Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

Analysis of the expression of cell cycle regulators in Ewing cell lines: EWS-FLI-1 modulates p57KIP2 and c-Myc expression

Abstract

Ewing tumour is characterized by specific chromosome translocations which fuse EWS to a subset of genes encoding ETS transcription factors, most frequently FLI-1. We report the analysis of the expression of various cell cycle regulators both in Ewing tumour derived cell lines and in different cellular models with either inducible or constitutive EWS-FLI-1 cDNA expression. In Ewing cell lines, cyclin D1, CDK4, Rb, p27KIP1 and c-Myc were consistently highly expressed whereas p57KIP2, p15INK4B and p14ARF demonstrated undetectable or low expression levels. The amount of p16INK4A, p21CIP1, p18INKAC and CDK6 was variable from one cell line to the other. The inducible expression of EWS-FLI-1 led to a strong upregulation of c-Myc and a considerable downregulation of p57KIP2. Other proteins did not show evident modification. High c-Myc and very low p57KIP2 expression levels were also observed in neuroblastoma NGP cells constitutively expressing EWS-FLI-1 as compared to parental cells. Analysis of the p57KIP2 promoter indicated that EWS-FLI-1 downregulates, possibly through an indirect mechanism, the transcription of this gene. Finally, we show that ectopic expression of p57KIP2 in Ewing cells blocks proliferation through a complete G1 arrest. These results suggest that the modulation of p57KIP2 expression by EWS-FLI-1 is a fundamental step in Ewing tumorigenesis.

Introduction

The Ewing family of tumours includes tumours with various tissue localization and cell morphology characterized by the presence of specific fusions between EWS and members of the ETS family of transcription factors. The most frequent fusion gene links EWS and FLI-1 sequences and encodes a chimeric EWS-FLI-1 protein which includes the N-terminal transactivation domain of EWS and the C-terminal DNA binding domain of FLI-1 (Delattre et al., 1992). EWS-FLI-1 can bind DNA with the same affinity as FLI-1, however it activates transcription of reporter genes controlled by ETS sequences much more efficiently than FLI-1. EWS-FLI-1 has the ability to transform NIH3T3 cells and this activity requires both the transactivation domain of EWS and the ETS-DNA binding domain of FLI-1 (May et al., 1993; Bailly et al., 1994; Mao et al., 1994). These observations have suggested that EWS-FLI-1 transforms cells through the aberrant activation of specific target genes. Indeed, genes upregulated by EWS-FLI-1 have been identified through differential expression screening between EWS-FLI-1-transformed and normal NIH3T3 cells (Thompson et al., 1996; May et al., 1997; Arvand et al., 1998). However, a direct role of EWS-FLI-1 on transcriptional activation of these genes has not been unambiguously demonstrated. Recent data suggest that the oncogenic role of EWS-FLI-1 is not restricted to activation of target genes. Indeed, its transforming activity is not strictly dependent upon the DNA binding domain, suggesting that the oncogenic activity of the fusion protein could also be mediated by protein-protein interactions (Jaishankar et al., 1999). Moreover, EWS-FLI-1 can act as a transcriptional repressor as shown by its ability to downregulate, through a direct repressor effect, the promoter of the Transforming Growth Factor type II receptor (TGFBR2) (Hahm et al., 1999). Other EWS-ETS fusion proteins observed in Ewing tumour (ET) also repress this promoter suggesting that the loss of the TGFβ signalling pathway is an important step for the Ewing sarcoma tumorigenesis (Im et al., 2000).

Although most human cancers harbour abnormalities of the G1/S transition, a link between EWS-FLI-1 and cell cycle regulators has not yet been described. To get additional insights into the mechanisms by which EWS-FLI-1 induces cell proliferation and oncogenesis, we report the analysis of the expression of cell cycle regulators in 13 Ewing cell lines and in two different cellular systems including a heavy metal inducible EWS-FLI-1 cDNA in Hela cells and neuroblastoma NGP cells constitutively expressing EWS-FLI-1. These results confirm and extend previous data concerning c-Myc (Bailly et al., 1994) and further show that EWS-FLI-1 downregulates the expression of p57KIP2. Therefore, EWS-FLI-1 controls two key regulators of cell growth and proliferation.

Results

Analysis of cell cycle regulators expression in Ewing cell lines

A total of 13 Ewing cell lines expressing different types of Ewing specific fusion proteins, being EWS-FLI-1 in 12 cases (five with a type 1, four a type 2 and three other types of EWS-FLI-1 fusions) and EWS-ERG in one case (Table 1), were investigated. In addition to the presence of the specific EWS-ETS lesion, most cell lines had p53 and/or p16INK4A genomic alterations (Table 1). Indeed, 11 out of 13 cell lines demonstrated p53 mutations and four had homozygous deletion of the p16INK4A exon 2 locus as determined by PCR amplification of this exon (data not shown). Protein extracts were Western blotted and probed with antibodies specific for cell cycle regulators (Table 1 and Figure 1). All cases without p16INK4A deletion but one (EW7) expressed the p16INK4A protein indicating that methylation of the p16INK4A promoter, a silencing mechanism frequently observed in other tumour types, is probably not a major cause of inactivation of the p16INK4A gene in Ewing tumour. p14ARF, which is mainly encoded by the exon 2 of p16INK4A and p15INK4B were only expressed at low level in two cases each. MDM2 was expressed at various levels in all cell lines without an evident link with the presence of a p53 mutation and with the level of p14ARF expression. In contrast, p21CIP1 expression was correlated with p53 status since it was expressed in the two cell lines without p53 mutation and in only two of the 11 p53-mutated cell lines. This strong but not absolute correlation is in agreement with previous reports suggesting that p21CIP1 can be activated by p53-independent pathways (for review see Gartel and Tyner, 1999). Interestingly, the expression of p21CIP1 and p16INK4A appeared inversely correlated since p21CIP1 was not detected in the seven out of eight cell lines which express p16INK4A whereas p16INK4A was not expressed in three out of four p21CIP1 expressing cell lines. Only LAP35 expressed both p21CIP1 and p16INK4A. Among other cyclin dependent kinase (CDK) inhibitors, p18INK4C and p27KIP1 were detected in most cell lines. In contrast, p57KIP2 was weakly expressed in only three cases (Figure 1a,b).

Table 1 Analysis of cell cycle regulators in Ewing cell lines
Figure 1
figure1

Western blot analysis of the expression of cell cycle regulators in Ewing cell lines. (a) A subset of the results indicated in Table 1 is shown. The EWS-FLI-1 fusion proteins are shown on the top. The variety of the size of the proteins is fully consistent with the type of fusion transcripts indicated in Table 1. The EW3 cell line expresses an EWS-ERG fusion which cannot be detected by the 7.3 antibody (Melot et al., 1997). Detection of β actin (bottom) is used as an internal control for the amount of proteins. (b) p57KIP2 is weakly expressed in ORS, EW7 and EW17 Ewing cell lines as compared to the neuroblastoma NGP cell line

Finally, c-Myc, E2F1, CDK4, cyclin D1 and both hypo and hyperphosphorylated forms of Rb were visualized in all cases.

Analysis of cell cycle regulators expression in cells with an inducible EWS-FLI-1 gene

The EWS-FLI-1 cDNA cloned under the control of the sheep metallothionein inducible promoter, was transfected in Hela cells. One clone (pMTEF) was selected based on an undetectable expression of the fusion protein in non-induced conditions and strong induction upon cadmium treatment (Figure 2a). Analysis of the kinetics of the induction indicated that the EWS-FLI-1 protein was detectable 4 h after addition of 20 μM cadmium in the medium and reached at 8–12 h an expression level similar to that of the endogeneous fusion protein in Ewing cell lines (Figure 2b). An induction of 24 h was used to study the expression of the various aforementioned cell cycle regulators. In order to differentiate the variation of expression linked to cadmium treatment and to EWS-FLI-1 induction, Western blot experiments were performed with protein extracts from induced or non-induced pMTEF cells and from Hela cells upon similar conditions. Similarly to β actin, the expression levels of Rb, E2F, CDK4, CDK6, MDM2, p21CIP1, p53, p16INK4A, p14ARF, p15INK4B, p18INK4C and p27KIP1 were not modified by EWS-FLI-1 induction (Figure 2a, and data not shown). In contrast, two proteins demonstrated dramatic modification: c-Myc was strongly upregulated whereas p57KIP2 expression was completely downregulated upon EWS-FLI-1 induction. Finally, cyclin D1 was strongly upregulated by cadmium alone, therefore, the effect of EWS-FLI-1 could not be precisely investigated (Figure 2a).

Figure 2
figure2

Analysis of the variation of the expression of cell cycle regulators depending on EWS-FLI-1 expression. (a) Extracts from standard Hela cells (HeLa) and from Hela cells stably transformed with EWS-FLI-1 controlled by the heavy metal inducible sheep metallothionein promoter (pMTEF) were analysed with or without the presence of 20 μM CdCl2. On the top and the bottom of the figure, the inducible expression of EWS-FLI-1 and the β actin internal control are shown, respectively. (b) Kinetics of the induction of EWS-FLI-1 in the pMTEF cell line. The level of expression of the fusion protein is similar to that of the endogeneous protein in the EW24 cell line. NT, not treated pMTEF cells. (c) Analysis of the p57KIP2 and c-Myc expression in NGP neuroblastoma parental cells, the NGP-NEO control cells and NGP-EF1 and -EF2 EWS-FLI-1 expressing cells. The expression of EWS-FLI-1 in the two latter cell lines was barely detectable by Western blot but clearly demonstrated by RT–PCR analysis (see top)

Expression of p57KIP2 and c-Myc in stable EWS-FLI-1 expressing neuroblastoma cells

To confirm the link between the expression of EWS-FLI-1 and the levels of c-Myc and p57KIP2 proteins in another system, NGP cells were retrovirally infected with an EWS-FLI-1 fusion coding vector and selected in the presence of G418. Two clones expressing EWS-FLI-1 were used to analyse the expression of p57KIP2 and c-Myc. In full agreement with the results obtained in Hela cells, the level of expression of p57KIP2 was considerably decreased and the c-Myc expression highly induced in EWS-FLI-1 expressing neuroblastoma cells as compared to parental NGP cells and NGP-NEO cells transfected with the control vector (Figure 2c).

EWS-FLI-1 regulates the level of c-Myc and p57KIP2 transcripts

Competitive RT–PCR experiments were performed by co-amplification of c-Myc or p57KIP2 mRNAs together with the endogeneous TBP transcript as an internal control. They showed that c-Myc mRNA was induced whereas that of p57KIP2 was reduced in the presence of EWS-FLI-1 both in the inducible Hela and in the constitutive NGP systems (Figure 3). These results strongly suggested that modifications of c-Myc and p57KIP2 occur through transcriptional regulation. Indeed, a previous study has indicated that c-Myc transcription is strongly upregulated by EWS-FLI-1, possibly through an indirect mechanism since specific binding of EWS-FLI-1 to the c-Myc promoter could not be demonstrated (Bailly et al., 1994). We therefore performed similar analysis of the transcription regulation of the p57KIP2 promoter.

Figure 3
figure3

EWS-FLI-1 upregulates c-Myc and downregulates p57KIP2 mRNA levels. The mRNA expressions of c-Myc and p57KIP2 were analysed by competitive RT–PCR using co-amplification of c-Myc or p57KIP2 with TBP as an internal control

EWS-FLI-1 downregulates the p57KIP2 promoter

To study the possible role of EWS-FLI-1 on the p57KIP2 promoter, the previously described c14F5 cosmid which contains the complete p57KIP2 gene was used (Reid et al., 1996). Four different luciferase vectors were constructed extending −2191, −1550, −595 and −165 (Figure 4a,b) upstream of the transcription initiation start site (Tokino et al., 1996). These reporters were co-transfected in Hela cells with EWS-FLI-1 or FLI-1 expression vectors. For all four constructs a moderate (approximately twofold) but reproducible decrease of the luciferase activity was observed with EWS-FLI-1 whereas such a reduction was not detected for wild type FLI-1 (Figure 4c). Similar levels of repression were obtained when CHO or SKNAS cells were used (data not shown). However, whatever the cells used or the amount of transfected EWS-FLI-1 the repression of transcription induced by EWS-FLI-1 never reached the basal level of a promoterless construct. These results strongly suggested that EWS-FLI-1 but not FLI-1 had a moderate repressive effect on the transcription of the p57KIP2 promoter. The p57KIP2 promoter contains a number of putative ETS binding sites (EBS). In particular, one such site (CGTTCCAC) is present in the −165KIP2 construct (Figure 4b). However, bandshift experiments indicated that EWS-FLI-1 did not bind to this site supporting the hypothesis that EWS-FLI-1 does not repress p57KIP2 transcription through a direct interaction with this site.

Figure 4
figure4

Regulation of the p57KIP2 promoter by EWS-FLI-1. (a) Schematic representation of the different p57KIP2 promoter constructs. The initiation start site is indicated by an arrow. (b) Sequence of the 165 bp region upstream of the p57KIP2 transcription initiation site. The putative ETS site is indicated in bold. The main putative transcription factor binding sites are underlined. (c) EWS-FLI-1 downregulates the p57KIP2 promoter. Hela cells were co-transfected with 1 μg of the luciferase reporters and 2 μg of the expression vectors; luciferase activity was measured 48 h post-transfection. Results are an average of five duplicate experiments. The inhibitory effect of EWS-FLI-1 on luciferase gene expression was observed for 100 ng of EWS-FLI-1 expression vector and was maximal for 2 μg. (d) Western blot analysis of the expression of EWS-FLI-1 and FLI-1 in transfected Hela cells. At the time of the luciferase assay, whole cell extracts were prepared and used to control the expression of the EWS-FLI-1 and FLI-1 proteins with the anti-HA antibody

Ectopic expression of p57KIP2 blocks proliferation of Ewing cells

The Ewing EW24 cell line was transfected with either an expression vector encoding a GFP-p57KIP2 fusion protein (Reynaud et al., 1999) or with a GFP control vector (pEGFP-C1, Clontech). In the days following transfection, fluorescent cells were counted. Cells expressing GFP demonstrated a clear proliferation with progressive decrease of the fluorescence of individual cells linked to dilution of the GFP vector in dividing cells. In contrast, when the GFP-p57KIP2 expression vector was used, the number of fluorescent cells did not increase and the intensity of fluorescence of individual cells remained stable over time (Figure 5a). This experiment strongly suggested that GFP-p57KIP2 can block the proliferation of Ewing cells. To confirm the effect of p57KIP2 on the cell cycle, EW24 Ewing cells were cotransfected with a vector encoding puromycin resistance (pPUR) and either empty or p57KIP2 encoding pcDNA. After selection of puromycin resistant cells and labelling with BrdU, the cell cycle was studied by flow cytometry. As compared to pPUR+pcDNA transfected cells, cells expressing p57KIP2 exhibited a strong decrease in S phase and an increase in G1 (Figure 5b). Similar results were obtained when another Ewing cell line (ORS) was used for these experiments (data not shown). Altogether, these results showed that p57KIP2 expression is able to block the proliferation of Ewing cells through inhibition of entry into S phase.

Figure 5
figure5

Ectopic expression of p57KIP2 in Ewing cells blocks proliferation through G1 arrest. (a) GFP-p57KIP2 blocks proliferation of Ewing cells. EW24 cells were transfected with either GFP or GFP-p57KIP2 and fluorescent cells were counted 2 and 7 days after transfection. The reported number of fluorescent cells is an average of eight different microscopic fields. (b) p57KIP2 arrests Ewing cells in G1 phase. EW24 cells co-transfected with pPUR and either empty pcDNA or p57KIP2 encoding pcDNA were incubated with BrdU for 30 min and analysed by flow cytometry. The percentage of cells in G1, S and G2 phase of the cell cycle was analysed by FACS. Results of three independent experiments are reported. The weak variation of the G2 phase is linked to the presence of a tetraploid cell subpopulation in the EW24 cell line. (c) Western blot analysis of the expression of p57KIP2 in transfected EW24 Ewing cells. At the time of FACS analysis, extracts from EW24 cells were analysed by Western blot with a p57KIP2 specific antibody

Discussion

In this study, our goal was to analyse the possible influence of EWS-FLI-1 on the expression levels of various regulators of the cell cycle. The ideal system would have been to construct an inducible EWS-FLI-1 model within the parental cells giving rise to Ewing tumour. However, since presently the precise cellular origin of ET is not known, the expression of EWS-FLI-1 in such an appropriate system is not possible. We therefore analysed the expression of cell cycle regulators in the context of Ewing tumour cell lines and correlated these findings with the expression level of the same regulators in two heterologous cellular models. These included an inducible EWS-FLI-1 expression system in Hela cells and a constitutive expression model in neuroblastoma cells.

The expression levels of Cyclin D1, Rb, E2F1, CDK4, MDM2 and c-Myc were high in all ET cell lines tested, an observation compatible with a link between EWS-ETS fusion products and the expression of these proteins. However, apart from a strong induction of c-Myc, the expression levels of these proteins did not significantly vary upon EWS-FLI-1 induction in pMTEF cells. c-Myc expression level was also considerably increased in NGP cells expressing EWS-FLI-1 as compared to parental cells. These results confirm and extend previous experiments which showed that EWS-FLI-1 upregulates the c-Myc promoter, probably through an indirect mechanism (Bailly et al., 1994).

Among inhibitors of cyclin/CDK complexes, p21CIP1, p27KIP1 and p16INK4A were expressed to high level in a subset of Ewing cell lines suggesting that EWS-FLI-1 does not have a general inhibitory effect on their expression. p15INK4B, p18INK4C and p14ARF were either not or weakly expressed in Ewing cell lines but were not influenced by EWS-FLI-1 expression in pMTEF cells. In contrast, the expression of p57KIP2 was weak or absent in all tested Ewing cells and completely abolished upon induction of EWS-FLI-1 in pMTEF cells. Moreover, whereas the parental neuroblastoma NGP cell line expressed high amounts of p57KIP2, this protein was not detectable in two different clones expressing EWS-FLI-1. The variation of the p57KIP2 transcript correlated with that of the protein indicating that the modulation of p57KIP2 expression by EWS-FLI-1 results from transcriptional or post-transcriptional modifications. The transcriptional analysis of the p57KIP2 promoter showed that EWS-FLI-1 but not wild type FLI-1 induces a twofold repression of this promoter. Present indications suggest that the effect of EWS-FLI-1 on the p57KIP2 promoter is indirect since no binding site for EWS-FLI-1 could be mapped within the minimal responsive construct. However, we cannot presently exclude that EWS-FLI-1 binds to the p57KIP2 promoter cooperatively with other transcription factors or that a direct EWS-FLI-1 responsive element is present in other regulatory regions not tested in the present study. Further experiments should unravel the EWS-FLI-1 DNA response elements of the p57KIP2 promoter and its precise mechanism of action. It has been shown recently that p57KIP2, similarly to p21CIP1, has concentration-dependent effects on cyclin-CDK complexes. At low doses, these proteins promote the assembly of catalytically active complexes whereas, at higher concentrations, they inhibit kinase activity of these complexes (Lin et al., 1996; Hashimoto et al., 1998). In this respect it is noteworthy that EWS-FLI-1 does not lead to full repression of the p57KIP2 promoter, an observation in agreement with the detection of a weak p57KIP2 expression in a subset of Ewing cell lines.

The crucial role of p57KIP2 downregulation in the oncogenic properties of Ewing cells is strongly supported by the observation that ectopic expression of p57KIP2 completely abolished proliferation of these cells through the induction of a G1 arrest. This effect is consistent with the role of p57KIP2 as an inhibitor of G1 cyclin-dependent kinases. Indeed, it has been shown that p57KIP2 can induce a G1-arrest through association with cyclin-CDK complexes and subsequent inhibition of the phosphorylation of the Rb protein (Lee et al., 1995; Matsuoka et al., 1995). The observation that p57KIP2 can block S phase entry in Ewing cells indicates that the dowstream effectors of this pathway, including Rb, are functional. p57KIP2 is suspected to play a role in different cancers. Indeed, it is localized within the 11p15 chromosome region which has been shown to undergo genomic imprinting, the maternal allele being predominantly expressed (Matsuoka et al., 1996). p57KIP2 loss-of-function may be involved in Wilms tumour which demonstrates frequent loss of the maternal allele at 11p15 (Hatada et al., 1996a). It could also be important in the oncogenesis of a number of human malignancies which demonstrates loss-of-heterozygosity of this chromosome region and/or low expression levels (Feinberg, 1999a). A direct link between p57KIP2 and oncogenesis is also provided by the observation of constitutional p57KIP2 mutations in a subset of patients with Beckwith-Wiedmann syndrome, a condition which is associated with a susceptibility to the development of childhood cancers (Hatada et al., 1996b).

This study together with recent data from other laboratories indicate that the expression of EWS-FLI-1 leads to major abnormalities of the regulation of the G1 to S transition through distinct but convergent pathways. First, it strongly upregulates c-Myc which in turn is expected to activate CDK4 and Id2 transcription (Hermeking et al., 2000; Lasorella et al., 2000). Accordingly, CDK4 (Table 1) and Id2 (data not shown), are highly expressed in Ewing cells. Secondly, the repression of the promoter of the TGFBR2 impairs the TGFβ pathway which controls cell cycle progression, in particular through the SMAD cascade which regulates the transcription of CDK inhibitors (Hahm et al., 1999; Alexandrow and Moses, 1995). Finally, EWS-FLI-1 modulates the expression of p57KIP2, an inhibitor of G1 cyclin-CDK complexes. Altogether, these different modifications are expected to converge on a functional inactivation of Rb. This combined effect probably constitutes a critical step in the oncogenesis of Ewing tumour. A direct repression of EWS-FLI-1 on the TGFBR2 has been strongly suggested (Hahm et al., 1999). Further studies should elucidate the precise mechanisms of the control of c-Myc and p57KIP2 transcription by EWS-FLI-1.

Materials and methods

Cell lines

The PMT/EF plasmid was obtained by cloning the EWS-FLI-1 type 1 open reading frame into the HindIII restriction site of pMT-CB6+ vector which contains the sheep metallothionein promoter and a Neo resistance gene (Sumarsono et al., 1996). This plasmid was used to stably transfect Hela cells in the presence of 2 μg/μl of G418. To generate the NGP-EF cell lines, the neuroblastoma NGP9A Tr1 (NGP) cell line was infected with a previously described EWS-FLI-1 encoding retroviral vector (Lessnick et al., 1995). After selection in the presence of 600 μg/ml of G418, stable clones were isolated for further characterization. The NGP-NEO cell line was generated by transfecting the pMAM-neo expression vector onto NGP9A Tr1 by Superfect method (Qiagen).

A673, HeLa, COS-7, CHO, SKNAS and pMTEF cells were propagated in Dulbecco's modified Eagle's medium (DMEM) supplemented with antibiotics and 10% foetal calf serum. All other Ewing cell lines were maintained in RPMI 1640 medium supplemented with 10% foetal calf serum (Life Technologies) and antibiotics (penicillin/streptomycin from Life Technologies). NGP and derived cell lines were grown in RPMI 1640 medium supplemented with 20% foetal calf serum and antibiotics.

p57Kip2 promoter reporter vectors and luciferase assay

A 4.8 kb EcoRI–HindIII fragment containing the p57KIP2 gene was excised from the c14F5 cosmid (Reid et al., 1996) and cloned into bluescript vector. The −2191KIP2 luciferase vector was constructed by cloning a SacI–NheI promoter fragment into the pGL3 basic (Promega). The −1550KIP2, −595KIP2 and −165KIP2 constructs were derived from the −2191KIP2.

2.5×105 Hela, CHO or SKNAS cells were seeded in 60-mm petri dishes and transfected by calcium phosphate method 24 h later with 1 μg of the reporter plasmid and the indicated amounts of expression plasmids. Forty-eight hours post-transfection, cells were lysed and assayed for luciferase activity according to the manufacturer's instructions (Promega).

Electrophoretic mobility shift assay

Transfection of COS-7 cells with an EWS-FLI-1 encoding vector, preparation of nuclear extracts and conditions for electrophoretic mobility shift assay were performed as previously described (Melot et al., 1997) using a p57KIP2 probe (GCTGGGCGTTCCACAGGCCA).

Flow cytometry analysis

EW24 Ewing cells were cotransfected by effectene method (Qiagen) with pPUR (puromycin resistance plasmid from Clontech) and p57KIP2 encoding vector (Reynaud et al., 1999) or pcDNA3 empty vector in a 1 to 10 ratio. One day after transfection, cells were selected for 24 to 48 h in the presence of 1 μg/ml of puromycin then labelled with 30 μM of BrdU for 30 min at 37°C. FACS analysis was performed as previously described (Remvikos et al., 1991). After washing in PBS 1× and fixation in ethanol 70%, cells were digested with 0.5 mg/ml pepsine for 20 min at 37°C and treated with 2 N HCl for 20 min at room temperature. Cells incubated with a rat monoclonal antibody anti-BrdU (Abcys) for 1 h at room temperature, then with a FITC-conjugated anti-rat secondary antibody (Southern Biotechnology Associates, Inc.) were used for cell cycle analysis.

Antibodies and Western blot analysis

Cellular extracts were prepared either directly in sample buffer or in RIPA without SDS depending on the antibody used. Seventy-five μg of proteins were loaded on SDS-polyacrylamide gels, separated by electrophoresis then electro-transferred onto nitrocellulose membranes. After staining with Ponceau red, membranes were blocked with 25 mM Tris-HCl pH 8, 125 mM NaCl, 0.15% tween 20 and 5% non fat milk for 1 h at room temperature, incubated for 1 h 30 min with primary antibodies at room temperature then washed and incubated for 1 h with horseradish peroxydase-conjugated anti-rabbit or anti-mouse secondary antibodies diluted 1/3000 (Amersham) and detected by an enhanced chemiluminescence system (Roche) according to the manufacturer's instructions.

Monoclonal anti-p21CIP1 (Transduction Laboratories), -p53 (provided by T Soussi, Institut Curie Paris, France), -FLI-1 (Melot et al., 1997), and polyclonal anti-HA, -p57Kip2, -p18INK4C, -p27KIP1 (obtained from Santa Cruz Biotechnology), -c-Myc (Euromedex), and cyclin D1 antibodies (Euromedex) were used to analyse extracts prepared in sample buffer. Monoclonal anti-E2F1 (KH95 from Santa Cruz Biotechnology), -Rb (G3-245 from Pharmigen) and -MDM2 (provided by T Soussi, Institut Curie Paris, France) and polyclonal anti-p16INK4A, -p14ARF, -p15INK4B (obtained from Santa Cruz Biotechnology) antibodies were used for extracts prepared in RIPA without SDS.

All the membranes were probed with a monoclonal anti-β actin AC74 antibody (supplied by Sigma) diluted 1/20 000 as an internal control for expression.

Competitive RT–PCR

Total mRNA treated with DNAse were extracted from Hela and NGP derived cell lines with S.N.A.P.TM total isolation kit (In Vitrogen). For the NGP-EF cell lines, EWS-FLI-1 expression was monitored using the 22.14 EWS primer: GCACCTCCATCCTACCCTCCT and the previously described FLI.11 primer (Peter et al., 1995).

Relative expression of c-Myc and p57Kip2 were assessed by co-amplification with TBP as internal control. The primer sequences for TBP were as described by Gil Diez de Medina et al. (1998), the primer sequences of c-Myc were: GACATGGTGAACCAGAGTTTC (sense) and GTGTCTCCTCATGGAGCAC (reverse), the primer sequences of p57Kip2 were obtained from Clontech. The PCR reactions were performed by using 15 pmoles of each primer for 30 cycles: 94°C for 30 s, 60°C for 30 s and 72°C for 30 s.

Analysis of the p15/p16 locus

Homozygous deletions of the p16INK4A and p15INK4B genes were analysed in the 13 Ewing cell lines by PCR amplification of exon 2 of p16INK4A and p15INK4B using previously described conditions (Xing et al., 1999).

References

  1. Alexandrow MG, Moses HL . 1995 Cancer Res. 55: 1452–1457

  2. Arvand A, Bastians H, Welford SM, Thompson AD, Ruderman JV, Denny CT . 1998 Oncogene 17: 2039–2045

  3. Bailly RM, Bosselut R, Zucman J, Cormie F, Delattre O, Roussel M, Thomas G, Ghysdael J . 1994 Mol. Cell. Biol. 14: 3230–3241

  4. Delattre O, Zucman J, Plougastel B, Desmaze C, Melot T, Peter M, Kovar H, Joubert I, de Jong P, Rouleau G, Aurias A, Thomas G . 1992 Nature 359: 162–165

  5. Feinberg AP . 1999 Cancer Res. 59: 1743s–1746s

  6. Gartel AL, Tyner AL . 1999 Exp. Cell. Res. 246: 280–289

  7. Gil-Diez de Medina S, Salomon L, Colombel M, Abbou CC, Bellot J, Thiery JP, Radvanyi F, Van der Kwast TH, Chopin DK . 1998 Hum. Pathol. 29: 1005–1102

  8. Hahm KB, Cho K, Lee C, Im YH, Chang J, Choi SG, Sorensen PH, Thiele CJ, Kim SJ . 1999 Nat. Genet. 23: 2222–2227

  9. Hamelin R, Zucman J, Melot T, Delattre O, Thomas G . 1994 Int. J. Cancer 57: 336–340

  10. Hashimoto Y, Kohri K, Kaneko Y, Morisaki H, Kato T, Ikeda K, Nakanishi M . 1998 J. Biol. Chem. 273: 16544–16550

  11. Hatada I, Inazawa J, Abe T, Nakayama M, Kaneko Y, Jinno Y, Niikawa N, Ohashi H, Fukushima Y, Iida K, Yutani C, Takahashi S, Chiba Y, Ohishi S, Mukai T . 1996a Hum. Mol. Genet. 5: 783–788

  12. Hatada I, Ohashi H, Fukushima Y, Kaneko Y, Inoue M, Komoto Y, Okada A, Ohishi S, Nabetani A, Morisaki H, Nakayama M, Niikawa N, Mukai T . 1996b Nat. Genet. 14: 171–173

  13. Hermeking H, Rago C, Schuhmacher M, Li Q, Barrett JF, Obaya AJ, O'Connell BC, Mateyak MK, Tam W, Kohlhuber F, Dang CV, Sedivy JM, Eick D, Vogelstein B, Kinzler KW . 2000 Proc. Natl. Acad. Sci. USA 97: 2229–2234

  14. Im YH, Kim HT, Lee C, Poulin D, Welford S, Sorensen PH, Denny CT, Kim SJ . 2000 Cancer Res. 60: 1536–1540

  15. Jaishankar S, Zhang J, Roussel MF, Baker SJ . 1999 Oncogene 18: 5592–5597

  16. Komuro H, Hayashi Y, Kawamura M, Hayashi K, Kaneko Y, Kamoshita S, Hanada R, Yamamoto K, Hongo T, Yamada M, Tsuchida Y . 1993 Cancer Res. 53: 5284–5288

  17. Kovar H, Auinger A, Jug G, Aryee D, Zoubek A, Salzer-Kuntschik M, Gadner H . 1993 Oncogene 8: 2683–2690

  18. Lasorella A, Noseda M, Beyna M, Iavarone A . 2000 Nature 5: 592–598

  19. Lee MH, Reynisdottir I, Massague J . 1995 Genes Dev. 9: 639–649

  20. Lessnick SL, Brau BS, Denny CT, May WA . 1995 Oncogene 10: 423–431

  21. Lin J, Reichner C, Wu X, Levine AJ . 1996 Mol. Cell. Biol. 16: 1786–1793

  22. Mao X, Miesfeldt S, Yang H, Leiden JM, Thompson CB . 1994 J. Biol. Chem. 269: 18216–18222

  23. Matsuoka S, Edwards MC, Bai C, Parker S, Zhang P, Baldini A, Harper JW, Elledge SJ . 1995 Genes Dev. 9: 650–662

  24. Matsuoka S, Thompson JS, Edwards MC, Bartletta JM, Grundy P, Kalikin LM, Harper JW, Elledge SJ, Feinberg AP . 1996 Proc. Natl. Acad. Sci. USA 93: 3026–3030

  25. May WA, Arvand A, Thompson AD, Braun BS, Wright M, Denny CT . 1997 Nat. Genet. 17: 495–497

  26. May WA, Lessnick SL, Braun BS, Klemsz M, Lewis BC, Lunsford LB, Hromas R, Denny CT . 1993 Mol. Cell. Biol. 13: 7393–7398

  27. Melot T, Gruel N, Doubeikovski A, Sevenet N, Teillaud JL, Delattre O . 1997 Hybridoma 165: 457–464

  28. Peter M, Magdelenat H, Michon J, Melot T, Oberlin O, Zucker JM, Thomas G, Delattre O . 1995 Br. J. Cancer 72: 96–100

  29. Reid LH, Crider-Miller SJ, West A, Lee MH, Massague J, Weissman BE . 1996 Cancer Res. 56: 1214–1218

  30. Remvikos Y, Vielh P, Padoy E, Benyahia B, Voillemot N, Magdelenat H . 1991 Br. J. Cancer 64: 501–507

  31. Reynaud EG, Pelpel K, Guillier M, Leibovitch MP, Leibovitch SA . 1999 Mol. Cell. Biol. 19: 7621–7629

  32. Sumarsono SH, Wilson TJ, Tymms MJ, Venter DJ, Corrick CM, Kola R, Lahoud MH, Papas TS, Seth A, Kola I . 1996 Nature 379: 534–537

  33. Thompson AD, Braun BS, Arvand A, Stewart SD, May WA, Chen E, Korenberg J, Denny CT . 1996 Oncogene 13: 2649–2658

  34. Tokino T, Urano T, Furuhata T, Matsushima M, Miyatsu T, Sasaki S, Nakamura Y . 1996 Hum. Genet. 97: 625–631

  35. Xing EP, Nie Y, Song Y, Yang GY, Cai YC, Wang LD, Yang CS . 1999 Clin. Cancer Res. 510: 2704–2713

Download references

Acknowledgements

We thank Ismail Kola, Christopher Denny and Serge Leibovitch for providing the pMT-CB6+ vector, the EWS-FLI-1 retroviral vector, the GFP-p57KIP2 and the p57KIP2 vectors, respectively. We also thank Danny Rouillard for her help in cell cycle analysis, Catherine Barbarou and Patricia de Cremoux for the analysis of p53. L Dauphinot is a recipient of a fellowship from the Ligue Nationale Contre le Cancer. This work was supported in part by grants from the Association pour la Recherche contre le Cancer, the Ligue Nationale Contre le Cancer and the USPHS, CA63176.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Olivier Delattre.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Dauphinot, L., De Oliveira, C., Melot, T. et al. Analysis of the expression of cell cycle regulators in Ewing cell lines: EWS-FLI-1 modulates p57KIP2 and c-Myc expression. Oncogene 20, 3258–3265 (2001). https://doi.org/10.1038/sj.onc.1204437

Download citation

Keywords

  • Ewing tumour
  • cell cycle
  • EWS-FLI-1
  • c-Myc
  • p57KIP2

Further reading

Search

Quick links