromosome that looked like a chromosome X on the basis of the DAPI inverted image. To prove that it was a t(X;11) translocation, we cohybridized the NUP98 probe with an Xq telomeric probe. We observed two Xqtel signals, one on the nonrearranged chromosome X and one colocalized with the splitted NUP98 probe signal on the der(11) chromosome. Two other NUP98 probe signals were observed on the nonrearranged chromosome 11 and on the der(X)(qtel) chromosome (Figure 1m). This combination of signals was observed in every mitosis studied. We deduced that patient 17 carried a semicryptic t(X;11)(q28;p15) translocation present in all leukemic cells.

Discussion

FISH analysis of 66 patients with hematological malignancies associated with a chromosome 11p15 anomaly, allowed us to detect 23 (35%) patients carrying a chromosome 11 anomaly involving the NUP98 gene and 12 other loci from various chromosomes. The percentage of NUP98 rearrangements detected in our series is similar to the results observed in a recent study using FISH on patients selected on the presence of 11p13–p15 rearrangements (five patients out of 14: 35%).38 It is higher than the frequency observed by Kobzev et al.4 where seven out of 46 patients studied (15%) had a NUP98 anomaly. As expected, several rearrangements such as those recombining NUP98 with HOXA cluster locus, DDX10, TOP1 and RAPAGDS1 were also observed in the present study. Four translocations t(10;11)(q24;p15), t(6;11)(q24;p15), t(9;11)(q34;p15) considered unique previously and t(8;11)(p11.2;p15) are now emerging as recurrent rearrangements. An unusual rearrangement of NUP98 was observed in a patient with a t(7;11)(p15;p15) translocation but no fusion with any of HOXA genes. This abnormality, resembling the one reported by Takeshita et al.39 in 2004, suggests the existence of alternative breakpoints on chromosome 7. Finally, two new translocations were identified. One involved the NUP98 gene and band 3q21 (two cases). The other one involved band Xq28. The molecular characterization of these chromosomal rearrangements is ongoing.

This study confirms that NUP98 is the target of many chromosomal abnormalities and that, contrary to previous claims, various NUP98 disruptions are found in Caucasians as well as in Asian populations.40, 41, 42, 43

The incidence of chromosome-associated NUP98 rearrangements observed in patients with various hematopoietic malignancies16, 38, 43, 44 is low (1–2%). In comparison, other genes such as MLL, RUNX1 and TEL/ETV6 rearrange frequently in hematological malignant disorders. Owing to this low incidence, it appeared useful to pool the data of our 23 patients to those observed on 73 patients reported the literature (Table 1). Some conclusions can be drawn from the data obtained from this sample of 96 patients.

General cytogenetic characteristics of hematopoietic malignancies associated with a NUP98 fusion gene

All karyotypes of the 96 patients with a NUP98 fusion were simple, that is, with no more than three chromosomal abnormalities before clonal evolution. This is true even in therapy-related AML and MDS patients whose karyotypes are often complex. In contrast, 24 of the 43 patients of this study who did not carry a NUP98 fusion presented a complex karyotype.

As the NUP98 locus is located 3 Mb from the 11p telomere, some NUP98 rearrangements are cryptic (for example the t(5;11)(q34;p15) translocation) or subtle (for example the t(X;11)(q28;p15) translocation). The true incidence of chromosome rearrangements involving the NUP98 locus may be underestimated at the present time. Screening other patients using FISH should unravel other rearrangements involving NUP98.

General clinical-hematological data in patients with a NUP98 fusion gene

Eighty percent of the 96 patients with disruption of the NUP98 gene have AML or MDS. Three quarters occurred de novo and one quarter were therapy-related AML or MDS. The de novo AML group is mainly composed of AML with maturation (AML-M2) (60%) and myelomonocytic leukemia (AML-M4) (about 20%). Only 8% of the patients were suffering from MDS (4% de novo and 4% therapy related). Interestingly, 12% were associated with a T-ALL. Also, no B-lymphoid proliferation was associated with a disruption of the NUP98 gene.

The NUP98 gene partners can be classified in three groups

As far as we know, already 19 genes are described as fused to NUP98 in various hematopoietic malignancies. The most common NUP98 gene partners are the HOX gene family, DDX10, the NSD gene family, the Topoisomerase (TOP1 and TOP2B) genes and RAP1GDS1. All these genes have been reported to fuse with NUP98 at least eight times (Table 1). According to the clinico-hematological data, we propose to subclassify these genes in three groups.

The first group is composed of genes that are mainly associated with de novo myeloid malignancies. It comprises the HOX and the NSD genes. Indeed 33 of 37 (90%) of NUP98/HOX fusions and 11 of 12 (90%) of NUP98/NSD fusions were found in de novo myeloid malignancies. The contribution of each HOX gene as well as the NSD1 and NSD3 genes in NUP98/HOX and NUP98/NSD fusions are indicated in Table 1. Patients with NUP98/HOX fusions tend to be older than patients with NUP98/NSD fusions (6/37 and 8/12 younger than 20 years, respectively). Interestingly, in both translocations, most of the translocation breakpoints lie within introns 11 or 12 (Figure 3).

Figure 3
figure3

NUP98 breakpoints localization. Molecular data of 92 -NUP98/partner genes show a NUP98 clustering of genomic breakpoints depending on the partner gene. Each partner gene is listed above the NUP98 specific breakpoints. The figure after the NUP98 partner genes indicates the number of patients bearing this NUP98/partner fusion.

Both HOX and NSD genes are involved in morphogenetic processes occurring during embryogenesis. The HOX genes form a complex system playing a major role in the organization of the antero-posterior axis and segmentation of the body. In addition to their role during embryogenesis, it has been demonstrated that HOX genes are involved during normal hematopoiesis.45, 46, 47, 48 The NUP98/HOX fusion generates an hybrid protein with an homeodomain fused to the GLFG domain of NUP98. In mouse models, the Nup98/Hox fusion proteins have transforming potentialities49, 50 dependent on the integrity of the HOX homeodomain. The FG repeats of the Nup98 moiety are also essential to provide these transforming properties presumably through the recruitment of transcriptional coactivators such as CBP/p300.36 NSD1 and NSD3 encode (as NSD2) a nuclear-receptor set domain proteins. Constitutional haploinsufficiency of NSD1 and NSD2 induces congenital malformations, respectively Sotos51 and Wolf-Hirschhorn syndromes.52 The N-terminal part of NSD protein contains a nuclear receptor interactive domain. The middle and the C-terminal part contain five PHD domains and a SET domain, as in the Trx and polycomb proteins, two protein families known for their role in the regulation of HOX gene expression during embryogenesis. However, the precise role of NSD proteins either during embryogenesis or during hematopoiesis are still unknown. In the majority of NUP98/NSD fusions studied, the breakpoints are located in intron 12 of NUP98 (6/8), in intron 5 of NSD1 and in intron 3 of NSD3. The hybrid protein contains the N-terminal GLFG Nup98 domain fused to almost the entire NSD protein except its nuclear receptor interactive N-terminal domain. The precise role of these fusion proteins during the leukemic processes remains to be investigated.

The second group is composed of genes that are often associated with therapy-related myeloid disorders. It comprises the TOP family genes (TOP1 and TOP2), and DDX10. Indeed, seven of 13 cases of NUP98 fusions with DDX10 and five of 10 fusions with TOP1 are found in therapy-related myeloid disorders. Together, they account for 25% of NUP98 partners, 14% (13/96) for DDX10 and 11% (11/96) for TOP1 and TOP2B (Table 1). In half of the patients with NUP98 gene fusion the hematologic disorder occurs in young patients, that is, less than 20 years old. Surprisingly, nine of 10 patients with a NUP98/TOP1 fusion were females. Interestingly, In fusions involving these genes, the breakpoints localisation within NUP98 are nonrandom (Figure 3). They were located within intron 13 of the NUP98 gene in all cases of NUP98/TOP1 fusions and mainly in intron 14 (10 patients, and only one in intron 12) in NUP98/DDX10 fusions. Genes of this group are all involved in unwinding and relaxing nucleic acid molecules.

The third group has only one member, the RAP1GDS1 gene which is involved in T-ALL (all the eight cases reported until now). NUP98/RAP1GDS1 fusions represent 9% (8/96) of the NUP98 fusion genes (Table 1). Half of these patients are less 20 years old. There is no sex ratio deviation. In contrast to gene of group 1 and 2, the RAP1GDS1 gene codes for smgGDS, a cytoplasmic protein belonging to the Armadillo (ARM) family proteins. SmgGDS promotes guanine nucleotide exchange by small GTPases like Rac1 and RhoA. In this way, it interferes with the regulation of the actin assembly associated with membrane ruffling.53 Different kinds of fusion transcripts can be generated by the t(4;11)(q21;p15) translocation. Until now, seven patients have been studied at the molecular level. The localisation of the breakpoints was always within the intron 1 of RAP1GDS1 gene and intron 12 (five of the seven patients), intron10 (one)30 and intron 11 (one of our cases) (Figure 3) of the NUP98 gene. All these fusion transcripts encode a chimeric protein composed in its N-terminal part of the GLFG Nup98 domain and the entire protein smgGDS except its initial methionine. To date the involvement of Nup98/smgGDS in the leukemic process has not been proven in any experimental model.

The three groups represent altogether 86% of the NUP98 fusions known today. The other 14% involved the PRRX, LEDGF, ADD3 and C6orf80 genes. It is too early to class them in one of the groups delineated above.

In conclusion, the validity of the classification of NUP98 fusions proposed here remains questionable until more data are obtained on the function of the genes involved. If specific pathways are correlated with some fusions or common to all of them remains an open question. The use of microarray technology will help to answer this question. Two major conclusions may be drawn from the present study. Firstly, owing to their cryptic nature, there are probably further rearrangements which remain to be detected by cytogenetic and FISH methods. The detection of any new gene fusion and the analysis of its consequences will contribute to our understanding of the role of NUP98 fusion genes. Secondly, the GFCH study included any hematopoietic disorders associated with a 11p15 abnormality. Only 23 exhibited a NUP98 rearrangement. Analysis of patients with a 11p15 rearrangement not involving NUP98 deserves further studies.

References

  1. 1

    Nakamura T, Largaespada DA, Lee MP, Johnson LA, Ohyashiki K, Toyama K et al. Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia. Nat Genet 1996; 12: 154–158.

  2. 2

    Borrow J, Shearman AM, Stanton Jr VP, Becher R, Collins T, Williams AJ et al. The t(7;11)(p15;p15) translocation in acute myeloid leukaemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9. Nat Genet 1996; 12: 159–167.

  3. 3

    Slape C, Aplan PD . The role of NUP98 gene fusions in hematologic malignancy. Leuk Lymphoma 2004; 45: 1341–1350.

  4. 4

    Kobzev YN, Martinez-Climent J, Lee S, Chen J, Rowley JD . Analysis of translocations that involve the NUP98 gene in patients with 11p15 chromosomal rearrangements. Genes Chromosomes Cancer 2004; 41: 339–352.

  5. 5

    Lahortiga I, Belloni E, Vazquez I, Agirre X, Larrayoz MJ, Vizmanos JL et al. NUP98 is fused to HOXA9 in a variant complex t(7;11;13;17) in a patient with AML-M2. Cancer Genet Cytogenet 2005; 157: 151–156.

  6. 6

    Nakamura T, Yamazaki Y, Hatano Y, Miura I . NUP98 is fused to PMX1 homeobox gene in human acute myelogenous leukemia with chromosome translocation t(1;11)(q23;p15). Blood 1999; 94: 741–747.

  7. 7

    Gervais C, Mauvieux L, Perrusson N, Helias C, Struski S, Leymarie V et al. A new translocation t(9;11)(q34;p15) fuses NUP98 to a novel homeobox partner gene, PRRX2, in a therapy-related acute myeloid leukemia. Leukemia 2005; 19: 145–148.

  8. 8

    Ahuja HG, Hong J, Aplan PD, Tcheurekdjian L, Forman SJ, Slovak ML . t(9;11)(p22;p15) in acute myeloid leukemia results in a fusion between NUP98 and the gene encoding transcriptional coactivators p52 and p75-lens epithelium-derived growth factor (LEDGF). Cancer Res 2000; 60: 6227–6229.

  9. 9

    Hussey DJ, Moore S, Nicola M, Dobrovic A . Fusion of the NUP98 gene with the LEDGF/p52 gene defines a recurrent acute myeloid leukemia translocation. BMC Genet 2001; 2: 20.

  10. 10

    Grand FH, Koduru P, Cross NC, Allen SL . NUP98-LEDGF fusion and t(9;11) in transformed chronic myeloid leukemia. Leuk Res 2005; 29 (12): 1469–1472.

  11. 11

    Morerio C, Acquila M, Rosanda C, Rapella A, Tassano E, Micalizzi C et al. t(9;11)(p22;p15) with NUP98-LEDGF fusion gene in pediatric acute myeloid leukemia. Leuk Res 2005; 29: 467–470.

  12. 12

    Jaju RJ, Fidler C, Haas OA, Strickson AJ, Watkins F, Clark K et al. A novel gene, NSD1, is fused to NUP98 in the t(5;11)(q35;p15.5) in de novo childhood acute myeloid leukemia. Blood 2001; 98: 1264–1267.

  13. 13

    Panarello C, Rosanda C, Morerio C . Cryptic translocation t(5;11)(q35;p15.5) with involvement of the NSD1 and NUP98 genes without 5q deletion in childhood acute myeloid leukemia. Genes Chromosomes Cancer 2002; 35: 277–281.

  14. 14

    Brown J, Jawad M, Twigg SR, Saracoglu K, Sauerbrey A, Thomas AE et al. A cryptic t(5;11)(q35;p15.5) in 2 children with acute myeloid leukemia with apparently normal karyotypes, identified by a multiplex fluorescence in situ hybridization telomere assay. Blood 2002; 99: 2526–2531.

  15. 15

    La Starza R, Gorello P, Rosati R, Riezzo A, Veronese A, Ferrazzi E et al. Cryptic insertion producing two NUP98/NSD1 chimeric transcripts in adult refractory anemia with an excess of blasts. Genes Chromosomes Cancer 2004; 41: 395–399.

  16. 16

    Cerveira N, Correia C, Doria S, Bizarro S, Rocha P, Gomes P et al. Frequency of NUP98-NSD1 fusion transcript in childhood acute myeloid leukaemia. Leukemia 2003; 17 (11): 2244–2247.

  17. 17

    Rosati R, La Starza R, Veronese A, Aventin A, Schwienbacher C, Vallespi T et al. NUP98 is fused to the NSD3 gene in acute myeloid leukemia associated with t(8;11)(p11.2;p15). Blood 2002; 99: 3857–3860.

  18. 18

    Arai Y, Hosoda F, Kobayashi H, Arai K, Hayashi Y, Kamada N et al. The inv(11)(p15q22) chromosome translocation of de novo and therapy-related myeloid malignancies results in fusion of the nucleoporin gene, NUP98, with the putative RNA helicase gene, DDX10. Blood 1997; 89: 3936–3944.

  19. 19

    Yamamoto M, Kakihana K, Kurosu T, Murakami N, Miura O . Clonal evolution with inv(11)(p15q22) and NUP98/DDX10 fusion gene in imatinib-resistant chronic myelogenous leukemia. Cancer Genet Cytogenet 2005; 157: 104–108.

  20. 20

    Ikeda T, Ikeda K, Sasaki K, Kawakami K, Takahara J . The inv(11)(p15q22) chromosome translocation of therapy-related myelodysplasia with NUP98-DDX10 and DDX10-NUP98 fusion transcripts. Int J Hematol 1999; 69: 160–164.

  21. 21

    Nakao K, Nishino M, Takeuchi K, Iwata M, Kawano A, Arai Y et al. Fusion of the nucleoporin gene, NUP98, and the putative RNA helicase gene, DDX10, by inversion 11 (p15q22) chromosome translocation in a patient with etoposide-related myelodysplastic syndrome. Intern Med 2000; 39: 412–415.

  22. 22

    Ahuja HG, Felix CA, Aplan PD . The t(11;20)(p15;q11) chromosomal translocation associated with therapy-related myelodysplastic syndrome results in an NUP98-TOP1 fusion. Blood 1999; 94: 3258–3261.

  23. 23

    Potenza L, Sinigaglia B, Luppi M, Morselli M, Saviola A, Ferrari A et al. A t(11;20)(p15;q11) may identify a subset of nontherapy-related acute myelocytic leukemia. Cancer Genet Cytogenet 2004; 149: 164–168.

  24. 24

    Iwase S, Akiyama N, Sekikawa T, Saito S, Arakawa Y, Horiguchi-Yamada J et al. Both NUP98/TOP1 and TOP1/NUP98 transcripts are detected in a de novo AML with t(11;20)(p15;q11). Genes Chromosomes Cancer 2003; 38: 102–105.

  25. 25

    Ahuja HG, Felix CA, Aplan PD . Potential role for DNA topoisomerase II poisons in the generation of t(11;20)(p15;q11) translocations. Genes Chromosomes Cancer 2000; 29: 96–105.

  26. 26

    Chen S, Xue Y, Chen Z, Guo Y, Wu Y, Pan J . Generation of the NUP98-TOP1 fusion transcript by the t(11;20) (p15;q11) in a case of acute monocytic leukemia. Cancer Genet Cytogenet 2003; 140: 153–156.

  27. 27

    Nebral K, Schmidt HH, Haas OA, Strehl S . NUP98 is fused to topoisomerase (DNA) IIbeta 180 kDa (TOP2B) in a patient with acute myeloid leukemia with a new t(3;11)(p24;p15). Clin Cancer Res 2005; 11: 6489–6494.

  28. 28

    Arai Y, Kyo T, Miwa H, Arai K, Kamada N, Kita K et al. Heterogenous fusion transcripts involving the NUP98 gene and HOXD13 gene activation in a case of acute myeloid leukemia with the t(2;11)(q31;p15) translocation. Leukemia 2000; 14: 1621–1629.

  29. 29

    Tosi S, Ballabio E, Teigler-Schlegel A, Boultwood J, Bruch J, Harbott J . Characterization of 6q abnormalities in childhood acute myeloid leukemia and identification of a novel t(6;11)(q24.1;p15.5) resulting in a NUP98-C6orf80 fusion in a case of acute megakaryoblastic leukemia. Genes Chromosomes Cancer 2005; 44 (3): 225–232.

  30. 30

    Hussey DJ, Nicola M, Moore S, Peters GB, Dobrovic A . The (4;11)(q21;p15) translocation fuses the NUP98 and RAP1GDS1 genes and is recurrent in T-cell acute lymphocytic leukemia. Blood 1999; 94: 2072–2079.

  31. 31

    Mecucci C, La Starza R, Negrini M, Sabbioni S, Crescenzi B, Leoni P et al. t(4;11)(q21;p15) translocation involving NUP98 and RAP1GDS1 genes: characterization of a new subset of T acute lymphoblastic leukaemia. Br J Haematol 2000; 109: 788–793.

  32. 32

    Lahortiga I, Vizmanos JL, Agirre X, Vazquez I, Cigudosa JC, Larrayoz MJ et al. NUP98 is fused to adducin 3 in a patient with T-cell acute lymphoblastic leukemia and myeloid markers, with a new translocation t(10;11)(q25;p15). Cancer Res 2003; 63: 3079–3083.

  33. 33

    Griffis ER, Altan N, Lippincott-Schwartz J, Powers MA . Nup98 is a mobile nucleoporin with transcription-dependent dynamics. Mol Biol Cell 2002; 13: 1282–1297.

  34. 34

    Griffis ER, Xu S, Powers MA . Nup98 localizes to both nuclear and cytoplasmic sides of the nuclear pore and binds to two distinct nucleoporin subcomplexes. Mol Biol Cell 2003; 14: 600–610.

  35. 35

    Dokudovskaya S, Veenhoff LM, Rout MP . Cleave to leave: structural insights into the dynamic organization of the nuclear pore complex. Mol Cell 2002; 10: 221–223.

  36. 36

    Kasper LH, Brindle PK, Schnabel CA, Pritchard CE, Cleary ML, van Deursen JM . CREB binding protein interacts with nucleoporin-specific FG repeats that activate transcription and mediate NUP98-HOXA9 oncogenicity. Mol Cell Biol 1999; 19: 764–776.

  37. 37

    Romana SP, Le Coniat M, Berger R . t(12;21): a new recurrent translocation in acute lymphoblastic leukemia. Genes Chromosomes Cancer 1994; 9: 186–191.

  38. 38

    Nebral K, Konig M, Schmidt HH, Lutz D, Sperr WR, Kalwak K et al. Screening for NUP98 rearrangements in hematopoietic malignancies by fluorescence in situ hybridization. Haematologica 2005; 90: 746–752.

  39. 39

    Takeshita A, Naito K, Shinjo K, Sahara N, Matsui H, Ohnishi K et al. Deletion 6p23 and add(11)(p15) leading to NUP98 translocation in a case of therapy-related atypical chronic myelocytic leukemia transforming to acute myelocytic leukemia. Cancer Genet Cytogenet 2004; 152: 56–60.

  40. 40

    Sato Y, Abe S, Mise K, Sasaki M, Kamada N, Kouda K et al. Reciprocal translocation involving the short arms of chromosomes 7 and 11, t(7p−;11p+), associated with myeloid leukemia with maturation. Blood 1987; 70: 1654–1658.

  41. 41

    Kwong YL, Liu HW, Chan LC . Racial predisposition to translocation (7;11). Leukemia 1992; 6: 232.

  42. 42

    Huang SY, Tang JL, Liang YJ, Wang CH, Chen YC, Tien HF . Clinical, haematological and molecular studies in patients with chromosome translocation t(7;11): a study of four Chinese patients in Taiwan. Br J Haematol 1997; 96: 682–687.

  43. 43

    Kwong YL, Pang A . Low frequency of rearrangements of the homeobox gene HOXA9/t(7;11) in adult acute myeloid leukemia. Genes Chromosomes Cancer 1999; 25: 70–74.

  44. 44

    Nishiyama M, Arai Y, Tsunematsu Y, Kobayashi H, Asami K, Yabe M et al. 11p15 translocations involving the NUP98 gene in childhood therapy-related acute myeloid leukemia/myelodysplastic syndrome. Genes Chromosomes Cancer 1999; 26: 215–220.

  45. 45

    Sauvageau G, Lansdorp PM, Eaves CJ, Hogge DE, Dragowska WH, Reid DS et al. Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells. Proc Natl Acad Sci USA 1994; 91: 12223–12227.

  46. 46

    Giampaolo A, Pelosi E, Valtieri M, Montesoro E, Sterpetti P, Samoggia P et al. HOXB gene expression and function in differentiating purified hematopoietic progenitors. Stem Cells 1995; 13: 90–105.

  47. 47

    Kawagoe H, Humphries RK, Blair A, Sutherland HJ, Hogge DE . Expression of HOX genes, HOX cofactors, and MLL in phenotypically and functionally defined subpopulations of leukemic and normal human hematopoietic cells. Leukemia 1999; 13: 687–698.

  48. 48

    Pineault N, Helgason CD, Lawrence HJ, Humphries RK . Differential expression of Hox, Meis1, and Pbx1 genes in primitive cells throughout murine hematopoietic ontogeny. Exp Hematol 2002; 30: 49–57.

  49. 49

    Kroon E, Thorsteinsdottir U, Mayotte N, Nakamura T, Sauvageau G . NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. Embo J 2001; 20: 350–361.

  50. 50

    Lin YW, Slape C, Zhang Z, Aplan PD . NUP98-HOXD13 transgenic mice develop a highly penetrant, severe myelodysplastic syndrome that progresses to acute leukemia. Blood 2005; 106: 287–295.

  51. 51

    Kurotaki N, Imaizumi K, Harada N, Masuno M, Kondoh T, Nagai T et al. Haploinsufficiency of NSD1 causes Sotos syndrome. Nat Genet 2002; 30: 365–366.

  52. 52

    Stec I, Wright TJ, van Ommen GJ, de Boer PA, van Haeringen A, Moorman AF et al. WHSC1, a 90 kb SET domain-containing gene, expressed in early development and homologous to a Drosophila dysmorphy gene maps in the Wolf-Hirschhorn syndrome critical region and is fused to IgH in t(4;14) multiple myeloma [published erratum appears in Hum Mol Genet 1998 Sep;7(9):1527]. Hum Mol Genet 1998; 7: 1071–1082.

  53. 53

    Chuang TH, Xu X, Quilliam LA, Bokoch GM . SmgGDS stabilizes nucleotide-bound and -free forms of the Rac1 GTP-binding protein and stimulates GTP/GDP exchange through a substituted enzyme mechanism. Biochem J 1994; 303: 761–767.

  54. 54

    Suzuki A, Ito Y, Sashida G, Honda S, Katagiri T, Fujino T et al. t(7;11)(p15;p15) Chronic myeloid leukaemia developed into blastic transformation showing a novel NUP98/HOXA11 fusion. Br J Haematol 2002; 116: 170–172.

  55. 55

    Taketani T, Taki T, Ono R, Kobayashi Y, Ida K, Hayashi Y . The chromosome translocation t(7;11)(p15;p15) in acute myeloid leukemia results in fusion of the NUP98 gene with a HOXA cluster gene, HOXA13, but not HOXA9. Genes Chromosomes Cancer 2002; 34: 437–443.

  56. 56

    Fujimura T, Ohyashiki K, Ohyashiki JH, Kawakubo K, Iwabuchi A, Kodama A et al. Two additional cases of acute myeloid leukemia with t(7;11)(p15;p15) having low neutrophil alkaline phosphatase scores. Cancer Genet Cytogenet 993; 68: 143–146.

  57. 57

    Hatano Y, Miura I, Nakamura T, Yamazaki Y, Takahashi N, Miura AB . Molecular heterogeneity of the NUP98/HOXA9 fusion transcript in myelodysplastic syndromes associated with t(7;11)(p15;p15). Br J Haematol 1999; 107: 600–604.

  58. 58

    Morris CM, Fitzgerald PH, Kennedy MA, Hollings PE, Garry M, Corbett GM . HRAS1 and INS genes are relocated but not structurally altered as a result of the t(7;11)(p15;p15) in a clone from a patient with acute myeloid leukaemia (M4). Br J Haematol 1989; 71: 481–486.

  59. 59

    Ahuja HG, Popplewell L, Tcheurekdjian L, Slovak ML . NUP98 gene rearrangements and the clonal evolution of chronic myelogenous leukemia. Genes Chromosomes Cancer 2001; 30: 410–415.

  60. 60

    Wong KF, So CC, Kwong YL . Chronic myelomonocytic leukemia with t(7;11)(p15;p15) and NUP98/HOXA9 fusion. Cancer Genet Cytogenet 1999; 115: 70–72.

  61. 61

    Gu BW, Wang Q, Wang JM, Xue YQ, Fang J, Wong KF et al. Major form of NUP98/HOXC11 fusion in adult AML with t(11;12)(p15;q13) translocation exhibits aberrant trans-regulatory activity. Leukemia 2003; 17: 1858–1864.

  62. 62

    Panagopoulos I, Isaksson M, Billstrom R, Strombeck B, Mitelman F, Johansson B . Fusion of the NUP98 gene and the homeobox gene HOXC13 in acute myeloid leukemia with t(11;12)(p15;q13). Genes Chromosomes Cancer 2003; 36: 107–112.

  63. 63

    La Starza R, Trubia M, Crescenzi B, Matteucci C, Negrini M, Martelli MF et al. Human homeobox gene HOXC13 is the partner of NUP98 in adult acute myeloid leukemia with t(11;12)(p15;q13). Genes Chromosomes Cancer 2003; 36: 420–423.

  64. 64

    Shimada H, Arai Y, Sekiguchi S, Ishii T, Tanitsu S, Sasaki M . Generation of the NUP98-HOXD13 fusion transcript by a rare translocation, t(2;11)(q31;p15), in a case of infant leukaemia. Br J Haematol 2000; 110: 210–213.

  65. 65

    Jaju RJ, Haas OA, Neat M, Harbott J, Saha V, Boultwood J et al. A new recurrent translocation, t(5;11)(q35;p15.5), associated with del(5q) in childhood acute myeloid leukemia. The UK Cancer Cytogenetics Group (UKCCG). Blood 1999; 94: 773–780.

  66. 66

    Cerveira N, Correia C, Doria S, Bizarro S, Rocha P, Gomes P et al. Frequency of NUP98-NSD1 fusion transcript in childhood acute myeloid leukaemia. Leukemia 2003.

  67. 67

    Cimino G, Sprovieri T, Rapanotti MC, Foa R, Mecucci C, Mandelli F . Molecular evaluation of the NUP98/RAP1GDS1 gene frequency in adults with T-acute lymphoblastic leukemia. Haematologica 2001; 86: 436–437.

Download references

Acknowledgements

We gratefully acknowledge S Nusbaum and F Poulain for excelent technical assistance. This work was supported by the Ligue contre le cancer (labeled team: SPR, IRW, AP, C.S, FNK, OAB, RB).

Author information

Correspondence to S P Romana.

Appendix

Appendix

The Appendix lists the name of the institute, with the center and number of cases in parentheses, followed by the names of other participants. CHU Toulouse (Toulouse; n=12): Eliane Duchayne, Cécile Demur, Blandine Roquefeuil, Alain Robert, Françoise Huguet, Christian Recher; CHU Nantes (Nantes; n=9); Hôpital Haut Lévêque (Bordeaux; n=7): Yves Perel, Arnaud Pigneux; CHU Dijon (Dijon; n=6): Patrick Callier, Bernardine Favre-Audry, Marc Maynadie, Denis Caillot; Institut Paoli Calmettes (Marseille; n=4): Danielle Sainty, Christine Arnoulet, Norbert Vey, Diane Coso, Aude Charbonnier; Hopital Jeanne de Flandre (Lille; n=4); CH Versailles (Versailles; n=4): Isabelle Garcia, Sylvie Castaigne; Institut de Pathologie et Genetique (Gerpinnes, Belgium; n=3): P Vannuffel, A Delannoy, M Andre, P Mineur; CHU Reims (Reims; n=3) Chantal Himberlin et Sylvie Daliphard; CHU Hôpital Nord (St Etienne, n=3); Groupe Hospitalier Pitié-Salpétrière (Paris; n=2): J.Ong; CHU St Antoine (Paris; n=2); CH Chambéry (Chambéry; n=2); Hôpital Universitaire de Genève (Genève, Switzerland; n=2): Claudine Helg, CHU St Louis (Paris; n=1), Hôpital E.Herriot (Lyon, n=1); Cliniques Universitaires StLuc (Bruxelles, Belgium: n=1)

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Romana, S., Radford-Weiss, I., Ben Abdelali, R. et al. NUP98 rearrangements in hematopoietic malignancies: a study of the Groupe Francophone de Cytogénétique Hématologique. Leukemia 20, 696–706 (2006) doi:10.1038/sj.leu.2404130

Download citation

Keywords

  • leukemia
  • chromosome 11p15
  • NUP98
  • FISH

Further reading