The pVHL-associated SCF ubiquitin ligase complex: Molecular genetic analysis of elongin B and C, Rbx1 and HIF-1α in renal cell carcinoma

Abstract

The VHL gene product (pVHL) forms a multimeric complex with the elongin B and C, Cul2 and Rbx1 proteins (VCBCR complex), which is homologous to the SCF family of ubiquitin ligase complexes. The VCBCR complex binds HIF-1α and HIF-2α, transcription factors critically involved in cellular responses to hypoxia, and targets them for ubiquitin-mediated proteolysis. Germline mutations in the VHL gene cause susceptibility to haemangioblastomas, renal cell carcinoma (RCC), phaeochromocytoma and other tumours. In addition somatic inactivation of the VHL gene occurs in most sporadic clear cell RCC (CC-RCC). However, the absence of somatic VHL inactivation in 30–40% of CC-RCC implies the involvement of other gatekeeper genes in CC-RCC development. We reasoned that in CC-RCC without VHL inactivation, other pVHL-interacting proteins might be defective. To assess the role of elongin B/C, Rbx1 and HIF-1α in RCC tumorigenesis we (a) mapped the genes to chromosomes 8q(cen) (elongin C), 16p13.3 (elongin B) and 22q11.2 (Rbx1) by FISH, monochromosomal somatic cell hybrid panel screening and in silico GenBank homology searching; (b) determined the genomic organisation of elongin C (by direct sequencing of PAC clones), Rbx1 and elongin B (by GenBank homology searching); and (c) performed mutation analysis of exons comprising the coding regions of elongins B, C and Rbx1 and the oxygen-dependent degradation domain of HIF-1α by SSCP screening and direct sequencing in 35 sporadic clear cell RCC samples without VHL gene inactivation and in 13 individuals with familial non-VHL clear cell RCC. No coding region sequence variations were detected for the elongin B, elongin C or Rbx1 genes. Two amino acid substitutions (Pro582Ser and Ala588Thr) were identified in the oxygen-dependent degradation/pVHL binding domain of HIF-1α, however neither substitution was observed exclusively in tumour samples. Association analysis in panels of CC-RCC and non-neoplastic samples using the RFLPs generated by each variant did not reveal allelic frequency differences between RCC patients and controls (P>0.32 by chi-squared analysis). Nevertheless, the significance of these variations and their potential for modulation of HIF-1α function merits further investigation in both other tumour types and in non-neoplastic disease. Taken together with our previous Cul2 mutation analysis these data suggest that development of sporadic and familial RCC is not commonly contributed to by genetic events altering the destruction domain of HIF-1α, or components of the HIF-α destruction complex other than VHL itself. Although (a) activation of HIF could occur through mutation of another region of HIF-a, and (b) epigenetic silencing of elongin B/C, Cul2 or Rbx1 cannot be excluded, these findings suggest that pVHL may represent the sole mutational target through which the VCBR complex is disrupted in CC-RCC. HIF response is activated in CC-RCC tumorigenesis.

Introduction

The isolation of rare familial cancer syndrome tumour suppressor genes (TSG) has led frequently to the identification of critical gatekeeper genes for sporadic cancers (Fearon, 1997). Prototypic examples are the APC TSG in familial polyposis coli and sporadic colorectal cancers and the VHL TSG in von Hippel–Lindau (VHL) disease and sporadic clear cell renal cell carcinoma. Furthermore, elucidation of the function of the TSG product may identify further candidate gatekeeper genes implicated in the same biochemical pathway. Thus the interaction of the APC, β-catenin and AXIN1 gene products provided the rationale for the subsequent identification of somatic mutations in the β-catenin gene (Morin et al., 1997; Korinek et al., 1997; Sparks et al., 1998) in colorectal cancers without APC gene mutations and of AXIN1 gene mutations in sporadic hepatocellular carcinomas without β-catenin mutations (Satoh et al., 2000). Similarly, both patched and smoothened mutations occur in cutaneous basal cell carcinoma (Gailani et al., 1996; Wolter et al., 1997; Xie et al., 1998).

Renal cell carcinoma (RCC) is the most common adult renal neoplasm and accounts for 2% of all adult human cancers. Most (80%) of RCC are classified as clear cell RCC (CC-RCC) (Thoenes et al., 1986). Investigations of the VHL TSG have provided critical insights into the pathogenesis of CC-RCC. Germline VHL TSG mutations are associated with a high (>70%) lifetime risk of CC-RCC and up to 70% of sporadic CC-RCC have VHL inactivation by loss, mutation or epigenetic silencing (Foster et al., 1994; Gnarra et al., 1994; Herman et al., 1994; Clifford et al., 1998). However, the absence of somatic VHL gene inactivation in a significant minority of CC-RCC and the existence of familial non-VHL CC-RCC kindreds (Teh et al., 1997, Woodward et al., 2000) demonstrates the existence of further CC-RCC genes. In view of the involvement of APC-associated proteins in colorectal cancer (Morin et al., 1997; Korinek et al., 1997; Sparks et al., 1998), genes which encode proteins implicated in pVHL function can be considered as candidate CC-RCC genes.

The VHL gene product is likely to have multiple and tissue-specific functions (Kaelin and Maher, 1998 and references within). The finding that pVHL is required for regulation of the HIF-1 transcriptional control system demonstrated a central role in the cellular response to hypoxia (Maxwell et al., 1999). VHL forms a complex with elongins B and C, Cul2 and the Ring-H2 finger protein Rbx1 (VCBCR complex) which shares sequence and structural similarities to the well-characterised SCF (Skp-1-Cdc53/Cullin-F-box) class of E3 ubiquitin ligase complexes. The VCBCR complex binds the oxygen dependent destruction domain of HIFα subunits through the β-domain of pVHL, with pVHL acting as the recognition component of the E3 ubiquitin ligase complex mediating HIF-α destruction (Cockman et al., 2000; Ohh et al., 2000; Tanimoto et al., 2000; Kamura et al., 2000). VHL TSG inactivation consequently leads to stabilization of HIF-1α and HIF-2α and constitutive activation of a wide range of hypoxia-inducible genes (Maxwell et al., 1999).

Previously we initiated investigations of the role of pVHL-binding proteins in oncogenesis by assessing the role of the Cul2 gene in the pathogenesis of RCC and phaeochromocytoma (Clifford et al., 1999; Duerr et al., 1999). Although Cul2 allele loss was detected in 25% of sporadic CC-RCC, no mutations were identified. Similarly, no somatic pathogenic mutations, were detected in 26 phaeochromocytomas although one sporadic tumour had a hemizygous gene deletion. Nevertheless two Cul2 SNPs were found to be significantly over-represented among phaeochromocytoma patients when compared to a control population. To further investigate the role of VHL binding proteins in renal tumorigenesis we undertook to map, characterise and perform mutation analysis of the elongin B, elongin C and Rbx1 genes. In addition we performed mutation analysis on exons encoding the oxygen-dependent domain of HIF-1α (Huang, 1998) which includes the core region sufficient for interaction with pVHL (Cockman et al., 2000; Ohh et al., 2000; Tanimoto et al., 2000).

Results

Chromosomal localization of pVHL-interacting proteins

FISH and cytogenetic analysis of metaphase spreads from normal lymphoblasts using P1 clone RPCI1 24815 as a probe localized the elongin C gene to the centromeric region of the q-arm of chromosome 8 (data not shown). BLAST homology searching of the NCBI GenBank database (http://www.ncbi.nlm.nih.gov/) using the elongin B (Accession no. NM_007108) and Rbx1 (Ac# AF140598) cDNA sequences revealed that the entire elongin B coding sequence was represented by three non-overlapping 100% homologous regions contained within two cosmid clones (407D8 (Ac# AC005570) and 373C8 (Ac# AC004493)) mapping to chromosome 16 at band p13.3. The entire Rbx1 coding sequence was represented by five non-overlapping 100% homologous regions contained within genomic clone 554C12 (Ac# A1080242) which maps to chromosome 22 at band q11.2. Localization of the elongin B, C and Rbx1 genomic sequences to chromosomes 16, 8 and 22 respectively was confirmed independently by PCR-based screening of a monochromosomal somatic cell hybrid panel (data not shown) obtained from the UK Human Genome Mapping Project Resource Centre (Kelsell et al., 1995). HIF-1α has previously been mapped to 14q21-q24 (Semenza et al., 1996).

Genomic structure of pVHL-interacting proteins

The genomic organization of the elongin C gene was resolved by direct DNA sequencing of the RPCI1 24815 P1 clone using oligonucleotide primers based on the published cDNA sequence of the elongin C gene (Ac# L34587). Novel intronic sequences and intron/exon boundaries were confirmed by PCR amplification of normal blood genomic DNA across each exon using oligonucleotide primer pairs based on the novel intronic sequences followed by direct sequencing. This analysis revealed that the elongin C coding sequence (88…426 of L34587) is contained within three exons of 54, 144 and >212 bp in size (join 37…91, 92…235 and 236…>444 of L34587). Elongin C exon sizes and boundaries are summarized in Figure 1.

Figure 1
figure1

Position and sequences of intron/exon boundaries surrounding the coding region of the human elongin C gene. Conserved splice donor and acceptor sites (AG/GT) are highlighted and the position of the ATG translation start site in exon 1 is shown in bold type. Positions shown are based on GenBank sequence L34587

Genomic structures of the elongin B and Rbx1 genes were determined by BLAST homology searching of the NCBI GenBank database. The elongin B coding sequence (1…357 of the elongin B cDNA (NM_007108)) comprised three exons (join 3…138, 139…244 and 242…>357). These exons showed 100% homology to segments contained within genomic clones 407D8 and 373C8 (join 35163…35298 of AC005570 with 1262…1367 and 4713…>4825 of AC004493). The Rbx1 coding sequence (7…333 of the Rbx1 cDNA (AF140598)) comprised five exons (join 2…84, 85…163, 164…234, 235…320 and 321…>508), showing 100% homology to segments contained within the genomic clone 554C12 (join 22066…22148, 24227…24305, 34719…34789, 38471…38556 and 43148…>43334 of AL080242). The genomic structure of HIF-1α has previously been described (Iyer et al., 1998). The sequence and boundaries of all exons analysed were confirmed by PCR amplification of normal genomic DNA using intronic primers spanning each exon, followed by direct DNA sequencing (see Table 1; data not shown). All intron/exon boundaries followed the usual GT/AG rule (Shapiro and Senapathy, 1987).

Table 1 Oligonucleotide primers and PCR conditions used for amplification of elongin B, elongin C, Rbx1 and HIF-1 exons

Analysis of DNA sequence variations in pVHL-interacting proteins

Coding regions of the elongin B, elongin C and Rbx1 genes and HIF-1α sequences spanning the oxygen-dependent degradation/pVHL interaction domain (residues 417–698, exons 10–12; Pugh et al., 1997; Huang et al., 1998; Iyer et al., 1998; Cockman et al., 2000; Ohh et al., 2000; Tanimoto et al., 2000), were screened for DNA sequence variations in our panel of familial and sporadic (including paired constitutional DNA where available) RCC samples by PCR amplification and SSCP methods using the oligonucleotide primers described in Table 1. No evidence of sequence variation in the elongin C (exons 1–3) or Rbx1 (exons 1–5) coding regions was found in any sample.

A complex conformer banding pattern was observed for exon 12 of HIF-1α on SSCP analysis. PCR amplification and direct DNA sequencing of samples giving rise to each conformer pattern revealed three independent single-base substitutions: Firstly, a silent A/T substitution at nt1828. Secondly, a C/T substitution at nt1772 giving rise to a PRO/SER variation at codon 582 and causing a novel Hph1 restriction fragment length polymorphism (RFLP). These two changes were detected in both constitutional and tumour DNA samples, were not tumour-specific in any of the sporadic RCC samples where matched constitutional DNA was available and were therefore considered to be polymorphic changes. A third single-base change (G/A substitution at nt1790) giving rise to a ALA/THR variation at codon 588 and causing a novel Acil RFLP was detected in a single constitutional DNA sample from an individual with inherited CC-RCC. Each of the substitutions causing novel RFLPs were confirmed by digestion with the appropriate restriction enzyme (data not shown). Sequence variations are summarised in Table 2, and example SSCP and sequencing analyses from the variant exons are shown in Figure 2.

Table 2 Summary of HIF-1α and elongin B sequence variations
Figure 2
figure2

Identification of sequence variations. (a) Exon 12 of the HIF-1 α gene – examples of each different conformer banding pattern detected are shown (A–G) together with electropherograms of confirmatory direct DNA sequence analysis showing the corresponding sequence variations. (b) Exon 3 of the elongin B gene – example electropherograms of sequence variations detected by direct DNA sequence analysis are shown. All sequence variations detected are summarized in Table 2

To assess whether the ALA588THR variation in HIF-1α was either disease-associated or disease-specific, two further panels of constitutional DNA samples from renal patients with non-neoplastic disease and unaffected relatives (n = 100) and from individuals receiving genetic screening for non-neoplastic disorders (n = 44) were screened using the Acil RFLP. In addition, the panels were assessed for the Hph1 RFLP at nt1772 to facilitate association mapping. The ALA588THR variation was detected in 4/144 of the individuals in these panels, indicating that this change represents a rare polymorphism not specific to individuals with RCC. Furthermore, presence or absence of a given allelotype at either RFLP was not specifically associated with CC-RCC development (P>0.32 by chi-squared analysis). Allelotype frequencies for all HIF-1α sequence variations are summarized in Table 2.

Direct DNA sequencing of elongin B exon 3 PCR products identified a further sequence variation in addition to those detected by SSCP analysis. This represented a single base insertion polymorphism (insG) +2 bases 3′ of the termination codon (see Figure 2). Forty-six per cent (6/13) of the samples analysed were polymorphic for this variation, which was not specific to tumour samples (see Table 2). Furthermore, multiple ESTs representing each variant were identified by BLAST homology searching of the NCBI GenBank EST database. Taken together these findings are indicative of a polymorphic variation. No sequence variations were detected in the remainder of either the elongin B coding reqion (exons, 1, 2) or the remainder of the oxygen-dependent degradation domain of HIF-1α (exons 10, 11).

Discussion

We have mapped the genes for three pVHL-associated proteins, elongin C, elongin B and Rbx1, to the pericentromic region of chromosome 8, 16p13.3 and 22q11.2 respectively and determined their genomic organisation. In addition to any role in hereditary non-VHL and sporadic RCC development these genes provide candidates genes for the development of tumours displaying genetic alterations at these loci. For instance, 8q loss of heterozygosity (LOH) has been reported in bladder and prostate carcinoma (Knowles et al., 1993; Perinchery et al., 1999), 16p13.3 LOH in anaplastic thyroid carcinoma and papillary carcinoma of the breast (Kadota et al., 2000; Lininger et al., 1998) and LOH at 22q11.2 in a number of tumour types including head and neck carcinoma and rhabdoid tumours (Poli-Frederico et al., 2000; Schofield et al., 1996). This report of the elongin C, elongin B and Rbx1 genomic organizations will facilitate studies to assess their role in the development of these tumour types.

We did not identify somatic mutations in elongins B and C or Rbx1 genes in 35 CC-RCC without VHL gene mutations. From these results, it seems unlikely that these genes are frequently mutated in CC-RCC with a VHL-independent mechanism of tumorigenesis. Some tumour suppressor genes may be inactivated frequently by epigenetic silencing but rarely by mutations (Dammann et al., 2000) so we cannot exclude the possibility that Elongin B and C and Rbx1 genes are methylated frequently RCC tumorigenesis. Nevertheless, the observation that, to date, cancer-associated mutations only occur in VHL would be compatible with a model where each protein has specialized functions within the VCBCR complex, but some components are involved in similar complexes controlling other pathways. In this model, Cul2 and Rbx1 would interact to recruit and activate ubiquity by E2 ubiquitin-conjugating enzymes. Elongins B and C would link the recognition component to the Cul2/Rbx1 module (Kamura et al., 2000) while the pVHL itself would act as a recognition component by binding specific target proteins. In a manner analagous to the F-box protein in SCF complexes, pVHL would determine substrate specificity while the rest of the VCBCR complex proteins constitute a generic unit which utilizes other recognition components to target other protein substrates. In support of this concept, more than 20 Elongin BC-binding proteins have now been identified and one such protein, SOCS-1 (suppressor of cytokine signalling) binds the haematopoietic-specific guanine nucleotide exchange factor Vav for ubiquitin mediated proteolysis (De Sepulveda et al., 2000). Such an arrangement would predict that mutations would occur in the specific substrate recognition components and not in the multifunctional CBCR components which might be implicated in a wide variety of other cellular processes. Based on the pVHL model, F-box like proteins that target oncogenic substrates for degradation may provide candidate tumour suppressor genes for further investigation.

The ability to sense and adapt to variations in oxygen concentration is fundamental to normal development and cellular physiology. The HIF-1 transcription factor activates transcription of genes whose products increase O2 delivery (including erythropoietin and angiogenic growth factors), metabolic adaptation (glucose transporters, glycolytic enxymes) or cell survival (IGF2) and plays a critical role in the normal cellular response to hypoxia (Semenza, 2000). HIF activation is implicated in many physiological and pathological processes. Gene targeting experiments have established that HIF-1 is required for embryonic development, and that HIF status influences susceptibility to hypoxia-induced pulmonary hypertension. HIF activation is particularly relevant to cancer biology, with experimental studies indicating major effects on gene expression and angiogenesis, and evidence of activation in the majority of human cancers studied. HIF activation has also been described recently in cardiac ischaemia. Although other mechanisms contribute, the dominant mode of regulation of HIF is through oxygen-dependent degradation of the α subunits, a process which requires pVHL. The oxygen dependent degradation domain (ODDD) of HIF-1α has been mapped to amino acids 401–603, and includes more than one sub-sequence which confers oxygen-dependent instability (Huang et al., 1998). The region includes a sequence centred around 549–582 which represents a transferable ODDD (Pugh et al., 1997) and is sufficient for pVHL binding (Cockman et al., 2000; Ohh et al., 2000; Tanimoto et al., 2000). We hypothesized that RCC without VHL gene inactivation might result from somatic missense mutations in the ODDD/VBD which would prevent binding to pVHL and result in increased HIF-1α expression. Although we did not identify somatic mutations, we did detect two novel missense variants at codons 582 and 588. Both these variants were detected in the germline of patients with familial or sporadic RCC but were also present in control patients with non-neoplastic disease. We cannot exclude the possibility that either variant might modify tumour susceptibility or progression, and the effects of the naturally occurring PRO582SER and ALA588THR variants on HIF-1 expression in hypoxic and normoxic conditions have not been investigated. Furthermore, these variants represent candidate genetic modifiers for the many human diseases associated with disturbed O2 homeostatis such as cardiovascular and respiratory disease and the angiogenic responses in ischaemia and tumorigenesis and merit further investigation in this respect (Semenza, 2000).

Materials and methods

Patients and samples

Thirty-five sporadic primary RCC samples were analysed (comprising paired tumour and normal blood DNA samples from 24 patients and tumour-only DNA samples from a further 11 patients). Histopathological classification was available for 20 tumours all of which were CC-RCC (Thoenes et al., 1986). Additionally, constitutional DNA was analysed from 13 affected individuals with familial CC-RCC. All samples have previously been assessed for VHL gene mutation and methylation status and screened for Cul2 mutation and have no evidence of inactivation or mutation of either gene (Foster et al., 1994; Clifford et al., 1998, 1999; Woodward et al., 2000). Constitutional DNA samples from renal patients with non-neoplastic disease (n = 100) and from individuals receiving genetic screening for non-neoplastic disorders (n = 44) were also employed.

P1 (PAC) artificial chromosome isolation, fluorescence in situ hybridization (FISH) analysis and direct DNA sequencing of PAC clones

PAC maintenance and DNA isolation was as described previously (Clifford et al., 1999). A PAC clone containing elongin C sequences (clone 24815) was isolated from the RPCI1 library (Ioannou and de Jong, 1996; supplied by the UK HGMP Resource Centre) by PCR-based screening using the primers AGGTTCGCTACACTAACAGC (forward) and TCGCAGCCATCAGCAGTTC (reverse) based on the elongin C cDNA sequence (GenBank accession no. L34587). Direct DNA sequencing of the PAC clone and FISH-based analysis of elongin C chromosomal localization using the clone 24815 P1 as a probe were performed as described previously (Clifford et al., 1999).

PCR amplification of pVHL-interacting protein exons

Based on the sequences defined, intronic PCR primer pairs lying >30 bp external to each intron/exon boundary were designed to amplify across each exon using the Oligo4 primer design package (see Table 1). Using these primers, exons were PCR amplified using standard conditions. Briefly, reactions comprised: GeneAmp 10 × PCR buffer (500 mM potassium chloride, 100 mM Tris-HCl (pH 8.3); Perkin Elmer), 3 μl; dNTP stock containing 2.5 mM dA,C,T,GTP (Pharmacia), 2.4 μl; 50 mM magnesium chloride (to required final concentration); 20 μM forward primer stock, 0.8 μl; 20 μM reverse primer stock, 0.8 μl; 5 U/μl Amplitaq (Perkin Elmer), 0.08 μl; 50 ng/μl genomic DNA template, 2 μl; sterile distilled water to 30 μl (final volume). Reactions were overlayed with mineral oil (30 μl) before thermal cycling (95°C for 5 min followed by 40 cycles of 95°C, 30 s; x°C, 30 s; 72°C, 30 s and a final extension at 72°C for 5 min). A control reaction substituting sterile distilled water for the genomic template was included in each batch of reactions to control against contamination of the reactions by exogenous DNA sources. Primers, PCR product size, annealing temperatures (x) and final MgCl2 concentrations for the amplification of each exon are summarized in Table 1.

Direct DNA sequencing of PCR products

PCR products were sequenced using the d-rhodamine sequencing kit protocol and the ABI 377 DNA sequencer (both Applied Biosystems). Individual exons were first PCR amplified as described above. PCR products were purified by agarose gel electrophoresis using the QiaQuick gel extraction kit (Qiagen) according to manufacturer's instructions and eluted in 15 μl sterile distilled water. Five μl of elutant was seeded into a 10 μl (final volume) d-rhodamine sequencing reaction, which was set up and cycled according to manufacturer's instructions, before separation and analysis on the ABI 377 DNA sequencer.

Detection of DNA sequence variations by single strand conformation polymorphism (SSCP) analysis

SSCP methods (Orita et al., 1989) were used to detect changes in the exonic DNA sequences, and were performed as previously described (Crossey et al., 1994). Briefly, for each exon under analysis, standard (see above) 30 μl PCR reactions were performed for all samples and water controls, and 10 μl of each completed reaction added to an equal volume of formamide loading buffer (98% formamide, 10 mM EDTA, 0.1% xylene cyanol, 0.1% bromophenol blue), before denaturing by heating at 95°C for 5 min and snap chilling on ice. Samples were then loaded onto a 20 × 20 cm vertical 8% polyacrylamide gel containing 5% glycerol and 0.5 × TBE buffer, and electrophoresed in a 10°C cold cabinet overnight at 2 Watts in 0.5 × TBE buffer. Gels were then removed from the apparatus and DNA bands visualized by silver staining as follows: (i) fixation in 10% ethanol for 5 min; (ii) oxidation in 1% nitric acid for 10 min; (iii) water rinse for 2 min; (iv) staining in 0.006 M silver nitrate for 15 min; (v) water rinse for 2 min; (vi) DNA band development in freshly prepared 0.28 M sodium carbonate/0.019% formalin until desired image intensity was achieved; (vii) fixation in 10% acetic acid for at least 5 min. Gels were then dried under heat and vacuum onto Whatman 3MM paper for viewing and storage.

Allelotyping using HIF-1α restriction fragment length polymorphisms (RFLPs)

All samples were allelotyped for the RFLPs identified in exon 12 of HIF-1α. Briefly, samples and water controls were PCR amplified as described. Following amplification, PCR products were restriction digested by addition of 2 μl restriction enzyme (Hph1 or Aci1, 10 U/μl), 4 μl 10 × appropriate reaction buffer (all New England Biolabs), 4 μl water and incubation at 37°C for 24 h. Samples were then resolved by agarose gel elecrophoresis and visualized by staining with ethidium bromide using standard techniques.

Monochromosomal somatic cell hybrid panel screening

A monochromosomal somatic cell hybrid panel was obtained from the UK Human Genome Mapping Project Resource Centre (Kelsell et al., 1995). Panel DNAs and appropriate controls were screened by PCR amplification as described elsewhere using primers to Rbx1 exon 2, elongin C exon 3 and elongin B exon 1 (see Table 1). PCR products were resolved by agarose gel electrophoresis and visualized by staining with ethidium bromide using standard techniques.

References

  1. Clifford SC, Prowse AH, Affara NA, Buys CH, Maher ER . 1998 Genes Chrom. Cancer 22: 200–209

  2. Clifford SC, Walsh S, Hewson K, Green EK, Brinke A, Green PM, Gianelli F, Eng C, Maher ER . 1999 Genes Chrom. Cancer 26: 20–28

  3. Cockman ME, Masson N, Mole DR, Jaakkola P, Chang GW, Clifford SC, Maher ER, Pugh CW, Ratcliffe PJ, Maxwell PH . 2000 J. Biol. Chem. 275: 25733–25741

  4. Crossey PA, Richards FM, Foster K, Green JS, Prowse A, Latif F, Lerman MI, Zbar B, Affara NA, Ferguson-Smith MA et al . 1994 Hum. Mol. Genet. 3: 1303–1308

  5. Dammann R, Li C, Yoon JH, Chin PL, Bates S, Pfeifer GP . 2000 Nat. Genet. 25: 315–319

  6. De Sepulveda P, Ilangumaran S, Rottapel R . 2000 J. Biol. Chem. 275: 14005–14008

  7. Duerr EM, Gimm O, Neuberg DS, Kum JB, Clifford SC, Toledo SP, Maher ER, Dahia PL, Eng C . 1999 J. Clin. Endocrinol. Metab. 84: 3207–3211

  8. Fearon ER . 1997 Science 278: 1043–1050

  9. Foster K, Crossey PA, Cairns P, Hetherington JW, Richards FM, Jones MH, Bentley E, Affara NA, Ferguson-Smith MA, Maher ER . 1994 Br. J. Cancer 69: 230–234

  10. Gailani MR, Stahlebackdahl M, Leffell DJ, Glynn M, Zaphiropoulos PG, Pressman C, Unden AB, Dean M, Brash DE, Bale AE, Toftgard R . 1996 Nat. Genet. 14: 78–81

  11. Gnarra JR, Tory K, Weng Y, Schmidt L, Wei MH, Li H, Latif F, Liu S, Chen F, Duh FM et al . 1994 Nat. Genet. 7: 85–90

  12. Herman JG, Latif F, Weng Y, Lerman MI, Zbar B, Liu S, Samid D, Duan DS, Gnarra JR, Linehan WM et al . 1994 Proc. Natl. Acad. Sci. USA 91: 9700–9704

  13. Huang LE, Gu J, Schau M, Bunn HF . 1998 Proc. Natl. Acad. Sci. USA 95: 7987–7992

  14. Ioannou PA, de Jong PJ . 1996 Construction of bacterial artificial chromosome libraries using the modified P1 (PAC) system In Dracopoli et al. (ed.) Current Protocols in Human Genetics Unit 5.15 New York: John Wiley and Sons

    Google Scholar 

  15. Iyer NV, Leung SW, Semenza GL . 1998 Genomics 52: 159–165

  16. Kadota M, Tamaki Y, Sakita I, Komoike Y, Miyazaki M, Ooka M, Masuda N, Fujiwara Y, Ohnishi T, Tomita N, Sekimoto M, Ohue M, Ikeda T, Kobayashi T, Horii A, Monden M . 2000 Onco. Rep. 7: 529–533

  17. Kaelin Jr WG, Maher ER . 1998 Trends Genet. 14: 423–426

  18. Kamura T, Sato S, Iwai K, Czyzyk-Krzeska M, Conaway RC, Conaway JW . 2000 Proc. Natl. Acad. Sci. USA 97: 10430–10435

  19. Kelsell DP, Rooke L, Warne D, Bouzyk M, Cullin L, Cox S, West L, Povey S, Spurr NK . 1995 Ann. Hum. Genet. 59: 233–241

  20. Knowles MA, Shaw ME, Proctor AJ . 1993 Oncogene 8: 1357–1364

  21. Korinek V, Barker N, Morin PJ, van Wichen D, de Weger R, Kinzler KW, Vogelstein B, Clevers H . 1997 Science 275: 1784–1787

  22. Lininger RA, Park WS, Man YG, Pham T, MacGrogan G, Zhuang Z, Tavassoli FA . 1998 Hum. Pathol. 29: 1113–1118

  23. Maxwell PH, Wiesener MS, Chang GW, Clifford SC, Vaux EC, Cockman ME, Wykoff CC, Pugh CW, Maher ER, Ratcliffe PJ . 1999 Nature 399: 271–275

  24. Morin PJ, Sparks AB, Korinek V, Barker N, Clevers H, Vogelstein B, Kinzler KW . 1997 Science 275: 1787–1790

  25. Ohh M, Park CW, Ivan M, Hoffman MA, Kim TY, Huang LE, Pavletich N, Chau V, Kaelin WG . 2000 Nat. Cell. Biol. 2: 423–427

  26. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T . 1989 Proc. Natl. Acad. Sci. USA 86: 2766–2770

  27. Perinchery G, Bukurov N, Nakajima K, Chang J, Hooda M, Oh BR, Dahiya R . 1999 Int. J. Oncol. 14: 495–500

  28. Poli-Frederico RC, Bergamo NA, Reis PP, Kowalski LP, Zielenska M, Squire JA, Rogatto SR . 2000 Head Neck 22: 585–590

  29. Pugh CW, O'Rourke JF, Nagao M, Gleadle JM, Ratcliffe PJ . 1997 J. Biol. Chem. 272: 11205–11214

  30. Satoh S, Daigo Y, Furukawa Y, Kato T, Miwa N, Nishiwaki T, Kawasoe T, Ishiguro H, Fujita M, Tokino T, Sasaki Y, Imaoka S, Murata M, Shimano T, Yamaoka Y, Nakamura Y . 2000 Nat. Genet. 24: 245–250

  31. Schofield DE, Beckwith JB, Sklar J . 1996 Genes Chrom. Cancer 15: 10–17

  32. Semenza GL, Rue EA, Iyer NV, Pang MG, Kearns WG . 1996 Genomics 34: 437–439

  33. Semenza GL . 2000 Genes Dev. 14: 1983–1991

  34. Shapiro MB, Senapathy P . 1987 Nuc. Acids Res. 15: 7155–7175

  35. Sparks AB, Morin PJ, Vogelstein B, Kinzler KW . 1998 Cancer Res. 58: 1130–1134

  36. Tanimoto K, Makino Y, Pereira T, Poellinger L . 2000 EMBO J. 19: 4298–4309

  37. The BT, Giraud S, Sari NF, Hii SI, Bergerat JP, Larsson C, Limacher JM, Nicol D . 1997 Lancet 349: 848–849

  38. Thoenes W, Storkel S, Rumpelt HJ . 1986 Path. Res. Prac. 181: 125–143

  39. Wolter M, Reifenberger J, Sommer C, Ruzicka T, Reifenberger G . 1997 Cancer Res. 57: 2581–2585

  40. Woodward ER, Clifford SC, Astuti D, Affara NA, Maher ER . 2000 J. Med. Genet. 37: 348–353

  41. Xie JW, Murone M, Luoh SM, Ryan A, Gu QM, Zhang CH, Bonifas JM, Lam CW, Hynes M, Goddard A, Rosenthal A, Epstein EH, de Sauvage FJ . 1998 Nature 391: 90–92

Download references

Acknowledgements

We thank the Medical Research Council, Cancer Research Campaign (CRC) and the VHL Alliance for financial support. We are grateful to Dr PC Harris, Mayo Clinic for providing DNA samples.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Eamonn R Maher.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Clifford, S., Astuti, D., Hooper, L. et al. The pVHL-associated SCF ubiquitin ligase complex: Molecular genetic analysis of elongin B and C, Rbx1 and HIF-1α in renal cell carcinoma. Oncogene 20, 5067–5074 (2001). https://doi.org/10.1038/sj.onc.1204602

Download citation

Keywords

  • renal cell carcinoma
  • elongin B
  • elongin C
  • Rbx1
  • HIF-1α
  • VHL
  • genomic organization
  • chromosomal localization
  • mutation

Further reading

Search