Minimal Residual Disease in B Cell Malignancies

Improved assessment of minimal residual disease in B cell malignancies using fluorogenic consensus probes for real-time quantitative PCR

Article metrics

Abstract

PCR of clonally rearranged immunoglobulin heavy chain (IgH) gene sequences is increasingly used for detection of minimal residual disease (MRD) in lymphoid malignancies. Inherent quantitating problems are the main drawbacks of traditional PCR technologies. These limitations have been overcome by the recently developed real-time quantitative PCR (RQ PCR) technology. However, clinical application of the few published RQ PCR assays targeting immune gene rearrangements is hampered by the expensive and time-consuming need for individual hybridization probes for each patient. We have developed a new RQ PCR strategy targeting clonally rearranged IgH sequences that solves this problem. The method uses only two different JHhybridization probes and four downstream JH primers homologous to consensus germline JH gene segments. In combination with an allele-specific upstream (ASO) primer the consensus JH probes and primers allow quantitation of about 90% of possible IgH rearrangements. In a series of 22 B-lineage ALL the new assay allowed the detection of one to 10 blasts in a background of 105 normal cells. To prove the clinical utility we quantified MRD in 23 follow-up samples of six ALL patients with the new assay in comparison with a published RQ PCR technique that used individually designed primer/probe sets. We showed that the sensitivity of the new RQ PCR assay was slightly higher for four of the six cases and about 100-fold higher for one case, enabling detection of an increasing MRD level as an indicator of subsequent relapse 44 weeks earlier compared to the ASO probe assay in this particular patient. The results suggest, that the novel RQ PCR assay is a rapid, technically simple, reliable, and sensitive alternative to traditional quantification assays and simplifies current approaches of monitoring MRD in clinical trials.

Introduction

Although complete remissions are nowadays obtained in the majority of patients with acute lymphoblastic leukemia (ALL), a significant proportion – depending mainly on pretherapeutic risk-factors – relapse and die of their disease.1 Several studies showed that quantitative measurement of MRD is useful as an independent risk factor for individual patients in ALL. Polymerase chain reaction (PCR) is the most sensitive and widely applicable method for MRD detection.234567 IgH gene rearrangements can be used as molecular targets for tumor-specific detection of MRD in about 90% of B-lineage ALL17 and in approximately 80% of lymphoma and myeloma patients.8 Traditional quantitative PCR assays usually rely on end point data collection resulting in PCR inherent quantitating problems as broad standard deviations of final PCR product amounts.2910 As a result, the quantitative potential of these tests is limited.

RQ PCR applying TaqMan technology is a new method for quantitative assessment of MRD.911121314 This technique uses an oligonucleotide hybridization probe in combination with standard amplification primers. The probe positioned internally to the PCR primers is labelled with a reporter fluorescent dye at the 5′ end and a quenching dye at the 3′ end. While fluorescence of the intact probe is quenched, 5′–3′ nuclease activity of the polymerase leads to separation of the dyes during amplification by degradation of the probe which results in an increase of reporter dye fluorescence intensity. The quantitative amount of PCR products is continuously (‘real-time’) monitored during the cycles allowing the rapid quantitation over several orders of magnitude without need for post-PCR processing.151617 However, a major disadvantage of the published RQ PCR assays using gene rearrangements as clonal markers for MRD is the utilization of specific TaqMan probes for every individual patient.913 Clone-specific TaqMan probes are not only expensive but also time-consuming to design and to test which limits their applicability in clinical settings. In addition, when used in combination with consensus primers sensitivity of RQ PCR compared to traditional quantitative PCR assays seems to be reduced.13

The present work was done to overcome these limitations by creating probes and downstream primers to consensus regions of the IgH gene joining (JH) elements that are suitable for the majority of IgH gene rearrangements. In combination with upstream ASO primers spanning the unique marker sequence of the IgH-CDR3 regions consensus germline JH primers and probes were tested for their applicability to RQ PCR MRD assays. The method was evaluated on DNA extracts of 22 patients with B-lineage ALL with a PCR amplifiable IgH rearrangement. We compared the sensitivity of this new approach with a RQ PCR technique utilizing patient-specific probes. It is shown that the new assay can accurately quantitate residual leukemia with a detection limit of one leukemia cell per 104 to 105 normal cells. The usefulness of the established RQ PCR assay for assessment of MRD was demonstrated on follow-up samples of six patients.

Materials and methods

Clinical samples

Diagnostic DNA samples from 22 patients with B-lineage ALL were selected for this study. In addition, two to five follow-up samples of cases 1–6 were investigated for quantitative MRD. All patients were participants in the German Multicenter ALL-Study Group and were enrolled in the study between 1988 and 1998. Type of ALL was determined by immunophenotyping and morphology in all cases. Mononuclear cells (MNC) were isolated from all samples and stored at −70°C before DNA extraction. Pooled MNC-DNA from equivalent amounts of five healthy donors served as polyclonal control. DNA was isolated by standard procedures using an DNA isolation kit (Boehringer Mannheim, Mannheim, Germany), and quantified by luminescence spectrometer analysis (Biotech Ultraspec 3000, Pharmacia, Cambridge, UK).

IgH-CDR3 consensus PCR and fluorescent fragment analysis

The standard PCR assay with consensus VH and JH primers used for identification of monoclonal IgH-CDR3 rearrangements followed a previously described protocol.18 The reaction tubes for PCR contained 0.5 μg of genomic DNA, 5 pmol of each primer, 2 units of UItma DNA polymerase (PE Biosystems, Foster City, CA, USA) and 80 μM of each deoxyribonucleotide in a final volume of 30 μl reaction buffer. PCR was performed for 35 cycles in a Model 9600 thermal cycler (PE Biosystems). Cycle conditions were: denaturation at 96°C for 1 min and annealing/extension at 55°C for 45 s with extension of the first denaturation step to 7 min and a final primer elongation step of 10 min at 70°C. PCR was hot start initiated by adding BioWax (Biozym, Hameln, Germany) to the reaction tubes. The VH primer was labelled at its 5′ end with 6′ FAM (6-carboxyfluorescein) (PE Biosystems) for automated fluorescent fragment analysis (genescanning) of the generated PCR products. Reaction products were analyzed on an ABI PRISM 377 (PE Biosystems) by exact size determination and quantitative measurement of fluorescence intensity with the genescan software (PE Biosystems) after electrophoresis on a high resolution polyacrylamide gel. PCR products with a dominant monoclonal genescanning pattern were sequenced directly using the BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems) on the ABI PRISM 377 automated sequencer (for details see Ref. 19).19 Monoclonal PCR products with significant background bands were sequenced after cloning.20 JH elements and individual DH segments were identified by comparison with published germline sequences.212223242526

RQ PCR primers and probes

Oligonucleotide design for ASO probe RQ PCR approach:

Clone-specific TaqMan probes complementary to CDR3 (N-DH–N) sequences of six patients (cases 1–6) were designed in combination with upstream VH–N (or VH–N–DH) and downstream germline JH primers using Primer Express software (PE Biosystems).

Oligonucleotide design for consensus probe RQ PCR approach:

Two different consensus JH probes (JHQ1/4/5 and JHQ6) were designed using published germline JH sequences (Table 1).2122 These two probes span areas with the highest degree of homology among different JH gene families and fit to around 90% of all known JH rearrangements.27 JHQ1/4/5 fits to the JH1, JH4 and JH5 family, JHQ6 to the JH6 family. All probes were labelled at the 5′-end with a reporter dye (FAM = 6-carboxyfluorescein), at the 3′-end with a quencher dye (TAMRA = 6-carboxytetramethylrhodamine) and phosphorylated at the 3′-end to prevent extension during PCR.

Table 1  Oligonucleotides used for the RQ PCR assays

For each JH family one reverse primer was designed using the Primer Express software (Table 1). The only oligonucleotides that had to be created individually for every single patient were the upstream primers. For 22 patients (including cases 1–6 which for comparison were also analyzed with the ‘ASO probe’ RQ PCR approach) ASO upstream primers were designed using the sequence information of the IgH-CDR3 (N–D–N) junction.

RQ PCR

RQ PCR was performed in MicroAmp reaction tubes (PE Biosystems) on an ABI PRISM 7700 thermal cycler (PE Biosystems). Twenty-five μl PCR mixture contained 12.5 μl 2 × TaqMan Universal Mastermix (PE Biosystems), including AmpErase Uracil N-Glycosylase (UNG) and dUTP instead of dGTP as carry-over protection, 50–900 nM of each primer (assay-specific concentrations are shown in Table 2), 200 nM probe, sterile water (Merck, Darmstadt, Germany) and 1 μg genomic DNA. Initial testings were done in 50 μl final volumes. After two steps of 2 min at 50°C for UNG activation and 10 min at 95°C for AmpliTaq Gold activation DNA was subjected to 40 cycles of PCR with denaturation at 95°C for 15 s followed by a combined annealing/extension step at 59–65°C for 30 s (for assay-specific annealing/extension temperatures see Table 2).

Table 2  PCR conditions, utilized consensus oligonucleotides and sensitivites for RQ PCR assays using consensus probes. Allele-specific oligonucleotides (ASO) spanning the patient specific IgH-CDR3-region serve as upstream primers. ASO sequences are shown in Table 3

Based on the 5′–3′ exonuclease activity of Taq DNA polymerase double-labelled fluorogenic probes are cleaved during PCR. This results in a stepwise increase of reporter dye fluorescence due to increasing numbers of unquenched reporter molecules. Sequence detection software (SDS) (PE Biosystems) averages peak normalized reporter fluorescence intensity for each cycle and plots it vs cycle number. This allows calculation of a threshold cycle (CT) defined as cycle number at which normalized reporter fluorescence (RN) passes a fixed threshold baseline. For distinct amplification targets, the amount of target molecules in the reaction tube determines CT. Quantification results from comparison CT of the follow-up samples with a standard curve established by RQ PCR of serially diluted genomic DNA with known starting copy numbers. To generate a standard curve DNA from bone marrow (BM) samples at diagnosis with almost 100% tumor cell involvement were serially diluted in polyclonal DNA to give final concentrations of 100, 10−1, 10−2, 10−3, 5 × 10−4, 10−4, 5 × 10−5, 10−5, 10−6. After simultaneous amplification of standard dilution series and follow-up samples target copy numbers of follow-ups were related to the number of target copies at diagnosis. Experiments were done at least in triplicate. Standard dilution series also served as control for sensitivity of the assay. Sensitivity threshold was defined as last dilution with a specific fluorescence signal. Before starting quantitation we optimized each RQ PCR assay for the highest signal intensities and the lowest CT in testing different primer concentrations and annealing temperatures. To confirm DNA integrity and to normalize for differences in amount and quality of DNA samples the albumin gene was used as internal reference (primer/probe sequences are adopted from Pongers-Willemse et al13). Simultaneous albumin RQ PCR of polyclonal DNA serially diluted in water and undiluted patient DNA allowed comparison of amplifiable genomes per sample and subsequent normalization of MRD values.

Results and discussion

Diagnostic DNA samples of 22 patients with B-lineage ALL in which at least one clonally rearranged IgH-CDR3 allele could be detected by PCR were selected for study. Sequences of the clonotypic junctional regions are shown in Table 3. To demonstrate the usefulness of the new real-time PCR assay, minimal residual disease was quantitated in follow-up samples of six patients (Figure 1).

Table 3  IgH-CDR3 junctional sequences deduced from PCR products
Figure 1
figure1

 Comparison of quantitative analysis of MRD in clinical samples of six patients (cases 1–6) using two different RQ PCR assays. (A) IgH-CDR3 junctional sequences of the six patients showing the position of primers and probes. Assay (a) uses allele-specific oligonucleotide (ASO) upstream primers (→red) and probes (▪) in combination with individually designed germline downstream primers. Assay (b) is performed with ASO upstream primers (→blue) in combination with consensus germline downstream primers and consensus probes (downstream primer and consensus probe sequences are shown in Table 1). The arrows indicate probe position on the sense () or antisense () strand. IgH-CDR3 junctional sequences are deduced from PCR products (see Table 3). Template-independent (N) sequences are indicated by lower case letters. 3′ PCR primer sites are written in italics. (B) Sensitivity of the two real-time PCR assays. (C) Time-tables (day 0–800, case 1 day 0–1121 post diagnosis) with MRD levels of follow-up samples determined with both approaches. Data points for positive samples are represented by filled circles and captioned with the MRD value. PCR-negative samples (open circles) are indicated with the level of sensitivity of the individual test and sample which is equal to the maximum possible MRD level. CR, complete clinical remission.

Design of primers and probes for RQ PCR

Initially we used exclusively individually designed primer/probe sets (ASO probes in combination with ASO upstream primers and germline JH downstream primers) for detection as described by Gerard et al9 and Pongers-Willemse et al13 (Figure 1). ASO probes for six patients (cases 1–6) were designed using Primer Express software and according to the manufacturer's guidelines with respect to melting temperature, C/G ratio (>1), G/C content (<70%), avoidance of a 5′G and self-dimerization. Two probes had to be positioned on the antisense strand to fulfill PE Biosystem's recommendation of a C/G ratio greater than 1. With this approach, a detection limit of 5 × 10−5 was reached in five cases and of 10−3 in one case, which may not be sensitive enough for clinical application in ALL.1562829 This problem has also been described in a recent paper by Pongers-Willemse et al,13 who showed that this type of RQ PCR appeared to be comparable to quantification by dot-blotting but less sensitive than liquid hybridization. An additional disadvantage of this procedure is the expensive and time-consuming need for unique primer and probe sets for each individual patient.

In search of an improved IgH-RQ PCR assay, we therefore changed the method by creating probes and reverse downstream primers that anneal to conserved germline JH gene segments of the four most often rearranged JH families. As a consequence, solely the application of two probes and four reverse primers in combination with upstream ASO primers was sufficient to perform RQ PCR of about 90% of possible IgH rearrangements. One probe was complementary to a consensus area of the J families JH1, JH4 and JH5 (probe JHQ1/4/5) and one probe annealed to the joining region of the JH6 family (probe JHQ6). These JH probes were located on the sense strand just as the ASO primers to enhance assay's specificity by avoiding probe cleavage due to asymmetric amplification of germline IgH sequences. In addition, four different reverse primers were designed with support of Primer Express software that annealed to joining regions JH1, JH4, JH5 and JH6, respectively (Table 1). For all patients it was possible to design allele-specific forward ASO primers that, in combination with suitable consensus probes and reverse primers, yielded specific RQ PCR results without background.

Optimization of the real-time PCR assay

Reaction volume:

Initial tests were performed with 50 μl of PCR mixture per tube following published RQ PCR protocols.911121314 In order to save reagents and costs, we repeated the real-time PCR in 25 μl reaction volumes leaving all concentrations unchanged except for DNA (1 μg/tube). Neither peak normalized reporter fluorescence intensities nor threshold cycle numbers significantly changed and no loss of sensitivity was observed (Figure 2). Consequently, we used 25 μl reaction volumes in all further RQ PCR assays thereby saving about 50% of the reagent costs.

Figure 2
figure2

 Comparison of IgH RQ PCR standard curves generated with 25 μl (□) and 50 μl (▪) PCR mixture using serial dilutions of clonal DNA (case 22). Experiments were performed in triplicate. Threshold cycle numbers (CT) (defined as cycle number at which normalized reporter fluorescence passes a fixed threshold baseline) were plotted against log10 of target number for each assay and the plot was fitted with a least-squares regression equation. r, correlation coefficient.

Cycling conditions:

PCR temperatures were determined according to the calculated primers’ melting temperatures (TM). If calculated TM values of both primers differed, optimal reaction conditions yielding highest ΔRN (difference between RN and baseline fluorescence) and lowest CT with clonal samples were selected. Using these reaction conditions each RQ PCR with individual primer/probe sets resulted in clone-specific amplification in the absence of background fluorescence after 40 cycles of RQ PCR. With the consensus probe approach, annealing/extension temperatures had to be elevated to 61–65°C for cases 6, 9, 17 and 19 in order to avoid background (Table 2). In case 11, the first designed ASO primer (5′ATTGTAGTGGTGGTAGCTGCTATGAG3′) failed due to non-specific amplification. However, also in this case, specific amplicons were finally obtained when another upstream primer was located 11 bp further downstream and annealing/extension temperature was set at 65°C. This demonstrates, that the design of specific ASO primers and optimization of reaction temperatures are the critical steps when consensus germline probes are applied for RQ PCR, because germline probes are only specific for JH families and therefore may also detect unrelated rearrangements using the corresponding JH.

Concentration of primers:

For further optimization, we tested different primer concentrations in reactions with 100 ng of clonal DNA. In most cases primer concentrations of 300 nM yielded the best results (Table 2).

Sensitivity of the RQ PCR assay with consensus JH probes

Utilizing these optimized conditions RQ PCR with consensus JH probes and 1 μg of sample detected clonotypic cells with a sensitivity of at least 5 × 10−5 (corresponding to 50 pg of clonal DNA or 7.5 copies) in 21 of 22 cases (95%) and 1 × 10−4 in the remaining case with a dynamic range of at least four orders of magnitude (Table 2). Regression analysis of real-time data obtained from standard dilution series yielded r values 0.98 for copy numbers >15. When tumor levels 10−4 were included in the analysis, r values were partly somewhat lower because of greater variation in CT at low copy numbers.

The method described here is as equally sensitive as traditional quantitative PCR assays.1235672830 Traditional quantitative PCR tests rely on end point data collection and are therefore susceptible to large variations in the amount of PCR product at a given target concentration due to many variables that determine the outcome of every single reaction. Methods that try to overcome these limitations by using multiple tube approaches373031 or introducing internal standards222 are often difficult to standardize, require large amounts of DNA or are laborious to implement.

In contrast to previous PCR methods, real-time PCR assays measure PCR product during the exponential phase of PCR and eliminate the effect of limiting reagents. However, published methods targeting immune genes for RQ PCR913 require individual fluorogenic probes for each patient and are therefore labour intensive and expensive. Our modified real-time PCR assay solves this problem by using consensus probes and reaches at least the level of sensitivity as the method described by Pongers-Willemse et al13 and Gerard et al.9

Clinical application of IgH CDR3-RQ PCR

The two different RQ PCR approaches described in this paper were applied to quantitate minimal residual disease in clinical follow-up samples of six patients (cases 1–6, Figure 1) at different time points during and after therapy. Standard dilution series and follow-up samples were examined at least in triplicate. To normalize for differences in amount and quality of DNA during quantification of diagnostic and follow-up samples, albumin sequences were used as marker for a number of amplifiable genomes as described by Pongers-Willemse et al.13 When 1 μg of diagnostic DNA, based on optical density at 260 nm, was set as 100%, the estimated albumin copy numbers between equal amounts of different follow-up samples varied (data not shown). The greatest differences were seen in two of 17 follow-up samples where the estimated albumin copy numbers were 20-fold lower compared to equal amounts of DNA of the corresponding samples obtained at primary diagnosis. These two DNA samples were collected and stored 5 and 12 years before study and were obviously of low quality due to partial degradation. In general, variations in estimated copy numbers are probably the combined result of variations in integrity of DNA from different bone marrow samples due to storage conditions, DNA extraction and the presence of PCR inhibitors such as heparin and pipetting errors. This points out the enormous importance of confirmation of DNA integrity and amplification efficiency for exact MRD quantification. As demonstrated, renunciation of determination of amplifiable genomes can result in large quantification errors.

Normalized clone-specific RQ PCRs with the described consensus probe approach demonstrated a decrease of tumor load for all patients during treatment as shown in Figure 1. Follow-ups of patients 1 and 2 who remained in complete remission were persistently PCR negative and therefore harbored tumor levels below the assays’ detection limit. The first follow-up sample of patient 3 who also remained in complete clinical remission contained measurable low level MRD of 1.8 × 10−5; two subsequent samples were PCR negative with a sensitivity of <1 × 10−5. Patients 4, 5 and 6 relapsed after initial complete remission. In cases 4 and 6 increasing MRD levels preceeded clinical relapse for 3 and 11 months. For patient 5 the only material available before relapse was of low quality with only 5.8% of theoretical albumin copy numbers and was PCR negative at a detection limit of 5.2 × 10−4 7 months prior to relapse (Figure 1).

Comparison of consensus probes to patient-specific probes for real-time quantification

As shown in Figure 1, sensitivity of the new RQ PCR system with ASO primers and consensus JH probes was moderately superior to the clone-specific primer/probe system in four of the six cases (cases 2–5). The most remarkable difference of the two RQ PCR approaches was seen in patient 6 with detection limits of 10−3 for the ASO primer/probe system vs 10−5 for the new approach with the consensus probe.

The estimated tumor load of the four follow-up samples that were MRD positive with both RQ PCR methods were higher in three cases (cases 3–5) when measured with the ASO probe approach and slightly lower in case 6. The ratios of the corresponding MRD values estimated with the two methods varied from 0.9 to 5.9 in individual samples. Taking into account that quantitative estimation of a single rearranged IgH allele in a dominant polyclonal background is much more complex than quantification of single copy genes, this moderate variation between two different PCR approaches should be tolerated.

Concordance in MRD status was demonstrated with both approaches for five of the six patients whereas maximum possible MRD levels in PCR-negative samples differed due to differing sensitivity limits. In case 6 an increasing MRD level as indicator for subsequent clinical relapse was detected 44 weeks earlier with the ‘consensus’ RQ PCR (Figure 1).

In conclusion, this study demonstrates that the novel real-time PCR assay using consensus probes in combination with an ASO primer for detection of clonally rearranged IgH sequences is sensitive, specific and easy to perform. It simplifies current approaches for detection of MRD in B-lymphoid malignancies and will allow analysis of large numbers of patient samples in clinical trials with reasonable costs, relatively low time consumption, and a high level of sensitivity. Furthermore, this technique should also be applicable for real-time quantitative PCR using rearranged TCRβ, TCRγ and TCRδ regions.

References

  1. 1

    Foroni L . Investigation of minimal residual disease in childhood and adult acute lymphoblastic leukemia by molecular analysis Br J Haematol 1999 105: 7–24

  2. 2

    Cave H, Guidal C, Rohrlich P, Delfau MH, Broyart A, Lescoeur B, Rahimy C, Fenneteau O, Monplaisir N, d'Auriol L, Elio J, Vilmer E, Grandchamp B . Prospective monitoring and quantitation of residual blasts in childhood acute lymphoblastic leukemia by polymerase chain reaction study of δ and γ T-cell receptor genes Blood 1994 83: 1892–1902

  3. 3

    Brisco MJ, Hughes E, Neoh SH, Sykes PJ, Bradstock K, Enno A, Szer J, McCaul K, Morley AA . Relationship between minimal residual disease and outcome in adult acute lymphoblastic leukemia Blood 1996 87: 5251–5256

  4. 4

    Roberts WM, Estrov Z, Ouspenskaia MV, Johnston DA, McClain KL, Zipf TF . Measurement of residual disease during remission in childhood acute lymphoblastic leukemia New Engl J Med 1997 336: 317–323

  5. 5

    Cave H, van der Werff ten Bosch J, Suciu S, Guidal C, Waterkeyn C, Otten J, Bakkus M, Thielemans K, Grandchamp B, Vilmer E, Nelken B, Fournier M, Boutard P, Lebrun E, Mechinaud F, Garand R, Robert A, Dastugue N, Plouvier E, Racadot E, Ferster A, Gyselinck J, Fenneteau O, Duval M, Solbu G, Manel AM . Clinical significance of minimal residual disease in childhood acute lymphoblastic Leukemia New Engl J Med 1998 339: 591–598

  6. 6

    Van Dongen JJ, Seriu T, Panzer-Grunmayer ER, Biondi A, Pongers-Willemse MJ, Corral L, Stolz F, Schrappe M, Masera G, Kamps WA, Gadner H, van Wering ER, Ludwig WD, Basso G, de Bruijn MA, Cazzaniga G, Hettinger K, van der Does-van den Berg A, Hop WC, Riehm H, Bartram CR . Prognostic value of minimal residual disease in acute lymphoblastic leukemia in childhood Lancet 1998 352: 1731–1738

  7. 7

    Gruhn B, Hongeng S, Yi H, Hancock ML, Rubnitz JE, Neale GAM, Kitchingman GR . Minimal residual disease after intensive induction therapy in childhood acute lymphoblastic leukemia predicts outcome Leukemia 1998 12: 675–681

  8. 8

    Corradini P, Ladetto M, Pileri A, Tarella C . Clinical relevance of minimal residual disease monitoring in non-Hodgkin's lymphomas: a critical reappraisal of molecular strategies Leukemia 1999 13: 1691–1695

  9. 9

    Gerard CJ, Olsson K, Ramanathan R, Rading C, Hanania EG . Improved quantitation of minimal residual disease in multiple myeloma using real-time polymerase chain reaction and plasmid-DNA complemetarity determining region III standards Cancer Res 1998 58: 3957–3964

  10. 10

    Elsworth AM, Evans PAS, Morgan GJ, Kinsey SE, Shiach CR . Quantitative PCR of the immunoglobulin heavy chain gene using genomic DNA Br J Haematol 1996 95: 700–703

  11. 11

    Dölken L, Schüler F, Dölken G . Quantitative detection of t(14;18)-positive cells by real-time quantitative PCR using fluorogenic probes BioTechniques 1998 25: 1058–1064

  12. 12

    Luthra R, McBride JA, Cabanillas F, Sarris A . Novel 5′ exonuclease-based real-time PCR assay for the detection of t(14;18)(q32;q21) in patients with follicular lymphoma Am J Pathol 1998 153: 63–68

  13. 13

    Pongers-Willemse MJ, Verhagen OJHM, Tibbe GJM, Wijkhuijs AJM, de Haas V, Roovers E, Van der Schoot CE, Van Dongen JJM . Real-time quantitative PCR for the detection of minimal residual disease in acute lymphoblastic leukemia using junctional region specific TaqMan probes Leukemia 1998 12: 2006–2014

  14. 14

    Olsson K, Gerard CJ, Zehnder J, Jones C, Ramanathan R, Reading C, Hanania EG . Real-time t(11;14) and t(14;18) PCR assays provide sensitive and quantitative assessment of minimal residual disease (MRD) Leukemia 1999 13: 1833–1842

  15. 15

    Holland PM, Abramson RD, Watson R, Gelfand DH . Detection of specific polymerase chain reaction product by utilizing the 5′–3′ exonuclease activity of Thermus aquaticus DNA polymerase Proc Natl Acad Sci USA 1991 88: 7276–7280

  16. 16

    Gibson UE, Heid CA, Williams PM . A novel method for real time quantitative RT-PCR Genome Res 1996 6: 995–1001

  17. 17

    Heid CA, Stevens J, Livak KJ, Williams PM . Real time quantitative PCR Genome Res 1996 6: 321–328

  18. 18

    Linke B, Bolz I, Pott C, Hiddemann W, Kneba M . Use of UITma DNA polymerase improves the PCR detection of rearranged immunoglobulin heavy chain CDR3 junctions Leukemia 1995 9: 2133–2137

  19. 19

    Linke B, Bolz I, Fayyazi A, von Hofen M, Pott C, Bertram J, Hiddemann W, Kneba M . Automated high resolution PCR fragment analysis for identification of clonally rearranged immunoglobulin heavy chain genes Leukemia 1997 11: 1055–1062

  20. 20

    Linke B, Pyttlich J, Tiemann M, Suttorp M, Parwaresch R, Hiddemann W, Kneba M . Identification and structural analysis of rearranged immunoglobulin heavy chain genes in lymphomas and leukemias Leukemia 1995 9: 840–847

  21. 21

    Flanagan JG, Rabbitts TH . The sequence of a human immunoglobulin epsilon heavy chain constant region gene, and evidence for three non-allelic genes EMBO J 1982 1: 655–660

  22. 22

    Mattila PS, Schugk HW, Makela O . Extensive allelic sequence variation in the J region of the human immunoglobulin heavy chain gene locus Eur J Immunol 1995 25: 2578–2582

  23. 23

    Ichihara Y, Matsuoka H, Kurosawa Y . Organization of human immunoglobulin heavy chain diversity gene loci EMBO J 1988 7: 4141–4150

  24. 24

    Huang C, Stewart AK, Schwartz RS, Stollar BD . Immunoglobulin heavy chain gene expression in peripheral blood lymphocytes J Clin Invest 1992 89: 1331–1343

  25. 25

    Mortari F, Wang JY, Schroeder HW . Mixed population of VH gene segments and CDR3 distribution in the expressed Cα and Cγ repertoires J Immunol 1993 150: 1348–1357

  26. 26

    Corbett SJ, Tomlinson IM, Sonnhammer, Buck D, Winter G . Sequence of the human immunoglobulin diversity (D) segment locus: a systematic analysis provides no evidence for the use of DIR segments, inverted D segments, ‘minor’ D segments or D–D recombination J Mol Biol 1997 270: 587–597

  27. 27

    Brezinschek HP, Brezinschek RI, Lipsky PE . Analysis of the heavy chain repertoire of human peripheral B cells using single-cell polymerase chain reaction J Immunol 1995 155: 190–202

  28. 28

    Nizet Y, Martiat P, Vaerman JL, Philippe M, Wildmann C, Staelens JP, Cornu G, Ferrant A, Michaux JL Sokal G . Follow-up of residual disease (MRD) in B lineage akute leukemia using a simplified PCR strategy: evolution of MRD rather than its detection is correlated with clinical outcome Br J Haematol 1991 79: 205–210

  29. 29

    Foroni L, Coyle LA, Papaioannou M, Yaxley JC, Cole Sinclai MF, Chim JS, Cannel P, Secker-Walker LM, Mehta AB, Prentice HG, Hoffbrand AV . Molecular detection of minimal residual disease in adult and childhood acute lymphoblastic leukemia reveals differences in treatment response Leukemia 1997 11: 1732–1741

  30. 30

    Sykes PJ, Neoh SH, Brisco MJ, Hughes E, Condon J, Morley AA . Quantitation of targets for PCR by use of limiting dilution BioTechniques 1992 13: 444–449

  31. 31

    Mayer SP, Giamelii J, Sandoval C, Roach AS, Ozkaynak MF, Tugal O, Rovera G, Jayabose S . Quantitation of leukemia clone-specific antigen gene rearrangements by a single-step PCR and fluorescence-based detection method Leukemia 1999 13: 1843–1852

Download references

Acknowledgements

This work was supported by Deutsche Forschungsgemeinschaft Grant KN 422/1-1.

Author information

Correspondence to M Brüggemann.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Brüggemann, M., Droese, J., Bolz, I. et al. Improved assessment of minimal residual disease in B cell malignancies using fluorogenic consensus probes for real-time quantitative PCR. Leukemia 14, 1419–1425 (2000) doi:10.1038/sj.leu.2401831

Download citation

Keywords

  • IgH-CDR3
  • real-time quantitative PCR
  • acute lymphoblastic leukemia
  • minimal residual disease

Further reading