Mutant p53 exerts a dominant negative effect by preventing wild-type p53 from binding to the promoter of its target genes

Abstract

Mutation of the p53 tumor suppressor gene is the most common genetic alteration in human cancer. A majority of these mutations are missense mutations in the DNA-binding domain. As a result, the mutated p53 gene encodes a full-length protein incapable of transactivating its target genes. In addition to this loss of function, mutant p53 can have a dominant negative effect over wild-type p53 and/or gain of function activity independently of the wild-type protein. To better understand the nature of the tumorigenic activity of mutant p53, we have investigated the mechanism by which mutant p53 can exert a dominant negative effect. We have established several stable cell lines capable of inducibly expressing a p53 mutant alone, wild-type p53 alone, or both proteins concurrently. In this context, we have used chromatin immunoprecipitation to determine the ability of wild-type p53 to bind to its endogenous target genes in the presence of various p53 mutants. We have found that p53 missense mutants markedly reduce the binding of wild-type p53 to the p53 responsive element in the target genes of p21, MDM2, and PIG3. These findings correlate with the reduced ability of wild-type p53 in inducing these and other endogenous target genes and growth suppression in the presence of mutant p53. We also showed that mutant p53 suppresses the ability of wild-type p53 in inducing cell cycle arrest. This highlights the sensitivity and utility of the dual inducible expression system because in previous studies, p53-mediated cell cycle arrest is not affected by transiently overexpressed p53 mutants. Together, our data showed that mutant p53 exerts its dominant negative activity by abrogating the DNA binding, and subsequently the growth suppression, functions of wild-type p53.

Introduction

p53 is a sequence-specific transcription factor that functions as a tumor suppressor protein. As such, mutations of the p53 gene are selected for in greater than 50% of all human cancers (Hollstein et al., 1994). Wild-type p53 is activated in response to cellular stresses, such as oncogene activation (Lowe and Ruley, 1993), DNA damage (Nelson and Kastan, 1994), and hypoxia (Graeber et al., 1996). Following activation, p53 induces downstream effects including cell cycle arrest, DNA repair, and apoptosis, thus preventing the proliferation of damaged cells.

The most common p53 mutations are missense mutations in the DNA-binding domain (DBD), producing a full-length protein that is incapable of binding DNA and is therefore nonfunctional. There are two classes of p53 DBD mutants, conformational mutants and contact site mutants. The conformational mutants, for example, V143A, R249S, and R175H, alter the structure of the protein (Cho et al., 1994). This alteration is detectable by an antibody (Pab 240) that recognizes residues exposed in the mutant but cryptic in the wild type (Milner and Medcalf, 1991). The contact site mutants, for example, R248W and R273H, have an altered residue at a site that, in the wild-type protein, directly contacts DNA (Cho et al., 1994; Rolley et al., 1995). Four of the p53 mutations mentioned above (R249S, R175H, R248W, and R273H) are described as ‘hot-spot’ mutants because they are among the most prevalent p53 mutations in human cancer (Hollstein et al., 1994).

In addition to this loss of function, some p53 mutants may have a gain of function, exhibiting oncogenic properties, or a dominant negative effect, inhibiting the function of wild-type p53 (Ko and Prives, 1996). The gain of function mutant exhibits a selective advantage in carcinogenesis (Levine et al., 1991). This is a potential explanation for why missense mutations account for approximately 74% of p53 mutations in human cancers (Hussain and Harris, 1998). In mouse models, mutant p53 expression in lymphoblastic leukemia cells or murine fibroblasts resulted in greater tumorigenicity and tissue invasiveness as compared to p53-null cells (Dittmer et al., 1993; Hsiao et al., 1994). This gain of function is not simply due to loss of function of wild-type p53. p53 mutants actually alter patterns of gene expression. For example, mutant p53 has been found to upregulate the promoters of several genes, including multidrug resistance-1 (MDR-1) (Chin et al., 1992; Dittmer et al., 1993; Chen et al., 1994; Lin et al., 1995; Atema and Chene, 2002) and c-myc (Frazier et al., 1998). While the exact molecular basis for mutant p53 gain of function is still not clear, the ability of mutant p53 to exert oncogenic effects independently of wild-type p53 provides a selective advantage for p53 missense mutation in cancer.

p53 mutants also exhibit a dominant negative effect through inactivation of the function of wild-type p53. This characteristic increases the significance of a single mutant p53 allele. While carcinogenesis requires the loss of both alleles of most tumor suppressor genes, mutation of one allele of p53 can result in loss of function. For example, transgenic mice expressing p53 mutated at residue 135 in a p53+/− background had a higher incidence of tumor formation compared to p53+/− mice without the transgene (Harvey et al., 1995). In another model, mice with R172H mutations (equivalent to the human mutation at residue 175) had increased rates of metastasis and decreased loss of heterozygosity (LOH) as compared to p53+/− mice (Liu et al., 2000). These results reveal that the mutant was capable of inducing carcinogenesis in the presence of wild-type p53, indicative of a dominant negative phenotype. This phenomenon is also applicable to human cancers. In a study of families with Li–Fraumeni Syndrome, which is characterized by germline p53 mutation, patients with missense mutations exhibited earlier age of diagnosis and decreased incidence of LOH as compared to patients with mutations that resulted in truncated p53 protein (Birch et al., 1998). Also, as compared to recessive mutations or wild-type p53, dominant negative mutations are associated with an earlier age of onset in patients with sporadic glioblastoma (Marutani et al., 1999).

While the dominant negative effect clearly occurs in cancer models, the mechanism by which it occurs has not been fully elucidated. There are several hypotheses that have been proposed to explain this effect. Mutant p53 has been shown to heterotetramerize with wild-type p53 (Milner and Medcalf, 1991; Milner et al., 1991; Chene, 1998). This is not unexpected because most p53 DBD missense mutants have no alteration in the tetramerization domain. (Milner and Medcalf (1991) have suggested that this heterotetramerization of mutant with wild-type p53 converts the wild-type protein to an inactive, mutant conformation). While this explanation may be relevant for p53 conformational mutants, it might fail to explain the dominant negative effect exhibited by contact site mutants. For example, the monoclonal antibody (Pab240) that recognizes the mutant conformation does not interact with p53 proteins with mutations at DNA contact sites, such as residues R248 or R273 (Legros et al., 1994; Ory et al., 1994; Chene, 1998). The dominant negative effect of these p53 mutants has been proposed to be due to the insufficient participation of the mutant in transactivation of certain p53 targets. In other words, the wild-type/mutant heterotetramer fails to bind DNA with as high affinity as a wild-type p53 homotetramer would bind (Friedlander et al., 1996; Chene, 1998; Nicholls et al., 2002). This hypothesis can also explain why mutant p53 is sometimes dominant negative for transactivation of target genes associated with apoptosis (BAX, IGFBP3), for which p53 has lower affinity, but recessive for transactivation of target genes associated with cell cycle arrest (p21, GADD45) or p53 negative regulator (MDM2) for which p53 has higher affinity (Friedlander et al., 1996; Ludwig et al., 1996; Delia et al., 1997; Ryan and Vousden, 1998; Aurelio et al., 2000; Szak et al., 2001; Monti et al., 2002; Qian et al., 2002).

Although these proposed mechanisms offer a good explanation of the dominant negative effect, there are other possibilities that do not require heterotetramerization of wild-type and mutant p53. The ability of mutant p53 to inhibit wild-type p53 could be due, in part, to binding of the mutant to transcriptional cofactors that are necessary for wild-type p53 activity. This squelching effect could involve cofactors, such as components of the TFIID and TFIIH complexes (Xiao et al., 1994; Horikoshi et al., 1995; Lu and Levine, 1995; Wang et al., 1995), which are known to bind to p53, or a unique, as yet unknown, factor required for p53 transactivational activity (Joers et al., 1998). This hypothesis is supported by the ability of p53 mutants to inhibit the activity of a p53 monomer that is incapable of forming tetramers (Joers et al., 1998). It is likely that the dominant negative effect can be attributed to a combination of these mechanisms, depending on the mutant conformation, the affinity of the mutant for p53 targets, the DNA-binding site, and the cell type and relevant cofactors.

To systemically analyse the dominant negative effect of mutant p53 in vivo, we have created several stable cell lines capable of inducibly expressing mutant p53 alone, wild-type p53 alone, or both proteins concurrently. Using this dual inducible system, we have found that the p53 mutants, R175H, R248W, and R273H, reduce the ability of the wild-type protein to suppress cell proliferation. Upon further investigation of the contact site mutant R273H and the conformational mutant R175H, we have found that these mutants reduce the ability of wild-type p53 to transactivate its target genes. To understand the mechanism of this inhibition, we used chromatin immunoprecipitation (ChIP) and showed that mutant p53 exerts its dominant negative effect by reducing the ability of the wild-type protein to bind to the p53 responsive element in its target genes, and consequently its transcriptional activity.

Results

Expression of mutant and wild-type p53 in the dual inducible system

Using the dual inducible system (Willis et al., 2003), we have established stable cell lines that express mutant p53 in the tetracycline-repressible system and wild-type p53 in the ecdysone-inducible system (Figure 1). Since p53 mutants in the DNA-binding domain are translated as full-length proteins, it is difficult to distinguish these proteins by SDS–PAGE. Therefore, we took advantage of the nontumor-derived polymorphism at position 72 of p53, encoding either a proline or an arginine. These polymorphic variants display different migration patterns on SDS-PAGE (Harris et al., 1986). For example, in Figure 1a and c, the HA-tagged mutant protein with arginine at codon 72 migrated faster than the Flag-tagged wild-type p53 protein with proline at residue 72. Alternatively, in Figure 1b, both wild-type p53 and mutant p53(248) have proline at codon 72, but the mutant protein migrated more slowly because it is HA tagged while the wild-type is untagged. The use of anti-p53 antibodies allows us to compare the level of mutant and wild-type p53 by Western blot analyses (Figure 1). The dual inducible system provides a unique way to investigate the dominant negative effect of mutant p53 because the activity of the wild-type protein in the presence or absence of mutant p53 can be evaluated in the same cellular background.

Figure 1
figure1

Establishment of stable cell lines inducibly expressing mutant p53, wild-type p53, or both proteins concurrently. Using the dual inducible system, cell lines were established that can inducibly express wild-type p53 and one of the p53 hot-spot mutants: R175H (a), R248W (b), or R273H (c). Cells were induced to express neither protein (lane 1), p53 mutant alone (lane 2), wild-type p53 alone (lane 3), or both proteins concurrently (lane 4) for 24 h. Cell extracts were collected and proteins resolved by SDS–PAGE. p53 expression was detected by probing with αp53 antibodies Pab1801 and Pab421. p21 expression was detected with the polyclonal antibody αp21. The membrane was probed with actin as a loading control

To ascertain that the wild-type p53 expressed by this dual inducible system is transcriptionally active, we determined the induction of p21, a known p53 target gene. As shown in Figure 1a–c (middle panel), p21 was highly induced by wild-type p53, but not mutant p53. Interestingly, induction of p21 by wild-type p53 was diminished in the presence of conformational (Figure 1a) or contact site (Figure 1b,c) p53 mutants. This indicates that mutant p53 is dominant negative over wild-type p53.

Mutant and wild-type p53 interact physically and are coexpressed when both are expressed in the dual inducible system

It is known that mutant and wild-type p53 form a heterotetramer both in vitro and in vivo (Milner and Medcalf, 1991). Thus, we investigated the physical relationship of these proteins in our system. The interaction between mutant and wild-type p53 was determined by immunoprecipitation/Western blot analyses. When the HA-tagged mutant p53(R273H) was immunoprecipitated by anti-HA antibody, the FLAG-tagged wild-type p53 was found in the anti-HA immunoprocipitates only from cell extracts containing both mutant and wild-type p53 (Figure 2, compare lane 8 with lanes 5–7).

Figure 2
figure2

Mutant and wild-type p53 interact physically in vivo. Cell extracts were prepared from cells (cell line #208) uninduced (lanes 1 and 5), induced to express HA-tagged mutant p53(R273H) (lanes 3 and 7), FLAG-tagged wild-type p53 (lanes 2 and 6), or both (lanes 4 and 8). For lanes 1–4, the Western blot was probed with anti-p53 antibody. For lanes 5–8, cell lysates were immunoprecipitated with anti-HA antibody (lanes 5–8) and the proteins in the immunoprecipitates were then detected with anti-FLAG antibody (right panel on the top) or anti-p53 antibody (right panel on the bottom)

Although mutant and wild-type p53 expression was selected for in our stable cell lines, we wanted to ensure that these proteins were being expressed within the same cell. This was accomplished using immunofluorescence staining of HA-tagged mutant p53(R273H) and FLAG-tagged wild-type p53. As shown in Figure 3, mutant p53 was detected by polyclonal anti-HA antibody (red) and wild-type p53 by monoclonal anti-FLAG antibody (green) in the same cell when both proteins were induced. When these images were merged, the fluorescent signal was altered, suggesting that mutant and wild-type p53 were localized in the same compartment of nucleus. Therefore, the diminished induction of p21 is likely due to the direct dominant negative effect of mutant p53 on wild-type p53.

Figure 3
figure3

Mutant and wild-type p53 are expressed in the same cell. Cells were seeded in four-well chamber slides, induced for 24 h in appropriate induction media and stained for mutant (anti-HA) and wild-type (anti-Flag) p53. Nuclear stain is blue, mutant p53 stain is red, and wild-type p53 stain is green

Mutant p53 inhibits the ability of wild-type p53 to transactivate its target genes

The decreased induction of p21 protein (Figure 1) indicates that mutant p53 inhibits the ability of wild-type p53 to transactivate the p21 gene. Previous studies have shown that mutant p53 can inhibit the ability of wild-type p53 to regulate p53-responsive reporters (Kern et al., 1992; Joers et al., 1998; Aurelio et al., 2000). The dual inducible system is advantageous in that it allows us to evaluate transactivation of endogenous p53 target genes. This analysis brings us closer to understanding the mechanism of the dominant negative effect. At the transcript level, both conformation mutant p53(R175H) and contact site mutant p53(R273H) markedly reduced the ability of wild-type p53 to increase expression of genes involved in the cell cycle arrest (p21), apoptosis (PIG3 and FDXR), and the p53 negative regulator (MDM2) (Figure 4).

Figure 4
figure4

Mutant p53 decreases the ability of wild-type p53 to transactivate its target genes. Northern blots were prepared using 10 μg of total RNA purified from cells induced to express neither protein, mutant p53 alone, wild-type p53 alone, or both proteins concurrently for 24 h. The blots were probed with p21, MDM2, PIG3, FDXR, and GAPDH cDNAs, respectively. Fold induction was calculated as compared to control samples in which neither protein was expressed

Mutant p53 inhibits the ability of wild-type p53 to bind to the p53 responsive element in its target genes

The ability of p53 to bind to the p53 responsive element in the promoter of its target genes in the presence of mutant p53 has been explored in vitro (Chene, 1998; Nicholls et al., 2002). To explore this further in vivo, we have used ChIP assay (Figure 5). Upon exploration of the effect of the contact site mutant R273H, we have found that this mutant reduced the ability of wild-type p53 to bind to the p21 promoter by 34%, and to the MDM2 promoter by 36% (Figure 5, right panel). Interestingly, mutant p53 almost completely abrogated the ability of wild-type p53 to bind to the promoter of the PIG3 gene (Figure 5, right panel). Similarly, the conformational mutant p53(R175H) also reduced the binding of wild-type p53 to the p21 promoter (55%), the MDM2 promoter (15%), and the PIG3 promoter (83%) (Figure 5, left panel). We would like to mention that these results were confirmed from at least two different collections of ChIP samples for each mutant tested.

Figure 5
figure5

p53(R273H) and p53(R175H) decrease the binding of wild-type p53 to its target genes. ChIP was performed using cell extracts from cells induced to express wild-type p53 alone, or both wild-type and mutant proteins concurrently. Wild-type p53–DNA complexes were immunoprecipitated by anti-Flag antibody. Anti-Myc antibody was used as a negative control. PCR was used to identify DNA to which wild-type p53 was bound. Samples were normalized to input and the fold decrease in binding was calculated for wild-type p53 alone compared to wild-type p53 expressed in the presence of mutant p53

Mutant p53 reduces the ability of wild-type p53 to suppress cell proliferation

Wild-type p53 is capable of suppressing cell proliferation through several pathways, including cell cycle arrest and apoptosis. Mutant p53, however, is not capable of inhibiting cell growth. To determine the ability of wild-type p53 to perform this antiproliferative function in the presence of mutant p53, we evaluated the growth rate of cells expressing neither protein, mutant p53 alone, wild-type p53 alone, or both proteins concurrently. As shown in Figure 6, wild-type p53 completely inhibited cell proliferation. In contrast, cells expressing mutant p53 proliferated at the same rate as control cells. Interestingly, coexpression of mutant p53 with wild-type p53 impeded the growth inhibition by the wild-type protein. This effect was observed with both conformational (Figure 6a) and contact site (Figure 6b,c) mutants.

Figure 6
figure6

Mutant p53 inhibits the ability of wild-type p53 to suppress cell proliferation. Cells were induced to express neither protein, p53 mutant alone, wild-type p53 alone, or both concurrently. Growth rates were evaluated over 5 days

Dominant negative mutant p53 disrupts induction of cell cycle arrest by wild-type p53

Several groups have reported that induction of apoptosis, but not cell cycle arrest, by wild-type p53 is inhibited by transiently overexpressed dominant negative p53 (Ryan and Vousden, 1998; Aurelio et al., 2000; Nicholls et al., 2002). To investigate these effects in our system, we analysed the DNA content of cells induced to express neither protein, mutant p53 alone, wild-type p53 alone, or both proteins concurrently (Figure 7). As expected, mutant p53 was unable to induce G1 arrest, while wild-type p53 induced G1 arrest as demonstrated by an increased percentage of cells with G1 DNA content. This increase was diminished upon coexpression of mutant p53 with wild-type protein. For example, the percentage of cells in G1 was reduced from 88.8% in the presence of wild-type p53 alone to 80.6% in the presence of both wild-type and mutant p53(175) (Figure 7, top panel). In addition, reduced antiproliferative capacity of wild-type p53 in the presence of mutant p53 was further demonstrated by the increased percentage of cells in S phase (9.1%) as compared to cells expressing wild-type p53 alone (3.6%) (Figure 7, top panel). These results support a dominant negative role of mutant p53 in cell cycle arrest. Similarly, contact site p53 mutants (R248W and R273H) diminished the ability of wild-type p53 to induce cell cycle arrest (Figure 7, middle and bottom panels).

Figure 7
figure7

Mutant p53 inhibits the ability of wild-type p53 to induce cell cycle arrest. Cells were induced to express neither protein (Control), mutant p53 alone, wild-type p53 alone, or both proteins concurrently (mutant+wild type). DNA histogram analysis was used to determine the percentage of cells in each phase of the cell cycle as detected by propidium iodide staining of DNA

Discussion

We have shown that both conformational (R175H) and contact site (R248W and R273H) mutants exhibit a dominant negative activity over wild-type p53. This is demonstrated by the ability of mutant p53 to inhibit the activity of the wild-type protein in suppressing cell proliferation and in inducing cell cycle arrest. We also showed that mutant p53 inhibits the ability of wild-type p53 to bind to the p53 responsive element in the promoter of its target genes and subsequently its ability to transactivate its target genes.

The dual inducible system is unique in that it allows us to investigate the effect of expression of wild-type and mutant p53, alone or in combination, within the same cell. Several studies, in both mice and humans, have demonstrated a carcinogenic advantage to cells expressing mutant p53, either in the presence or absence of wild-type p53 (Dittmer et al., 1993; Hsiao et al., 1994; Harvey et al., 1995; Birch et al., 1998; Marutani et al., 1999; Liu et al., 2000). The observed dominant negative effect has sparked interest in the mechanism behind this phenomenon. It has been demonstrated that dominant negative p53 mutants decrease the ability of wild-type p53 to upregulate p53 responsive reporters (Kern et al., 1992; Friedlander et al., 1996; Ludwig et al., 1996; Joers et al., 1998; Aurelio et al., 2000). However, little is known about the comparative ability of wild-type p53 to transactivate endogenous targets in the absence and presence of mutant p53. The dual inducible system provides a way to compare these activities in the same cellular background, eliminating the effect of differences in available transcriptional cofactors and inherent proliferation rates of different cell lines.

To determine the mechanism of the dominant negative activity, we have performed ChIP to investigate whether mutant p53 prevents the wild-type protein from sequence-specific binding to the promoter of its target genes. This method is advantageous because it allows exploration of DNA binding in vivo. The dual inducible system allows comparison of this binding in cells expressing wild-type p53 alone to cells expressing wild-type p53 in the presence of a mutant p53. Thus, our data have provided convincing evidence that the dominant negative activity of mutant p53 is through inhibition of wild-type p53 to bind to the p53 responsive element and subsequently, its transcriptional activity.

It has been suggested that an excess of mutant p53 over wild-type p53 is required to exert the dominant negative effect (Blagosklonny, 2000). However, our results showed that, although wild-type and mutant p53 were expressed concurrently at an equivalent level (Figure 1), the mutant is capable of inhibiting wild-type function. As mutant p53 does not activate expression of its negative regulator, MDM2, nor is it degraded by MDM2 (Prives and Hall, 1999; Peng et al., 2001), it is more stable than wild-type p53. Therefore, in cancer cells, it is likely that mutant p53 accumulates to a greater extent than the wild-type protein, increasing its dominant negative activity.

While previous reports have indicated that p53 mutants are more likely to be dominant negative in induction of apoptosis than cell cycle arrest, the dual inducible system has allowed us to show that this effect is also evident in induction of G1 arrest. This evaluation is easier because we can compare expression of mutant p53 in the absence or presence of wild-type p53 in the same cellular background. We have shown that, although mutant p53 does not completely abrogate the ability of wild-type p53 to induce cell cycle arrest, it definitely decreases its capacity to do so.

Materials and methods

Plasmids

Flag-tagged p53 was generated by TA cloning into pGEMT Easy using 5′ primer Flag p53 (IndexTermAAGGATCCACCATGGATTACAAGGA TGACGACGATAAGGAGGAGCCGCAGTCAGAT) and the 3′ primer Tap p53 3′ (IndexTermGCCGGGCGGGGGTGTGGAATCAAC). This fragment was cloned into pIND p53 at the BamHI and PvuII sites. p53 mutants (R175H with Arg72, R248W with Pro72, and R273H with Arg72) were excised from pCMV-175, pCMV-248, and pCMV-273, respectively (kindly provided by Bert Vogelstein) and cloned into pUHD 10-3 at its BamHI sites to produce 10-3 expression vectors containing p53(175)Arg72, p53(248)Pro72, and p53(273)Arg72, respectively. To make HA-tagged p53(175)Pro72, p53(273)Pro72, and p53(248)Pro72, the N-terminal region (residues 2–143: PvuII site) of the HA-tagged wild-type p53 was used to substitute the corresponding region in mutant p53. To make HA-tagged p53(175)Arg72, the N-terminal region (residues 2–39: BsrDI site) of HA-tagged wild-type p53 was used to substitute the corresponding region in p53(175)Arg72. To make HA-tagged p53(273)Arg72, the region of the HA-tagged construct (p53(175)Arg72) with arginine at codon 72 (residues 2–143: PvuII site) was used to substitute the region of mutant constructs containing proline at codon 72.

Establishment of a dual inducible system and stable cell lines

H1299 is a p53-null human non-small cell lung carcinoma cell line. Cells were cultured in Dulbecco's modified Eagle's medium (DMEM) (Gibco, Invitrogen Corp., Carlsbad, CA, USA) supplemented with 10% fetal bovine serum. All inductions were cultured in DMEM with 10% tet-system approved serum. To establish the dual inducible system, H1299 cells were transfected with the tetracycline-repressible system regulatory vector, 15-1 neo and selected with 500 μg/ml neomycin (G418) to establish H24 cells as previously described (Chen et al., 1996). These cells were subsequently transfected with the ecdysone-inducible system regulatory vector, pVgRXR and selected with zeocin (250 μg/ml) to establish HTE20 cells. HTE20 cells were then cotransfected with three plasmids: (1) pBabe (Morgenstern and Land, 1990, 2) a 10-3 vector containing one of the p53 mutants, and (3) a pIND vector containing wild-type p53. Cells were selected with 1 μg/ml puromycin (Sigma Chemical Co., St Louis, MO, USA). Individual clones were screened for inducible expression of wild-type or mutant p53 by Western blot analyses using a mix of anti-p53 monoclonal antibodies Pab 1801 and Pab 421 (Chen et al., 1995). The following cell lines express mutant p53 in the tetracycline-repressible system and wild-type p53 in the ecdysone-inducible system: p53(175)Arg72/p53 #317 inducibly expresses p53(175) and p53; p53(248)Pro72/p53 #30 inducibly expresses p53(248) and p53; and p53(273)Pro72/p53 #268 inducibly expresses p53(273) and p53. These cell lines express HA-tagged mutant p53 and untagged wild-type p53. The cell line p53(175)Arg72/p53 #320 inducibly expresses p53(175) and p53 and p53(273)Arg72/p53 #208 inducibly expresses p53(273) and p53. These cell lines express HA-tagged mutant p53 and Flag-tagged wild-type p53.

Immunoprecipitation and Western analyses

Whole-cell lysates were prepared by incubating at 4°C for 30 min in the lysis buffer (0.3 M. NaCl, 20 mM HEPES (pH 7.4), 0.5% Triton X-100, 5 mM NaF, 0.5 mM Na3VO4, 0.5 mM PMSF, 1 μg/ml leupeptin, and 1 μg/ml antipain). After preclearing with protein G agarose beads, immunoprecipitations were carried out by incubating the extracts with anti-HA antibody at 4°C for 1 h. Bound proteins were captured by incubating with protein G agarose beads at 4°C for 1 h, washed three times with 0.1 M NaCl/20 mM HEPES (pH 7.4)/0.5% Triton X-100, and resolved on SDS–PAGE. Separated proteins were transferred to nitrocellular membrane and Western blotted with the indicated antibody using standard procedures (Sambrook et al., 1989), except that horseradish peroxidase-conjugated goat anti-mouse kappa secondary antibody was used. To extract protein for Western blot analysis, cells were washed with 1 × phosphate-buffered saline (PBS: 8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, and 0.24 g KH2PO4 in 1 l as described in (Sambrook et al., 1989)), resuspended in 2 × sample buffer, and denatured by boiling for 5 min. Anti-p53 mouse monoclonal antibodies Pab 1801 and Pab 421 (Chen et al., 1995) were used. Anti-FLAG monoclonal antibody M2 was purchased from Sigma Chemical Co. (St Louis, MO, USA). Anti-p21 polyclonal antibody C19 was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antiactin polyclonal antibody was purchased from Sigma Chemical Co. (St Louis, MO, USA).

Growth rate analyses

Cells were seeded at approximately 60 000 cells/60-mm plate. Cells were induced to express neither protein, mutant p53 alone, wild-type p53 alone, or both proteins concurrently. The medium was replaced every 72 h. Each day over 5 days, two plates for each of the four inductions were washed with DMEM to remove dead cells. Live cells were trypsinized and samples from each plate were counted three times using a Coulter cell Counter (Coulter Corporation, Miami, FL, USA). The average number of cells from each plate was calculated to determine the growth rate for each induction.

DNA histogram analysis

Cells were seeded at approximately 200 000 cells/100-mm plate and induced to express neither protein, mutant p53 alone, wild-type p53 alone, or both proteins concurrently. At 3 days after induction, both floating cells in the medium and live cells on the plate were collected and fixed with 100% ethanol for at least 1 h at 4°C. The fixed cells were centrifuged and resuspended at a concentration of 2 million cells/ml in 1 × PBS with 20 μg/ml of RNase A and 50 μg/ml of propidium iodide (Sigma Chemical Co., St Louis, MO, USA). The stained cells were analysed in a fluorescence-activated cell sorter (FACSCaliber; Becton Dickson, Menlo Park, CA, USA) within 4 h.

RNA isolation and Northern blot analysis

Total RNA was isolated using Trizol reagent (Invitrogen., Carlsbad, CA, USA). Northern blot analyses were performed as described (Dohn et al., 2001). The p21 probe was made from a 1.0-kilobase pair EcoRI–EcoRI fragment (el-Deiry et al., 1993); the MDM2 probe was made from a 2.1-kilobase pair NotI–SmaI fragment (Oliner et al., 1993); and the GAPDH probe was made from a 1.25-kilobase pair PstI–PstI cDNA fragment (Fort et al., 1985). The PIG3 and FDXR probes were prepared as described (Liu and Chen, 2002; Zhu et al., 1998).

ChIP

Cells were seeded at approximately 60% confluency and induced to express neither protein, mutant p53 alone, wild-type p53 alone, or both proteins concurrently for 16 h. Cells were collected by scraping and nuclei were extracted on ice in Hypotonic Buffer A (10 mM HEPES, 1.5 mM MgCl2, 10 mM KCl, and protease inhibitor cocktail) for 10 min, followed by 0.5% NP-40. Genomic DNA and protein were crosslinked with 1% formaldehyde for 10 min at room temperature. Samples were sonicated to yield 200- to 1000-bp DNA fragments. In all, 1/50th of the sample was removed for input. Following clarification by centrifugation, sonicated lysates were diluted with equal volume of 2 × RIPA buffer (100 mM Tris-HCl pH 7.4, 2% NP-40, 0.5% Na-deoxycholate, 300 mM NaCl, 2 mM EDTA) and 1 : 100 protease inhibitor cocktail and immunoprecipitated with Anti-Flag antibody M2, αp53Pab 1801/Pab 421, or αMyc 9E10 as a negative control. The immunocomplexes were captured by Protein A/G sepharose beads that were saturated with salmon sperm DNA and washed sequentially with TSE buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.1) containing 150 mM NaCl, TSE containing 500 mM NaCl, Buffer III (0.25 M LiCl, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris-HCl pH 8.1), and TE buffer (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA). The immunocomplexes were then eluted twice with elution buffer (1% SDS, 0.1 M NaHCO3) for 15 min at room temperature. Crosslinking was reversed at 65°C for at least 6 h. DNA was purified by phenol chloroform extraction and ethanol precipitation and resuspended in 50 μl TE. PCR was performed to detect the p21 promoter fragment with the 5′ primer p2151 (IndexTermCAGGCTGTGGCTCTGATTGG) and the 3′ primer p2131 (IndexTermTCCAGAGTAACAGGCTAAGG). PCR was performed to detect the MDM2 genomic DNA with the 5′ primer MDM2RE1F (IndexTermGGGAGTTCAGGGTAAAGGTCA) and the 3′ primer MDM2RE1R (IndexTermCCTTTTACTGCAGTTTCG). PCR was performed to detect the PIG3 promoter fragment with the 5′ primer PIG3 RE F (IndexTermCCAACGGCTCCTTTCTCTTC) and the 3′ primer PIG3 RE R (IndexTermGCTTGACAGAAAGTGCGATTC).

Immunofluorescence

Cells were seeded at approximately 60% confluency on four-well chamber slides and induced to express neither protein (2 μg/ml tetracycline, no ponasterone), mutant p53 alone (no tetracycline, no ponasterone), wild-type p53 alone (2 μg/ml tetracycline, 2 μ M ponasterone), or both proteins concurrently (no tetracycline, 2 μ M ponasterone). At 24 h after induction, cells were fixed with 10% formalin in PBS, permeabilized with 0.5% Triton X-100, and blocked with 1% BSA. Fixed cells were incubated for 60 min with the primary antibodies, polyclonal α-HA and mouse monoclonal α-Flag. Cells were then stained for 30 min with the secondary antibodies, Texas Red-conjugated goat anti-rabbit and FITC-conjugated goat anti-mouse (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA). Nuclei were visualized by staining with 4′,6-diamidino-2-phenylindole (DAPI) (Molecular Probes, Inc., Eugene, OR, USA) and mounted with coverslips. Stained cells were analysed by fluorescent microscopy.

References

  1. Atema A and Chene P . (2002). Cancer Lett., 185, 103–109.

  2. Aurelio ON, Kong XT, Gupta S and Stanbridge EJ . (2000). Mol. Cell. Biol., 20, 770–778.

  3. Birch JM, Blair V, Kelsey AM, Evans DG, Harris M, Tricker KJ and Varley JM . (1998). Oncogene, 17, 1061–1068.

  4. Blagosklonny MV . (2000). FASEB J., 14, 1901–1907.

  5. Chen X, Bargonetti J and Prives C . (1995). Cancer Res., 55, 4257–4263.

  6. Chen X, Ko LJ, Jayaraman L and Prives C . (1996). Genes Dev., 10, 2438–2451.

  7. Chen Y, Chen PL and Lee WH . (1994). Mol. Cell. Biol., 14, 6764–6772.

  8. Chene P . (1998). J. Mol. Biol., 281, 205–209.

  9. Chin KV, Ueda K, Pastan I and Gottesman MM . (1992). Science, 255, 459–462.

  10. Cho Y, Gorina S, Jeffrey PD and Pavletich NP . (1994). Science, 265, 346–355.

  11. Delia D, Goi K, Mizutani S, Yamada T, Aiello A, Fontanella E, Lamorte G, Iwata S, Ishioka C, Krajewski S, Reed JC and Pierotti MA . (1997). Oncogene, 14, 2137–2147.

  12. Dittmer D, Pati S, Zambetti G, Chu S, Teresky AK, Moore M, Finlay C and Levine AJ . (1993). Nat. Genet., 4, 42–46.

  13. Dohn M, Zhang S and Chen X . (2001). Oncogene, 20, 3193–3205.

  14. el-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE, Kinzler KW and Vogelstein B . (1993). Cell, 75, 817–825.

  15. Fort P, Marty L, Piechaczyk M, el Sabrouty S, Dani C, Jeanteur P and Blanchard JM . (1985). Nucleic Acids Res., 13, 1431–1442.

  16. Frazier MW, He X, Wang J, Gu Z, Cleveland JL and Zambetti GP . (1998). Mol. Cell. Biol., 18, 3735–3743.

  17. Friedlander P, Haupt Y, Prives C and Oren M . (1996). Mol. Cell. Biol., 16, 4961–4971.

  18. Graeber TG, Osmanian C, Jacks T, Housman DE, Koch CJ, Lowe SW and Giaccia AJ . (1996). Nature, 379, 88–91.

  19. Harris N, Brill E, Shohat O, Prokocimer M, Wolf D, Arai N and Rotter V . (1986). Mol. Cell. Biol., 6, 4650–4656.

  20. Harvey M, Vogel H, Morris D, Bradley A, Bernstein A and Donehower LA . (1995). Nat. Genet., 9, 305–311.

  21. Hollstein M, Rice K, Greenblatt MS, Soussi T, Fuchs R, Sorlie T, Hovig E, Smith-Sorensen B, Montesano R and Harris CC . (1994). Nucleic Acids Res., 22, 3551–3555.

  22. Horikoshi N, Usheva A, Chen J, Levine AJ, Weinmann R and Shenk T . (1995). Mol. Cell. Biol., 15, 227–234.

  23. Hsiao M, Low J, Dorn E, Ku D, Pattengale P, Yeargin J and Haas M . (1994). Am J Pathol, 145, 702–714.

  24. Hussain SP and Harris CC . (1998). Cancer Res., 58, 4023–4037.

  25. Joers A, Kristjuhan A, Kadaja L and Maimets T . (1998). Oncogene, 17, 2351–2358.

  26. Kern SE, Pietenpol JA, Thiagalingam S, Seymour A, Kinzler KW and Vogelstein B . (1992). Science, 256, 827–830.

  27. Ko LJ and Prives C . (1996). Genes Dev., 10, 1054–1072.

  28. Legros Y, Meyer A, Ory K and Soussi T . (1994). Oncogene, 9, 3689–3694.

  29. Levine AJ, Momand J and Finlay CA . (1991). Nature, 351, 453–456.

  30. Lin J, Teresky AK and Levine AJ . (1995). Oncogene, 10, 2387–2390.

  31. Liu G and Chen X . (2002). Oncogene, 21, 7195–7204.

  32. Liu G, McDonnell TJ, Montes de Oca Luna R, Kapoor M, Mims B, El-Naggar AK and Lozano G . (2000). Proc Natl Acad Sci USA, 97, 4174–4179.

  33. Lowe SW and Ruley HE . (1993). Genes Dev., 7, 535–545.

  34. Lu H and Levine AJ . (1995). Proc Natl Acad Sci USA, 92, 5154–5158.

  35. Ludwig RL, Bates S and Vousden KH . (1996). Mol. Cell. Biol., 16, 4952–4960.

  36. Marutani M, Tonoki H, Tada M, Takahashi M, Kashiwazaki H, Hida Y, Hamada J, Asaka M and Moriuchi T . (1999). Cancer Res., 59, 4765–4769.

  37. Milner J and Medcalf EA . (1991). Cell, 65, 765–774.

  38. Milner J, Medcalf EA and Cook AC . (1991). Mol. Cell. Biol., 11, 12–19.

  39. Monti P, Campomenosi P, Ciribilli Y, Iannone R, Inga A, Abbondandolo A, Resnick MA and Fronza G . (2002). Oncogene, 21, 1641–1648.

  40. Morgenstern JP and Land H . (1990). Nucleic Acids Res., 18, 3587–3596.

  41. Nelson WG and Kastan MB . (1994). Mol. Cell. Biol., 14, 1815–1823.

  42. Nicholls CD, McLure KG, Shields MA and Lee PW . (2002). J. Biol. Chem., 277, 12937–12945.

  43. Oliner JD, Pietenpol JA, Thiagalingam S, Gyuris J, Kinzler KW and Vogelstein B . (1993). Nature, 362, 857–860.

  44. Ory K, Legros Y, Auguin C and Soussi T . (1994). EMBO J., 13, 3496–3504.

  45. Peng Y, Chen L, Li C, Lu W, Agrawal S and Chen J . (2001). J. Biol. Chem., 276, 6874–6878.

  46. Prives C and Hall PA . (1999). J. Pathol., 187, 112–126.

  47. Qian H, Wang T, Naumovski L, Lopez CD and Brachmann RK . (2002). Oncogene, 21, 7901–7911.

  48. Rolley N, Butcher S and Milner J . (1995). Oncogene, 11, 763–770.

  49. Ryan KM and Vousden KH . (1998). Mol. Cell. Biol., 18, 3692–3698.

  50. Sambrook J, Maniatis T and Fritsch EF . (1989). Molecular Cloning: a Laboratory Manual, 2 edn. Cold Spring Harbor Laboratory: Cold Spring Harbor, NY.

  51. Szak ST, Mays D and Pietenpol JA . (2001). Mol. Cell. Biol., 21, 3375–3386.

  52. Wang XW, Yeh H, Schaeffer L, Roy R, Moncollin V, Egly JM, Wang Z, Freidberg EC, Evans MK, Taffe BG, Bohr VA, Weeda G, Hoeijmakers JHJ, Forrester K and Harris CC . (1995). Nat. Genet., 10, 188–195.

  53. Willis AC, Pipes T, Zhu J and Chen X . (2003). Oncogene, 22, 5481–5495.

  54. Xiao H, Pearson A, Coulombe B, Truant R, Zhang S, Regier JL, Triezenberg SJ, Reinberg D, Flores O and Ingles CJ . (1994). Mol. Cell. Biol., 14, 7013–7024.

  55. Zhu J, Jiang J, Zhou W and Chen X . (1998). Cancer Res., 58, 5061–5065.

Download references

Acknowledgements

This work is supported in part by NIH Grant 2 RO1 CA076069.

Author information

Correspondence to Xinbin Chen.

Rights and permissions

Reprints and Permissions

About this article

Keywords

  • p53
  • mutant p53
  • cell cycle arrest
  • transcription

Further reading