RASSF6 is a novel member of the RASSF family of tumor suppressors

Abstract

RASSF family proteins are tumor suppressors that are frequently downregulated during the development of human cancer. The best-characterized member of the family is RASSF1A, which is downregulated by promoter methylation in 40–90% of primary human tumors. We now identify and characterize a novel member of the RASSF family, RASSF6. Like the other family members, RASSF6 possesses a Ras Association domain and binds activated Ras. Exogenous expression of RASSF6 promoted apoptosis, synergized with activated K-Ras to induce cell death and inhibited the survival of specific tumor cell lines. Suppression of RASSF6 enhanced the tumorigenic phenotype of a human lung tumor cell line. Furthermore, RASSF6 is often downregulated in primary human tumors. RASSF6 shares some similar overall properties as other RASSF proteins. However, there are significant differences in biological activity between RASSF6 and other family members including a discrete tissue expression profile, cell killing specificity and impact on signaling pathways. Moreover, RASSF6 may play a role in dictating the degree of inflammatory response to the respiratory syncytial virus. Thus, RASSF6 is a novel RASSF family member that demonstrates the properties of a Ras effector and tumor suppressor but exhibits biological properties that are unique and distinct from those of other family members.

Introduction

Mutant Ras proteins play a critical role in the development of over 30% of human cancers (Shields et al., 2000; Malumbres and Barbacid, 2003). However, although promoting many aspects of transformation, activated forms of Ras can also exhibit growth antagonistic properties. These include the induction of senescence, cell cycle arrest and apoptosis (Mayo et al., 1997; Serrano et al., 1997; Nicke et al., 2005). We can reconcile these apparently contradictory properties if we consider the fact that Ras proteins can interact with a wide variety of downstream effector proteins allowing a broad range of effector outputs (Malumbres and Pellicer, 1998). Many Ras effector proteins contain conserved structural regions that are responsible for mediating the interaction with Ras. These regions have been designated the Ras Association (RA) domain (Ponting and Benjamin, 1996). Using a bioinformatics-based approach to screen for RA domain containing proteins, we have previously identified several members of the RASSF family as potential Ras effectors that mediate growth inhibitory effects.

Four RASSF proteins have been characterized biologically thus far: RASSF1, RASSF2, RASSF4 and Nore1 (RASSF5) (Dammann et al., 2000; Vos et al., 2000, 2003a, 2003b; Burbee et al., 2001; Khokhlatchev et al., 2002; Eckfeld et al., 2004; Agathanggelou et al., 2005). All demonstrate biological properties compatible with a tumor suppressor function. These include inhibiting growth, promoting cell cycle arrest and apoptosis. They are all frequently downregulated during tumorigenesis by promoter methylation (Agathanggelou et al., 2005; Akino et al., 2005). Moreover, RASSF1A knockout mice demonstrate enhanced tumor susceptibility (Tommasi et al., 2005) and loss of Nore1 (RASSF5) function is linked to a familial form of kidney cancer (Chen et al., 2003).

Here, we identify and characterize a novel member of this family, RASSF6. RASSF6 interacts directly with K-Ras in a guanosine triphosphate (GTP)-dependent manner via its effector domain with an affinity comparable to that of other known Ras effectors. RASSF6 induces apoptosis and the ability of RASSF6 to kill cells is enhanced by activated Ras. Overexpression of RASSF6 inhibits the survival of specific tumor cell lines and knockdown of RASSF6 by siRNA enhances the ability of tumor cell lines to grow in soft agar. In matched pair primary tumor samples, the levels of RASSF6 mRNA are often downregulated in the primary tumors. However, although RASSF6 has some similar overall properties as RASSF1A, the proteins demonstrate discrete expression profiles, and cell killing specificity.

Recently, the RASSF6 locus has been implicated in determining susceptibility to infection by the respiratory syncytial virus (RSV) (Hull et al., 2004). RSV infection activates the eukaryotic nuclear factor κB (NFκB) pathway and this activation may play a vital role in the inflammatory response to infection. We have found that RASSF6 expression inhibits the basal levels of NFκB activity in a lung epithelial cell line, suggesting that defects in RASSF6 may facilitate viral NFκB activation. Thus, we identify a further member of the RASSF family as a novel potential Ras effector/tumor suppressor with distinct biological characteristics.

Results

Family alignment and tissue distribution of RASSF6

TblastN searches of the EST database using the RA domain of RASSF1A led to the identification of RASSF6. During the preparation of this manuscript, the gene was described in: http://www.genecards.org/cgi-bin/carddisp.pl?gene=RASSF6. Sequences were aligned using ClustalW (Figure 1a). RASSF6 shows most identity to RASSF2 (57%) and RASSF4 (55%). It lacks the N-terminal extension of Nore1 (RASSF5) and the microtubule association domain of RASSF1A (Vos et al., 2004; Agathanggelou et al., 2005) but shares the SARAH motif of other family members. Northern analysis of RASSF6 expression (Figure 1b) showed a distinct pattern of expression that differs from other family members (Vos et al., 2000, 2003a, 2003b).

Figure 1
figure1

(a) Alignment of mRASSF6 with hRASSF6, RASSF2 and RASSF4 using the ClustalW program. Shaded bars, identical residues; ‘:’, conserved substitutions; ‘.’, semi-conserved substitutions. The RA domains have been shaded in gray. mRASSF6 shares 82% with hRASSF6 and RASSF6 shows greatest homology with RASSF2 (57%) followed by RASSF4 (55%). (b) Northern analysis of RASSF6 mRNA expression in normal tissue. Actin serves as the loading control. The table below the panel summarizes the relative expression of other family members in the same blot. +, low expression; ++, moderate expression; +++, high expression; −, no expression; nd, not done.

RASSF6 interacts with Ras GTP in cells via its effector domain

293-T cells were cotransfected with FLAG-tagged RASSF6 and HA-tagged activated K-Ras (G12V) or wild-type K-Ras. The cells were lysed after 48 h and immunoprecipitated with anti-Ras antibody for western analysis using anti-FLAG antibodies. RASSF6 preferentially associated with the active form of K-Ras as no association was seen with the inactive (wild-type) protein (Figure 2a).

Figure 2
figure2

RASSF6 binds K-Ras in a GTP-dependant manner via its effector domain. HA-tagged K-Ras proteins (WT, activated and effector mutants) and FLAG-tagged RASSF6 were cotransfected into 293-T cells. After 48 h, the cells were lysed using RIPA buffer and immunoprecipitated (IP) with sc-259 anti-Ras beads (Santa Cruz Biotechnology, Santa Cruz, CA, USA) before immunoblotting (IB) with FLAG antibodies. (a) RASSF6 preferentially interacts with the GTP-bound (activated) form of K-Ras compared to the wild type (compare lanes 1 and 2). The bottom two panels show the relative amount of each protein in the lysate as examined with anti-FLAG and anti-HA antibodies. (b) In similar experiments, mutations in the effector domain of K-Ras disrupt the binding to RASSF6. (c) Lack of farnesylation (K-Ras12v/186S) also impairs the ability of Ras and RASSF6 to interact with each other.

Ras associates with its effectors via its effector domain (Marshall 1993) therefore, effector mutants (White et al., 1995; Vos et al., 2003a) of activated K-Ras (G12V/35S) and (G12V/40C) were subjected to similar coprecipitation experiments with RASSF6. Figure 2b shows that mutations in the effector region of K-Ras strongly impaired its ability to interact with RASSF6.

Farnesylation is important for Ras to bind to its effectors with full affinity (Williams et al., 2000). By using a point mutant of activated K-Ras that lacks a functional CAAX motif (Solski et al., 1995) and cannot be farnesylated, we determined that the farnesylation of Ras is very important for binding to RASSF6 (Figure 2c).

RASSF6 binds K-Ras directly

To examine the physiological relevance of the interaction and to confirm a direct interaction between RASSF6 and K-Ras, we generated a recombinant glutathione S-transferase (GST)-fusion of the RA domain of RASSF6, designated GST-F6RA. GST-F6RA was used as an affinity reagent in quantitative binding assays with purified, farnesylated K-Ras (Figure 3). Ras was loaded with GTP and incubated with 100 ng of GST or GST-F6RA at decreasing concentrations for 4 h at 4°C in phosphate-buffered saline, 0.025% Tween-20 and 1 mM MgCl2. GST-F6 beads were then washed and subjected to western analysis using an anti-K-Ras antibody (F234 Santa Cruz Biotechnology, CA, USA). The apparent Kd was taken as half the maximal binding. Binding was saturated by 300 nM, giving an apparent Kd of less than or equal to 150 nM.

Figure 3
figure3

RASSF6 interacts directly with K-Ras through its RA domain. The RA domain of RASSF6 was cloned into a GST vector (GST-F6RA) and used as an affinity reagent to precipitate purified, farnesylated K-Ras. GST served as a negative control. A total of 100 ng of GST-fusion protein was incubated with decreasing concentrations of K-Ras. K-Ras was detected using a K-Ras monoclonal antibody (Santa Cruz). The apparent Kd was taken as half the maximal binding concentration of 300 nM.

RASSF6 and RASSF1A exhibit different cell-specific growth inhibitory properties

Tumor cell lines were transfected with pBabe expression constructs and selected in puromycin. Colony formation was scored after 2 weeks (Figure 4). Whereas neither RASSF1A nor RASSF6 inhibited the growth of the H1299 human lung tumor cell line, both inhibited the growth of MCF-7 human breast tumor cells. However, RASSF6 was significantly less effective at inhibiting the growth and survival of A549 human lung tumor cells.

Figure 4
figure4

RASSF6 differentially inhibits growth in human tumor cell lines. H1299 and A549 human lung tumor cells along with MCF-7 breast tumor cells were transfected with RASSF6 in the selectable vector pBabe. Cells were selected for 2 weeks in puromycin and surviving colonies stained with crystal violet.

RASSF6 and K-Ras synergize to induce cell death

To determine the effects of activated Ras on the biological activity of RASSF6, we performed cotransfections in 293-T cells. After 48 h, the cells were stained with trypan blue to detect cell death. A dramatic synergistic activation of cell death was observed when the cells were transfected with activated K-Ras and RASSF6 together (Figure 5a and b).

Figure 5
figure5

K-Ras and RASSF6 synergize to promote cell death. 293-T cells were transfected with K-Ras G12Vand RASSF6 constructs alone and in combination. (a) After 48 h, cells were stained with Trypan blue to identify dead cells. A typical experiment is illustrated and quantification of three independent experiments is shown in Figure 5b.

RASSF6 induces apoptotic cell death

To determine if RASSF6 was proapoptotic, we used the pCaspase3-Sensor system (Clontech, Mountain View, CA, USA) and fluorescent microscopy to measure caspase-3 activation in individual cells as described previously (Vos et al., 2003b). Quantification showed that addition of RASSF6 induced a fivefold increase of active caspases over empty vector (Figure 6).

Figure 6
figure6

RASSF6 promotes apoptosis in MCF-7 cells and binds MOAP-1. (a) The pCaspase3-Sensor plasmid±RFP-RASSF6 was transfected into MCF-7 cells and localization examined after 48 h. (a) Quantification of cells exhibiting caspase activation in RASSF6 expressing cells. Data presented are derived from three separate experiments, showing standard error. (b) A total of 2 μg FLAG-tagged RASSF1A was cotransfected in 293-T cells with 2 μg MYC-tagged MOAP-1 in the presence or absence of activated K-Ras. Upper panel shows the immunoprecipitate probed with FLAG, the lower panel shows the input lysate probed with FLAG.

RASSF6 binds the proapoptotic protein MOAP-1

One of the proapoptotic pathways that has been identified for RASSF1A involves the direct interaction with the protein modulator of apoptosis 1 (MOAP-1) which then binds and activates Bax (Vos et al., 2006; Baksh et al., 2005). To determine if RASSF6 might also use this pathway to mediate apoptosis, we performed coimmunoprecipitation assays with differentially tagged expression constructs. RASSF6 could coimmunoprecipitate with MOAP-1 (Figure 6b). Moreover, the degree of binding of RASSF6 and MOAP-1 appeared to be enhanced by the presence of activated K-Ras, suggesting a potential mechanism by which Ras may activate the proapoptotic effects of RASSF6.

RASSF6 siRNA enhances tumorigenicity

H1792 cells transfected with RASSF6 siRNA were plated in soft agar (Figure 7a and b). The cells transfected with RASSF6 siRNA demonstrated enhanced ability to grow in soft agar compared to the control cells transfected with a scrambled siRNA.

Figure 7
figure7

Knockdown of RASSF6 enhances the tumorigenic phenotype. (a) H1792 human lung tumor cells were transfected with a RASSF6 siRNA. The cells were plated in soft agar and scored for growth after 10 days. Two representative experiments are shown. (b) qRT–PCR analysis of RASSF6 expression in the A549 cells. The siRNA RASSF6 construct reduced the expression of RASSF in the cell line tested. Data represent two separate experiments in duplicate. Error bars are standard errors.

RASSF6 expression is frequently lost in primary tumors

Using a cancer profiling array containing paired cDNAs generated from matched pair normal (N) and tumor (T)-derived tissues we show that the expression of RASSF6 is downregulated in 30–60% of tumor derived tissues of the breast, colon, kidney, liver, rectum, pancreas, stomach and the thyroid gland compared to normal tissue (Figure 8). Intriguingly, several tumor samples showed elevated levels of RASSF6 expression. The differences seen were not owing to differential loading, as the control incubation with the ubiquitin cDNA probe yielded similar levels of expression in N vs T (data not shown). The reasons for the elevated levels of expression in some tumors are not known, but could reflect the presence of a mutant RASSF6.

Figure 8
figure8

Expression of RASSF6 is reduced in primary tumor cells. A cancer profiling array (Clontech) containing cDNAs generated from total RNA of tumor samples and corresponding normal tissue was subjected to northern analysis using the human RASSF6 as a cDNA probe. An ubiquitin cDNA probe was used and confirmed approximately equal loading in all samples (data not shown). A summary of the frequency of alterations of expression is shown below.

RASSF6 suppresses the NFκB pathway

RSV induces severe bronchiolitis in a subpopulation of infected individuals. Recent studies have genetically linked the RASSF6 locus to susceptibility for the RSV-induced bronchiolitis (Smyth and Openshaw, 2006). One of the major effects of RSV infection is to stimulate the NFκB pathway (Hull et al., 2004). Activation of the NFκB pathway appears to play roles in both modulating the degree of inflammation induced by RSV and in supporting viral replication, perhaps by suppressing apoptosis (Bitko et al., 2004). As RASSF6 can induce apoptosis by an unknown mechanism, we examined the possibility that it might function, at least in part, via NFκB. Dual Luciferase assays were performed in A549 lung tumor cells using an NFκB luciferase reporter and a CMV-Renilla internal control. RASSF6 suppressed the serum-induced basal levels of NFκB reporter approximately fivefold (Figure 9). A much weaker effect was observed with the most closely related family member RASSF2.

Figure 9
figure9

RASSF6 suppresses the activation of NFκB in A549 human lung tumor cells. A549 cells were transfected with RASSF6, an NFκB-luciferase reporter construct and a Renilla luciferase internal control. Results are normalized to the Renilla internal control. Data presented represent three experiments performed in duplicate. Error bars are standard errors.

Discussion

Inappropriate activation of Ras proteins promotes a variety of protumorigenic phenotypes including enhanced growth, loss of contact inhibition, reduced requirement for growth factors, enhanced motility and invasion and resistance to apoptosis (Malumbres and Barbacid, 2003). However, like other powerful oncoproteins, activated Ras can also induce various aspects of growth inhibition and death (Mayo et al., 1997; Serrano et al., 1997; Hueber and Evan, 1998; Frame and Balmain, 2000; Cox and Der, 2003; Diep et al., 2004; Nicke et al., 2005). These observations suggest that Ras proteins may control a balance between life and death in normal cells (Feig and Buchsbaum, 2002).

RASSF family proteins have now been identified as potential mediators of some of the growth inhibitory effects of Ras (Vos et al., 2000, 2003a, 2003b; Khokhlatchev et al., 2002; Eckfeld et al., 2004). Intriguingly, RASSF family proteins are often downregulated during tumorigenesis (Pfeifer et al., 2002; Vos et al., 2003a, 2003b; Eckfeld et al., 2004; Agathanggelou et al., 2005). This suggests that loss of function of RASSF family proteins may be an important component of the development of Ras-dependant tumors.

We report here the first characterization of the last member of the family, RASSF6. RASSF6 demonstrates approximately 60% identity to RASSF2 and RASSF4, with approximately 30% identity to RASSF1A.

RASSF6 associates preferentially with activated Ras and this interaction is dependant on the effector domain of Ras. The interaction is also dependant on the correct posttranslational modification of Ras by farnesyl. Posttranslational modification of Ras has previously been shown to play an important role in the binding to effectors. In the case of RASSF6, this seems to be particularly important. Thus, studies using unprocessed Ras to examine the binding of Ras to RASSF proteins may underestimate the binding affinity. The interaction between farnesylated Ras and RASSF6 is likely to be physiological as the apparent Kd of the interaction was determined to be less than or equal to 150 nM compared to 50 nM previously determined for Ras and its physiological effector Raf-1 (Okada et al., 1996).

RASSF family proteins have been shown to inhibit growth and participate in proapoptotic programs (Agathanggelou et al., 2005). RASSF6 also promotes cell death in a Ras-dependant manner and can induce apoptotic cell death in human tumor cell lines. RASSF1A mediates some of its apoptotic functions by directly binding the proapoptotic Bax activator MOAP-1 (Baksh et al., 2005; Vos et al., 2006). RASSF6 can also interact with MOAP-1 and so shares this pathway with RASSF1A. However, not all tumor lines are sensitive to killing by RASSF family overexpression. Neither RASSF1A nor RASSF6 was very effective at killing the lung tumor cell line H1299. The killing also shows some specificity between family members as RASSF1A was much more effective at killing A549 cells than RASSF6. This implies that RASSF1A and RASSF6 do not mediate identical functions.

To date, all RASSF family members with the exception of RASSF3 (Tommasi et al., 2002) have shown frequent loss of expression during tumor development primarily due to promoter methylation (Agathanggelou et al., 2005). Here, we show that RASSF6 shows reduced levels of RASSF6 mRNA in between 30 and 60% of primary tumor tissues of the breast, colon, kidney, liver, pancreas, stomach and thyroid gland. Curiously, some tumor samples appeared to exhibit elevated levels of RASSF6 compared to the normal tissue. The reason for this is unknown but might represent a mutant form of RASSF6 that has lost tumor suppressor function. So far, we have not identified any tumor-associated point mutants of RASSF6.

To determine a mechanism for the reduced expression of RASSF6 in tumors, we examined the promoter of RASSF6 and found that approximately only 1/7 of the tumor cell lines examined demonstrated partial promoter methylation (data not shown). This level was lower than expected, based on the results in the primary tumor samples. This suggests that either our examination of the promoter did not extend sufficiently upstream to detect important sites of methylation, or that nonmethylation-based mechanisms are involved in the downregulation of RASSF6. RASSF6 is located at 4q21.21 in the genome. This region has been reported to suffer deletions during tumor development (Diep et al., 2004). Therefore, the loss of expression in the primary tumors could also reflect gene deletions as well as epigenetic mechanisms of silencing.

Recently, genetic mapping studies have implicated RASSF6 as playing an unexpected role in the response to infection by RSV (Smyth and Openshaw, 2006). RSV infection is a leading cause of infant hospitalization. Certain individuals appear to be particularly susceptible to RSV-induced bronchiolitis, which is characterized by severe inflammation (Hull et al., 2004) and can lead to serious complications or death. The reason why only some individuals develop bronchiolitis after infection is not known. However, a genetic locus for the susceptibility to RSV-induced bronchiolitis has now been mapped to RASSF6 (Hull et al., 2004). This implies that defects in RASSF6 might alter the cellular response to RSV infection. One of the major effects of infection by RSV is activation of the NFκB pathway and this appears to play a critical role in both promoting inflammation and supporting viral replication by suppressing apoptosis (Bitko et al., 2004). As RASSF6 is proapoptotic, we wondered if RASSF6 might be able to modulate the NFκB pathway. Indeed, we found that in a lung tumor cell line, RASSF6 was highly effective at suppressing the NFκB pathway (Figure 9). This appears to be a specific effect as the closest family member, RASSF2, exhibited only a modest effect on NFκB activation (Figure 9). This is the first example of a RASSF family member being linked to NFκB function. Thus, impaired function of RASSF6 may facilitate the activation of NFκB by RSV, enhancing the infection. It may be interesting to test the activity of RSV in cells specifically knocked down for RASSF6. It may also be interesting to examine the role of RASSF6 in inflammation in cancer.

Thus, although RASSF6 demonstrates some similarities to other previously characterized RASSF proteins, it also demonstrates some unique properties. These include a discrete tissue expression profile, subcellular localization, cell killing specificity and impact on signaling pathways. Moreover, we may have identified a mechanism behind which RASSF6 may play a role in dictating the degree of inflammatory response of the RSV. Consequently, we propose that RASSF6 is a Ras effector/tumor suppressor of the RASSF family but with distinct characteristics and function compared to other family members.

Experimental procedures

Cloning and vectors

Murine RASSF6 was isolated by polymerase chain reaction (PCR) from IMAGE clone ID: 3669766 using primers IndexTermggatccatgacagcaatggatcaccag and IndexTermgaattcctagactgtggtctccgttttagc and cloned in pCDNA.Flag and pBabe.HA. The RA domain of RASSF6 (amino acid residues 184–273) was isolated by PCR (oligomers gacggatccaagcctctgatgatggacaga and acacaattgctaaactgttgtctctgtttttattactagtttatt) and cloned into pGEX-2T vector (Phamacia, Piscataway, NJ, USA).

K-Ras/RASSF6 binding assays

293-T cells were transfected with pCGN-K-ras (Fiordalisi et al., 2000) and pcDNAF-RASSF6. Cells were lysed in radioimmuno precipitation assay (RIPA) buffer (50 mM Tris, pH 7.5, 1% (v/v) IGEPAL, 150 mM NaCl) and immunoprecipitated with anti-Ras antibodies (sc-259, Santa Cruz Biotechnology) followed by western analysis.

Direct binding assays were carried out using a GST-fusion of the RASSF6 RA domain and purified, farnesylated K-Ras (a kind gift from D Stokoe, University of California, San Francisco). K-Ras was loaded as described previously (Clark et al., 1996) and added to 100 ng of the RA fusion protein immobilized to glutathione-coated beads at a range of Ras concentrations from 600 to 150 nM. Ras binding was determined as described previously (Vos et al., 2003b).

Cell cultures and transfections

Human tumor cell lines were grown in Dulbecco's modified Eagle's medium/10% fetal bovine serum and transfected using lipofectamine-2000 (Invitrogen, Carlsbad, CA, USA). SiRNA studies were performed by transfecting H1792 cells with 100 nM of RASSF6 SiRNA (ID # 130201 Ambion Inc., Austin, TX, USA) using oligofectamine (Invitrogen). Cells were plated in soft agar after 24 h as described previously (Vos et al., 2003b). Dual luciferase assays were performed as described in Ellis et al. (2002).

qRT–PCR studies

quantitative real-time polymerase chain reaction (qRT–PCR) was performed on an iCycler Real-Time Detection System (Bio-Rad Laboratories Inc., Hercules, CA, USA) using the Quantitect SYBR Green RT–PCR Kit (Qiagen Inc., Valencia, CA, USA). The fold change for the RASSF6 gene was calculated using the 2−ΔΔCT method and using β-actin as the reference gene.

Cell death/apoptosis assay

MCF-7 cells were transfected with 1 μg each of pCaspase3-sensor reporter plasmid (15) and pHcRed-RASSF6. Location of the enhanced green fluorescent protein-sensor reporter protein in cotransfected cells was examined after 24–48 h using fluorescence microscopy.

In situ Trypan blue assays were performed on 293-T cells (ATCC, Manassas, VA, USA) as described previously (Vos et al., 2003b).

Expression in normal tissue and cancer profiling array

Human RASSF6 was used as a probe for northern analysis of a Normal Tissue Blot (Clontech, Paolo Alto, CA, USA). To examine the expression of RASSF6 in primary tumors, southern analysis of the Clontech matched pair tissue blot was performed, using hRASSF6 and an ubiquitin cDNA probe as a control.

Abbreviations

GST:

glutathione S transferase

RA:

Ras association

RSV:

respiratory syncytial virus

References

  1. Agathanggelou A, Cooper WN, Latif F . (2005). Role of the Ras-association domain family 1 tumor suppressor gene in human cancers. Cancer Res 65: 3497–3508.

    CAS  Article  PubMed  Google Scholar 

  2. Akino K, Toyota M, Suzuki H, Mita H, Sasaki Y, Ohe-Toyota M et al. (2005). The Ras effector RASSF2 is a novel tumor-suppressor gene in human colorectal cancer. Gastroenterology 129: 156–169.

    CAS  Article  PubMed  Google Scholar 

  3. Baksh S, Tommasi S, Fenton S, Yu VC, Martins LM, Pfeifer GP et al. (2005). The tumor suppressor RASSF1A and MAP-1 link death receptor signaling to Bax conformational change and cell death. Mol Cell 18: 637–650.

    CAS  Article  PubMed  Google Scholar 

  4. Bitko V, Garmon NE, Cao T, Estrada B, Oakes JE, Lausch RN et al. (2004). Activation of cytokines and NF-kappa B in corneal epithelial cells infected by respiratory syncytial virus: potential relevance in ocular inflammation and respiratory infection. BMC Microbiol 4: 28.

    Article  PubMed  PubMed Central  Google Scholar 

  5. Burbee DG, Forgacs E, Zochbauer-Muller S, Shivakumar L, Fong K, Gao B et al. (2001). Epigenetic inactivation of RASSF1A in lung and breast cancers and malignant phenotype suppression. J Natl Cancer Inst 93: 691–699.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  6. Chen J, Lui WO, Vos MD, Clark GJ, Takahashi M, Schoumans J et al. (2003). The t(1;3) breakpoint-spanning genes LSAMP and NORE1 are involved in clear cell renal cell carcinomas. Cancer Cell 4: 405–413.

    CAS  Article  PubMed  Google Scholar 

  7. Clark GJ, Drugan JK, Terrell RS, Bradham C, Der CJ, Bell RM et al. (1996). Peptides containing a consensus Ras binding sequence from Raf-1 and theGTPase activating protein NF1 inhibit Ras function. Proc Natl Acad Sci USA 93: 1577–1581.

    CAS  Article  PubMed  Google Scholar 

  8. Cox AD, Der CJ . (2003). The dark side of Ras: regulation of apoptosis. Oncogene 22: 8999–9006.

    CAS  Article  PubMed  Google Scholar 

  9. Dammann R, Li C, Yoon JH, Chin PL, Bates S, Pfeifer GP . (2000). Epigenetic inactivation of a RAS association domain family protein from the lung tumour suppressor locus 3p21.3. Nat Genet 25: 315–319.

    CAS  Article  PubMed  Google Scholar 

  10. Diep CB, Teixeira MR, Thorstensen L, Wiig JN, Eknaes M, Nesland JM et al. (2004). Genome characteristics of primary carcinomas, local recurrences, carcinomatoses, and liver metastases from colorectal cancer patients. Mol Cancer 3: 6.

    Article  PubMed  PubMed Central  Google Scholar 

  11. Eckfeld K, Hesson L, Vos MD, Bieche I, Latif F, Clark GJ . (2004). RASSF4/AD037 is a potential ras effector/tumor suppressor of the RASSF family. Cancer Res 64: 8688–8693.

    CAS  Article  PubMed  Google Scholar 

  12. Ellis CA, Vos MD, Howell H, Vallecorsa T, Fults DW, Clark GJ . (2002). Rig is a novel Ras-related protein and potential neural tumor suppressor. Proc Natl Acad Sci USA 99: 9876–9881.

    CAS  Article  PubMed  Google Scholar 

  13. Feig LA, Buchsbaum RJ . (2002). Cell signaling: life or death decisions of ras proteins. Curr Biol 12: R259–R261.

    CAS  Article  PubMed  Google Scholar 

  14. Fiordalisi JJ, Johnson RL 2nd, Ulku AS, Der CJ, Cox AD . (2001). Mammalian expression vectors for Ras family proteins: generation and use of expression constructs to analyze Ras family functions. Meth Enzymology 332: 3–36.

    CAS  Article  Google Scholar 

  15. Frame S, Balmain A . (2000). Integration of positive and negative growth signals during ras pathway activation in vivo. Curr Opin Genet Dev 10: 106–113.

    CAS  Article  PubMed  Google Scholar 

  16. Hueber AO, Evan GI . (1998). Traps to catch unwary oncogenes. Trends Genet 14: 364–367.

    CAS  Article  PubMed  Google Scholar 

  17. Hull J, Rowlands K, Lockhart E, Sharland M, Moore C, Hanchard N et al. (2004). Haplotype mapping of the bronchiolitis susceptibility locus near IL8. Hum Genet 114: 272–279.

    CAS  Article  PubMed  Google Scholar 

  18. Khokhlatchev A, Rabizadeh S, Xavier R, Nedwidek M, Chen T, Zhang XF et al. (2002). Identification of a novel Ras-regulated proapoptotic pathway. Curr Biol 12: 253–265.

    CAS  Article  PubMed  Google Scholar 

  19. Malumbres M, Barbacid M . (2003). RAS oncogenes: the first 30 years. Nat Rev Cancer 3: 459–465.

    CAS  Article  PubMed  Google Scholar 

  20. Malumbres M, Pellicer A . (1998). RAS pathways to cell cycle control and cell transformation. Front Biosci 3: d887–d912.

    CAS  Article  PubMed  Google Scholar 

  21. Marshall MS . (1993). The effector interactions of p21ras. Trends Biochem Sci 18: 250–254.

    CAS  Article  PubMed  Google Scholar 

  22. Mayo MW, Wang CY, Cogswell PC, Rogers-Graham KS, Lowe SW, Der CJ et al. (1997). Requirement of NF-kappaB activation to suppress p53-independent apoptosis induced by oncogenic Ras. Science 278: 1812–1815.

    CAS  Article  PubMed  Google Scholar 

  23. Nicke B, Bastien J, Khanna SJ, Warne PH, Cowling V, Cook SJ et al. (2005). Involvement of MINK, a Ste20 family kinase, in Ras oncogene-induced growth arrest in human ovarian surface epithelial cells. Mol Cell 20: 673–685.

    CAS  Article  PubMed  Google Scholar 

  24. Okada T, Masuda T, Shinkai M, Kariya K, Kataoka T . (1996). Post-translational modification of H-Ras is required for activation of, but not for association with, B-Raf. J Biol Chem 271: 4671–4678.

    CAS  Article  PubMed  Google Scholar 

  25. Pfeifer GP, Yoon JH, Liu L, Tommasi S, Wilczynski SP, Dammann R . (2002). Methylation of the RASSF1A gene in human cancers. Biol Chem 383: 907–914.

    CAS  Article  PubMed  Google Scholar 

  26. Ponting DP, Benjamin DR . (1996). A novel family of Ras-binding domains. Trends Biochem Sci 21: 422–425.

    CAS  Article  PubMed  Google Scholar 

  27. Serrano M, Lin AW, McCurrach ME, Beach D, Lowe SW . (1997). Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88: 593–602.

    CAS  Article  Google Scholar 

  28. Shields JM, Pruitt K, McFall A, Shaub A, Der CJ . (2000). Understanding Ras: ‘it ain’t over ‘til it's over’. Trends Cell Biol 10: 147–154.

    CAS  Article  PubMed  Google Scholar 

  29. Smyth RL, Openshaw PJ . (2006). Bronchiolitis. Lancet 368: 312–322.

    Article  PubMed  Google Scholar 

  30. Solski PA, Quilliam LA, Coats SG, Der CJ, Buss JE . (1995). Targeting proteins to membranes using signal sequences for lipid modification. Methods Enzymol 250: 435–454.

    CAS  Article  PubMed  Google Scholar 

  31. Tommasi S, Dammann R, Jin SG, Zhang XX, Avruch J, Pfeifer GP . (2002). RASSF3 and NORE1: identification and cloning of two human homologues of the putative tumor suppressor gene RASSF1. Oncogene 21: 2713–2720.

    CAS  Article  PubMed  Google Scholar 

  32. Tommasi S, Dammann R, Zhang Z, Wang Y, Liu L, Tsark WM et al. (2005). Tumor susceptibility of Rassf1a knockout mice. Cancer Res 65: 92–98.

    CAS  PubMed  Google Scholar 

  33. Vos MD, Dallol A, Eckfeld K, Allen NP, Donninger H, Hesson L et al. (2006). The RASSF1A tumor suppressor activates Bax via MOAP-1. J Biol Chem 281: 4557–4563.

    CAS  Article  PubMed  Google Scholar 

  34. Vos MD, Ellis CA, Bell A, Birrer MJ, Clark GJ . (2000). Ras uses the novel tumor suppressor RASSF1 as an effector to mediate apoptosis. J Biol Chem 275: 35669–35672.

    CAS  Article  PubMed  Google Scholar 

  35. Vos MD, Ellis CA, Elam C, Ulku AS, Taylor BJ, Clark GJ . (2003a). RASSF2 is a novel K-Ras-specific effector and potential tumor suppressor. J Biol Chem 278: 28045–28051.

    CAS  Article  PubMed  Google Scholar 

  36. Vos MD, Martinez A, Elam C, Dallol A, Taylor BJ, Latif F et al. (2004). A role for the RASSF1A tumor suppressor in the regulation of tubulin polymerization and genomic stability. Cancer Res 64: 4244–4250.

    CAS  Article  PubMed  Google Scholar 

  37. Vos MD, Martinez A, Ellis CA, Vallecorsa T, Clark GJ . (2003b). The pro-apoptotic Ras effector Nore1 may serve as a Ras-regulated tumor suppressor in the lung. J Biol Chem 278: 21938–21943.

    CAS  Article  PubMed  Google Scholar 

  38. White MA, Nicolette C, Minden A, Polverino A, Van AL, Karin M et al. (1995). Multiple Ras functions can contribute to mammalian cell transformation. Cell 80: 533–541.

    CAS  Article  PubMed  Google Scholar 

  39. Williams JG, Drugan JK, Yi GS, Clark GJ, Der CJ, Campbell SL . (2000). Elucidation of binding determinants and functional consequences of Ras/Raf-cysteine-rich domain interactions. J Biol Chem 275: 22172–22179.

    CAS  Article  PubMed  Google Scholar 

Download references

Acknowledgements

This work was supported in part by Intramural funds of the National Cancer Institute and RR018733 (GJC), FL is supported in part by Cancer Research UK.

Author information

Affiliations

Authors

Corresponding author

Correspondence to G J Clark.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Allen, N., Donninger, H., Vos, M. et al. RASSF6 is a novel member of the RASSF family of tumor suppressors. Oncogene 26, 6203–6211 (2007). https://doi.org/10.1038/sj.onc.1210440

Download citation

Keywords

  • Ras
  • RASSF6
  • tumor suppressor

Further reading

Search

Quick links