Enhanced tumorigenicity caused by truncation of the extracellular domain of GP125/CD98 heavy chain

Abstract

GP125/CD98 is a heterodimeric 125-kDa glycoprotein, which consists of an 85-kDa heavy chain (hc) and a 40-kDa light chain (lc), and is strongly expressed on the cell surface of various tumor cells, irrespective of their tissue of origin. We have recently demonstrated that overexpression of the CD98hc cDNA causes malignant transformation of NIH3T3 cells. To investigate the function of the extracellular domain of CD98hc in cell proliferation and malignant transformation, we established two NIH3T3-derived clones transfected with human truncated CD98hc cDNAs, and compared their characteristics with parental NIH3T3 and clones transfected with full-length CD98hc cDNA. Truncated as well as full-length CD98hc-transfected clones grew to a higher saturation density than control cells. Efficiency of colony formation in soft agar was augmented in all CD98hc-transfected clones, and the degrees of augmented colony formation of the transfectants expressing full-length CD98hc of 529 a.a. or truncated CD98hc of 418 a.a. were reduced by anti-human CD98hc antibodies, while that of the transfectant expressing truncated CD98hc of 237 a.a. lacking the epitopes recognized by anti-human CD98hc antibodies was not affected by the addition of antibodies. CD98hc-transfected clones developed tumors in athymic mice, and tumor growth of truncated CD98hc-transfected clones was faster than that of full-length CD98hc-transfected clones.

Introduction

A 125-kDa glycoprotein (GP125)/CD98, which was originally identified by the monoclonal antibody (mAb) 4F2 (Haynes et al., 1981) raised against the HSB-2 human T cell line, consists of an 85-kDa heavy chain (hc) and a 40-kDa light chain (lc). Analyses of CD98 cDNAs have revealed that CD98hc is a type II transmembrane glycoprotein (Broer et al., 1995; Lumadue et al., 1987; Parmacek et al., 1989; Quackenbush et al., 1987; Teixeira et al., 1987), which is disulfide-linked to a nonglycosylated member of the permease family, CD98lc (Kanai et al., 1998; Mannion et al., 1998; Mastroberardino et al., 1998; Nakamura et al., 1999; Pfeiffer et al., 1999; Tsurudome et al., 1999).

Several groups have reported higher levels of expression of GP125/CD98 in some normal cells, including activated lymphocytes (Haynes et al., 1981; Hashimoto et al., 1983; Tanaka et al., 1988; Yagita et al., 1986b), the basal layer of skin (Hashimoto et al., 1983; Masuko et al., 1985; Patterson et al., 1984), small intestinal epithelium (Hashimoto et al., 1983; Masuko et al., 1985), hyperplastic urinary bladder epithelium (Masuko et al., 1985), proximal tubules of the kidney (Masuko et al., 1985; Quackenbush et al., 1986) and a wide variety of tumors (Hashimoto et al., 1983; Masuko et al., 1985; Yagita et al., 1986a; Kamma et al., 1989; Tanaka et al., 1989; Dixon et al., 1990). Using T24 human and BC47 rat bladder tumor cell lines as immunogens, we produced several mAbs that recognize human (Masuko et al., 1985) and rat (Hashimoto et al., 1983) CD98hc.

Expression of GP125/CD98 is augmented following stimulation of resting T cells with mitogens (Haynes et al., 1981; Hashimoto et al., 1983; Yagita et al., 1986b), alloantigens (Haynes et al., 1981; Yagita and Hashimoto, 1986), or phorbol ester and calcium ionophores (Tanaka et al., 1989), correlated with the G0–G1 transition of the cell cycle, and occurs before the expression of interleukin 2 and transferrin receptors (Yagita et al., 1986b; Tanaka et al., 1989) or the onset of DNA synthesis (Haynes et al., 1981, Hashimoto et al., 1983; Yagita et al., 1986b). Our anti-CD98hc mAbs have been shown to efficiently inhibit the activation of lymphocytes (Yagita and Hashimoto, 1986) and the growth of various tumor cell lines (Yagita et al., 1986a).

The involvement of CD98 in cellular Na+-dependent calcium uptake has been reported in cardiac and skeletal muscle (Michalak et al., 1986), and in the parathyroid gland (Posillico et al., 1987). In this context, CD98 has been identified as a major surface receptor for a mammalian galactoside-binding protein, Galectin-3 (Dong and Hughes, 1996), which binds to CD98 and induces an increase in intracellular calcium in human Jurkat T leukemia cells.

Tyrosine phosphorylation of a protein of Mr.125 000, and homotypic aggregation and apoptosis of lymphoid progenitor cells triggered by anti-CD98 mAb have been observed, and the possible involvement of CD98 in the control of cell survival/death of hematopoietic cells has been proposed (Warren et al., 1996). In addition, CD98 has been reported to participate in virus-mediated cell fusion (Ohgimoto et al., 1995) and regulation of integrin affinity (Fenczik et al., 1997).

CD98hc was suggested to be involved in the transport of neutral and dibasic amino acids, since complementary RNAs for human and rat CD98hc stimulated the system L- and y+-like amino acid transport activities in Xenopus laevis oocytes (Broer et al., 1995; Bertran et al., 1992; Wells et al., 1992). However, circumstantial evidence suggested that CD98hc was strongly linked to amino acid transport but was not the transporter itself (Bertran et al., 1992; Macleod et al., 1994). The first light chain (Lc1 or LAT1) associated with CD98hc have been identified at long last (Kanai et al., 1998, Mastroberardino et al., 1998; Nakamura et al., 1999; Tsurudome et al., 1999), and this molecule proved to be TA1/E16 (Sang et al., 1995). Lc1 mediates Na+-independent large neutral amino acid transport (system L). Shortly after that, a growing number of amino-acid transporters, specifically Lc2 to Lc6, were identified as novel CD98lcs (Pfeiffer et al., 1999; Pineda et al., 1999; Rossier et al., 1999; Sato et al., 1999; Rajan et al., 1999).

The wide variety of cellular functions of GP125/ CD98 cannot be simply explained by its role in amino acid transport. To understand the physiological and pathological roles of CD98 other than those in amino acid transport, further analysis of CD98-associated molecules is indispensable. Recently, to understand the function of CD98 with respect to cellular proliferation and malignancy, we isolated human full-length CD98hc-transfected NIH3T3 clones and demonstrated that CD98hc-transfected clones showed various malignant phenotypes (Hara et al., 1999).

In this study, to characterize the functional domains of CD98hc with respect to cellular proliferation and malignancy, we analysed the effects of truncation of the extracellular domain on the display of malignant phenotypes using various NIH3T3 clones transfected with wild-type and truncated cDNAs of human CD98hc. Our results indicated that cDNAs encoding truncated CD98hc proteins lacking the distal one-third or half of the extracellular domain endows NIH3T3 cells with much more enhanced malignant phenotypes as compared with full-length CD98hc cDNA, indicating that the extracellular domain of CD98hc has a suppressive or regulatory role in the display of malignant phenotypes.

Results

Isolation of transfectants expressing truncated human CD98hc proteins

We have recently demonstrated the emergence of malignant phenotypes (Hara et al., 1999) and resistance to growth arrest by serum starvation (Hara et al., submitted for publication) in NIH3T3 cells transfected with a cDNA encoding full-length CD98hc. To assess the role of the extracellular domain of CD98hc, we examined several characteristics of full-length or truncated CD98hc-expressing transfectants. We have already established three NIH3T3 clones transfected with cDNA encoding full-length CD98hc (Hara et al., 1999), and in this study, we established additional one clone expressing full-length human CD98hc (NIH/hH-4) and two clones with different truncated CD98hc proteins. To distinguish introduced from endogenous CD98hc protein, human CD98hc cDNA was used. NIH3T3 cells were transfected with hCD98H-pcDNA3 carrying full-length CD98hc cDNA (Hara et al., 1999), and hCD98HD1-pcDNA3 or hCD98HD2-pcDNA3 carrying truncated human CD98hc cDNAs and a neomycin resistance gene under the control of the constitutively active cytomegalovirus promoter. Three clonal lines, designated as NIH/hH-4, NIH-hHD-1 and NIH/hHD-2 cells were selected by G418 resistance and were examined for the expression of human full-length and truncated CD98hc by immunoreactivity with a mixture of anti-CD98hc mAbs 4F2, HBJ127 and 5-21. Figure 1a shows the expression of full-length or truncated (hHD-1) CD98hc isoform in these clones. Expression of truncated CD98hc mRNA in hHD-2 cells, which does not possess epitopes recognized by anti-CD98hc mAbs, was demonstrated by RT–PCR (Figure 1b). Although NIH/neo control transfectant cells had a normal morphology that was indistinguishable from NIH3T3 cells, CD98hc-transfected full-length and truncated clones had the typical refractile, spindle-shaped appearance of transformed cells. This transformation-related appearance was remarkable particularly in hHD-1 and hHD-2.

Figure 1
figure1

Expression of CD98hc proteins and mRNAs in transfectants. (a) Reactivity of human CD98hc-transfected NIH3T3 clones with anti-human CD98hc mAbs. NIH3T3 cells were transfected with pcDNA3 (NIH/neo), pcDNA3 containing full-length human CD98hc cDNA (NIH/hH-1, -2, -3 and -4) or pcDNA3 containing truncated CD98hc cDNAs (NIH/hHD-1 and hHD-2). Cells were sequentially treated with a mixture of anti-human CD98hc mAbs followed by fluoresceine isothiocyanate-conjugated rabbit anti-mouse immunoglobulin. Cells (10 000 cells) were analysed for their fluorescence intensity by flow cytometry; B3 control mAb (a) and anti-human CD98hc mAbs (b). (b) NIH3T3, NIH/neo, NIH/hH-1 and NIH/hHD-2 were assessed for the mRNAs of human CD98hc by RT–PCR as described in Materials and methods. The arrow shows the amplified CD98hc fragments of 210 bp

Proliferation of full-length and truncated CD98hc transfectants in monolayer culture

Growth curves for parental NIH3T3, NIH/neo, full-length human CD98hc-transfected NIH3T3 clones (NIH/hH-1, hH-2 and hH-3) and truncated CD98hc-transfected NIH3T3 clones (NIH/hHD-1 and hHD-2) were generated to determine whether overexpression of CD98hc led to alteration of the growth parameters (Figure 2). Doubling times of these clones were almost the same; those of NIH3T3, NIH/neo, NIH/hH-1, hH-2, hH-3, hHD-1 and hHD-2 were 19.8, 19.5, 18.6, 19.7, 20.9, 19.7 and 18.5, respectively. In contrast, full-length and truncated CD98hc-transfected clones showed about 4–5-fold higher saturation densities (18.4×104, 17.9×104, 16.7×104, 16.6×104 and 22.3×104 cells/cm2, for NIH/hH-1, hH-2, hH-3, hHD-1 and hHD-2, respectively) than those of the control cells (4.2×104 and 3.7×104 cells/cm2 for NIH3T3 and NIH/neo, respectively.

Figure 2
figure2

Growth curves of human CD98hc-transfected NIH3T3 clones. Cells were inoculated at 1×104 cells/well in 24-well plates with 10% FBS–DMEM. Cellular growth was daily determined by counting the number of cells after seeding

Expression of truncated CD98hc induces anchorage-independent growth of NIH3T3

High saturation density is regarded as an indicator of malignant transformation (Khosravi-Far et al., 1995; Qiu et al., 1995). Thus, the increase in saturation density of CD98hc-transfected cells indicated the malignancy of these cells. To test the influence of overexpression of CD98hc on anchorage-independent growth, we examined the ability of human CD98hc-transfected clones to grow in soft agar. The colony forming efficiency of CD98hc-transfected cells was much higher than that of control cells (Figure 3a). In addition, the efficiency of colony formation was significantly higher in truncated CD98hc transfectants (especially in hH-D2) than in full-length transfectants. To assess whether the malignant properties of CD98hc-transfected clones were due to the expression of human CD98hc proteins, we next examined the effects of a mixture of anti-human CD98hc mAbs (4F2, HBJ127 and 5-21) recognizing different epitopes on CD98hc and an isotype-matched control mAb (B3) on anchorage-independent growth of transfectants. As shown in Figure 3b, the colony forming efficiencies of NIH/hH-1, hH-2, hH-3, and NIH/hHD-1 cells were reduced by 60.7, 56.1, 55.1 and 22.8%, respectively, by anti-human CD98hc mAbs, but only slightly reduced by the control mAb. No inhibition of colony formation by mAbs in hHD-2 shows specificity of mAbs, because this truncated CD98-transfected clone does not possess epitopes recognized with any of three anti-CD98hc mAbs (HBJ127, 4F2 and 5-21). Low inhibition of colony formation by mAbs in hHD-2 might be explained by the fact that full-length CD98hc-transfected clones react with all three anti-CD98hc mAbs, but hHD-1 reacts only with 5-21 mAb. In addition, anti-CD98hc mAbs had no effect on background level of colony formation by NIH3T3 or NIH/neo (data not shown). The reduction in number of colonies by the addition of anti-human CD98hc mAbs suggested that the increased colony-forming ability in soft agar was due to the function of exogenously expressed CD98hc proteins, excluding the possibility of accidental acquisition of transformed phenotype by gene transfer or spontaneous transformation during isolation of clones. These observations indicated that overexpression of full-length CD98hc protein or expression of truncated CD98hc proteins promotes anchorage-independent growth.

Figure 3
figure3

Colony formation of human CD98hc-transfected NIH3T3 clones in soft agar. (a) Cells (1×103) were cultured for 14 days in 35-mm soft agar dishes. The data represent typical results of three independent experiments, and values shown are the means of five samples±s.d. Bars, s.d., P<0.01 in NIH/hH-1, hH-2 and hH-3 versus NIH3T3 and NIH/neo cells; P<0.05 in NIH/hHD-1 and hHD-2 versus NIH/hH-1, hH-2 and hH-3 cells. (b) Effects of anti-human CD98hc mAbs on the colony formation of human CD98hc-transfected clones in soft agar. Cells (1×103) were cultured for 14 days in 35-mm soft agar dishes with or without mAbs ([hatched box]; anti-human CD98hc mAbs, □ B3 isotype-matched control mAb) at a concentration of 10 μg/ml. The data represent the per cent inhibition of colony formation relative to the control (without mAb). Bars, s.d. *, P<0.01 versus B3

Overexpression of truncated CD98hc causes more enhanced tumor formation compared with full-length CD98hc

Anchorage-independent growth is often correlated with in vivo tumor formation (Bouck and Di Mayorca, 1979; Cooper et al., 1980). To investigate the in vivo relevance of the above results, the tumorigenicity of CD98hc-transfected clones was evaluated in athymic mice. Full-length CD98hc transfectant cells and truncated CD98hc transfectant cells developed tumors in 14 of 20 athymic mice and in all of 10 mice, respectively. The six mice without tumors were those that had been inoculated with NIH/hH-3 or hH-4 cells which expressed relatively low levels of human CD98hc. In this tumorigenicity assay, the degree of malignancy of full-length CD98hc-transfected clones was proportional to the level of CD98hc expression; i.e. degree of malignancy was high in NIH/hH-1 and hH-2, and relatively low in NIH/hH-3 and hH-4 cells. Surprisingly, hHD-1 and hHD-2 developed much more rapidly growing tumors as compared with full-length CD98hc-transfected clones. All tumors were histologically diagnosed as typical fibrosarcomas, and the levels of human CD98hc expression were comparable to those of corresponding cells cultured in vitro (data not shown). On the other hand, no mice developed tumors within 60 days after s.c. injection of NIH3T3 or NIH/neo cells (Figure 4).

Figure 4
figure4

Tumorigenicity of human CD98hc-transfected NIH3T3 clones in athymic mice. Each mouse was injected s.c. with 1×106 cells. Once a tumor was detected, the size was monitored by taking caliper measurements every other day for 50 days, and tumor volume was calculated by 0.5×(length)×(width)2 (left and right). Each bar represents the s.d. of individual tumors after injection. Fractions in the figure show tumor incidences 23 days (left) or 35 days (right) after inoculation of cells

We concluded that expression of CD98hc with a truncated extracellular domain is sufficient to transform mammalian fibroblasts, and results in a much stronger malignant phenotype as compared with full-length CD98hc.

No point mutations have been reported in murine or human CD98hc genes in tumor cells. Therefore, we have emphasized the possibility that the normal coding sequence of the CD98hc gene display oncogenic potential by overexpressing wild-type CD98hc proteins in mammalian cells (Hara et al., 1999). Similarly, the epidermal growth factor (EGF) receptor family expressing wild-type proteins has been implicated in a wide variety of human tumors, where they are typically overexpressed by gene amplification or increased transcription (Krous et al., 1987).

The results of the present study suggested a regulatory role of the extracellular domain of CD98hc, in the process of malignant transformation by CD98hc. In this context, the v-erb transforming gene of avian erythroblastosis virus was derived, by retroviral transduction, from the gene (c-erbB) encoding the avian EGF receptor, and the transforming capacity of v-erbB appears to result from truncation of the receptor (Donward et al., 1984). Similarly, enhanced malignant phenotypes have been observed in glioblastoma cells expressing a truncated EGF receptor (Nishikawa et al., 1994). In these cases, constitutive tyrosine phosphorylation of receptors is associated with the ability of the mutant receptor to confer enhanced malignant phenotype on tumor cells (Martin, 1986; Yamazaki et al., 1988).

Although the precise mechanism of malignant transformation by overexpression of wild-type CD98hc and enhanced malignant potential of truncated CD98hc remains to be determined, regulation by the extracellular domain of CD98hc, which is normally regulated by unknown ligands, may be released by truncation and lead to enhanced malignant phenotypes as compared to those in cells expressing wild-type CD98hc. In this context, we are now investigating the effect of galectin-3 on the display of CD98-mediated malignant phenotypes in full-length and truncated CD98-transfected clones.

Recently, the structure of light chains associated with CD98hc was analysed, and has been shown to be a family of permease-related amino acid transporter (Kanai et al., 1998; Mastroberardino et al., 1998; Nakamura et al., 1999; Pfeiffer et al., 1999; Pineda et al., 1999; Rossier et al., 1999; Sato et al., 1999). The expression of light chains on the cell surface requires the coexpression of CD98hc (Kanai et al., 1998; Mastroberardino et al., 1998; Nakamura et al., 1999; Pfeiffer et al., 1999). We have recently detected two forms of human CD98hc disulfide-linked or unlinked with light chains in human CD98hc-transfected NIH3T3 cells and various human tumor cell lines by immunoprecipitation analyses (unpublished data). Although the participation of the light chains in CD98hc-induced malignant transformation requires further investigation, it is conceivable that the transforming effect of CD98hc is in part due to the ‘titrating out’ effect of the light chain. We have recently evaluated the transforming ability of mutant CD98hc with substitutions of cysteine to serine and which would therefore be defective in association with the light chain by the disulfide bridge, and demonstrated that transformation of murine fibroblasts caused by over-expression of CD98hc requires its association with CD98lc (Shishido et al., 2000). Since two deletion mutants of CD98hc investigated in this study had a cysteine residue, these mutant cells can be disulfide-linked to CD98lc (Shishido et al., unpublished data). We are planning analysis of other deletion mutants lacking almost all of the extracellular domain and which cannot bind to the light chain.

Recently, it has been demonstrated that the physical interaction between the cytoplasmic domains of β1 integrin and CD98hc leads to the activation of integrin by a conformational change in the ligand-binding site of the integrins (Fenczik et al., 1997). Although the regulatory mechanism of integrin activation is unclear, the involvements of Rho family proteins (Schwartz et al., 1996), integrin-linked kinase (ILK) (Radeva et al., 1997) and the Ras/Raf-initiated mitogen-activated protein (MAP) kinase pathway (Hughes et al., 1997) have recently been reported. Cell growth is regulated separately by integrin- and serum- (growth factor) dependent pathways, and these two pathways converge downstream (Schwartz, 1997). Constitutive activation of components at given points in the pathways often gives rise to transformed cells, and integrin- or serum-independence has been acquired in relation to the position of the components in the two pathways. For example, Rho-overexpressing NIH3T3 cells show anchorage-independent but serum-dependent growth (Schwartz et al., 1996). In this context, CD98 seems to be involved in integrin-dependent events as CD98hc-transfected clones grow under anchorage-independent conditions. However, we found that NIH3T3 cells show resistance to growth arrest by serum starvation when they overexpress CD98hc (Hara et al., submitted for publication). Thus, CD98 participates in the serum-dependent pathway directly or indirectly as well as in the anchorage-dependent pathway.

Unlike typical receptor-type oncoproteins, such as members of the erbB/epidermal growth factor receptor family with restricted tumor distribution (Plowman et al., 1993), CD98 is overexpressed on the cell surface of almost all tumor cells irrespective of tissue of origin. Therefore, we expect that analysis of CD98-mediated malignant transformation will lead to the general understanding of the oncogenic process in diverse tumor types.

In conclusion, our findings revealed that the truncated CD98hc gene acts as a more potent oncogene than the full-length gene when expressed in NIH3T3 cells. Studies are currently underway to address the mechanism and in vivo relevance of CD98-mediated malignancy by evaluating possible links to components in integrin-mediated or serum-dependent pathways, by searching for natural CD98hc of truncated forms and novel CD98-associated molecules, and by assessing the in vivo effects of overexpression, truncation and disruption of CD98hc by transgene and gene-targeting strategies.

Materials and methods

Plasmid construction and transfection

Full-length human CD98hc cDNA encoding a CD98hc protein of 529 amino acids was obtained from A431 cells by reverse transcription-PCR and was cloned into pcDNA3 (Invitrogen, San Diego, CA, USA) as described (Hara et al., 1999). To obtain truncated CD98hc cDNAs encoding extracellular C-terminus-truncated CD98hc proteins, PCR was carried out with primers (5′ sense, ACCATG AGCCAGGACACCGAGGT; and 3′ antisense, TATTAGAG GG AGCCAGGGTCTTC) for amplification of CD98hc protein of 418 amino acids, and with primers (5′ sense, ACCATGAGCCAGGACACCGAGGT; and 3′ antisense, TATTACA (GA) CCAA(GA)CCAA(GA)AACTCAGAGC) for a CD98hc protein of 237 amino acids, and the products were cloned into pBluescript II. The nucleotide sequences of the inserted fragments were confirmed by dideoxy chain termination sequencing analysis (Sanger et al., 1977) using a 373A DNA Sequencer (Applied Biosystems, Foster City, CA, USA). To establish NIH3T3 cells stably expressing truncated human CD98hc, we used the mammalian expression vector pcDNA3 containing the neomycin phosphotransferase (neo) gene. The plasmids were assembled by ligating the XhoI–NotI fragment containing human truncated CD98hc cDNAs from pBluescript II into XhoI–NotI cut pcDNA3 to yield hCD98HD1–pcDNA3 and hCD98HD2–pcDNA3. The plasmid DNAs for transfection were purified with a Qiagen plasmid kit (Funakoshi, Tokyo). Transfection was carried out by electroporation with an ECM 600 electro cell manipulator (BTX Inc., San Diego, CA, USA). Cells (1.2×106 in 400 μl of PBS) were mixed with 8 μg of plasmid DNA and exposed to a 145 V electric pulse with a capacitance of 600 mF and 13 ohm at room temperature. Seventy-two hours after transfection, drug-resistant cells were selected using geneticin disulfate (G418; Wako Pure Chem., Osaka, Japan). Surviving colonies were picked up, and the cloned cells were then continuously cultured in the presence of G418. Expression of human CD98hc protein or mRNA was confirmed by flow cytometry or RT–PCR, respectively. Primers for RT–PCR used were 5′ sense, TACCGCATCGGCGACCTTCA, and 3′ antisense, AAAATCTTCCTGGGAGCCTA. NIH3T3 cells were also transfected with the pcDNA3 vector as described above, and one G418-resistant clone (NIH/neo) was used as a control transfectant. Multiple aliquots of individual clones (passages 5–10) were frozen, and each aliquot was used for no more than 2 weeks, to avoid potential phenotypic changes in each line.

Cell culture

NIH3T3 mouse fibroblastic cells and A431 human vulvar squamous carcinoma cells (American Type Culture Collection, Bethesda, MD, USA) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS; ICN Biomedicals, Aurora, OH, USA). Full-length (wild-type) and truncated human CD98hc transfectants were maintained in DMEM containing 10% FBS and 400 μg/ml of G418. Cells were cultured at 37°C in a humidified 5% CO2 atmosphere.

Antibodies

4F2 (Haynes et al., 1981), HBJ127 (Masuko et al., 1985) and 5–21 mAbs recognize the Mr.85 000 subunit (heavy chain) of human CD98/GP125. Anti-rat CD98hc mAb B3 (Hashimoto et al., 1983) was used as an isotype-matched control IgG. These mAbs were purified using protein G-Sepharose columns (Pharmacia, Uppsala, Sweden).

Flow cytometry

Cells (2×105) were incubated for 1 h on ice with mAb (1 μg) in 100 μl of phosphate-buffered saline (PBS; 140 mM NaCl, 25 mM KCl, 80 mM Na2HPO4, 15 mM KH2PO4, pH 7.4) containing 1% bovine serum albumin (BSA; Fraction V; Sigma Chem., St. Louis, MO, USA). After washing with PBS, cells were incubated for 45 min on ice with fluoresceine isothiocyanate-conjugated rabbit anti-mouse immunoglobulin (Dako Japan, Tokyo) diluted 1 : 200 in 1% BSA–PBS. Cells were then washed with PBS, and cell-surface fluorescence was analysed using a FACScan flow cytometer (Becton Dickinson, San José, CA, USA).

Proliferation assay

Cells (1×104) were seeded into 24-well plates (Costar, Cambridge, MA, USA), grown in 10% FBS–DMEM and counted daily by the Trypan blue dye exclusion test for 6 days.

Soft agar assay

The wells of 35-mm dishes (Falcon) were coated with 2 ml of bottom agar mixture (10% FBS–DMEM, 0.53% agar). After the bottom layer had solidified, 2 ml of the top agar mixture (10% FBS–DMEM, 0.3% agar) containing the cells (1×103) was added. On day 15 after plating, colonies were counted under a microscope. For mAb inhibition experiments, mAbs were added at a final concentration of 10 μg/ml in 10% FBS–DMEM on the top agar mixture on days 1 and 7.

Tumorigenicity assay

Male athymic mice (KSN strain) at 6 weeks of age (Nippon SLC, Hamamatsu, Japan) were randomly distributed into eight groups of five animals each. Cells were trypsinized and suspended in PBS at a density of 5×106 cells/ml. Aliquots of 200 μl of the cell suspensions were injected s.c. into the right dorsal flank of each animal. The size of each tumor formed was measured every 2 days for 5 weeks. Tumor volume was calculated by the formula 0.5×(length)×(width)2 (Shin, 1979). All animals were maintained in a specific-pathogen-free facility.

References

  1. Bertran J, Magagnin S, Werner A, Markovich D, Biber J, Testar X, Zorzano A, Kuhn LC, Palacin M and Murer H. . 1992 Proc. Natl. Acad. Sci. USA 89: 5606–5610.

  2. Bouck N and Di Mayorca G. . 1979 Methods Enzymol. 58: 296–302.

  3. Broer S, Broer A and Hamprecht B. . 1995 Biochem. J. 312: 863–870.

  4. Cooper GM, Okenquist S and Silverman L. . 1980 Nature 284: 418–421.

  5. Dixon WT, Sikora LK, Demetrick DJ and Jerry LM. . 1990 Int. J. Cancer 45: 59–68.

  6. Dong S and Hughes RC. . 1996 FEBS Lett. 395: 165–169.

  7. Downward J, Yarden Y, Mayes E, Scrace G, Totty N. Stockwell P, Ullrich A, Schlessinger J and Waterfield MD. . 1984 Nature 307: 521–527.

  8. Fenczik CA, Sethi T, Ramos JW, Hughes PE and Ginsberg MH. . 1997 Nature 390: 81–85.

  9. Hara K, Kudoh H, Enomoto T, Hashimoto Y and Masuko T. . 1999 Biochem. Biophys. Res. Commun. 262: 720–725.

  10. Hashimoto Y, Masuko T, Yagita H, Endo N, Kanazawa J and Tazawa J. . 1983 Jpn. J. Cancer. Res. 74: 819–821.

  11. Haynes BF, Hemler ME, Mann DL, Eisenbarth GS, Shelhamer J, Mostowski HS, Thomas CA, Strominger JL and Fauci AS. . 1981 J. Immunol. 126: 1409–1414.

  12. Hughes PE, Renshaw MW, Pfaff M, Forsyth J, Keivens VM, Schwartz MA and Ginsberg MH. . 1997 Cell 88: 521–530.

  13. Kamma H, Endo K, Horiguchi H, Iijima T and Ogata T. . 1989 Cancer Res. 49: 5118–5122.

  14. Kanai Y, Segawa H, Miyamoto K, Uchino H, Takeda E and Endou H. . 1998 J. Biol. Chem. 273: 23629–23632.

  15. Khosravi-Far R, Solski PA, Clark GJ, Kinch MS and Der CJ. . 1995 Mol. Cell. Biol. 15: 6443–6453.

  16. Krous MH, Popescu NC, Amsbaugh SC and King CR. . 1987 EMBO J. 6: 605–610.

  17. Lumadue JA, Glick AB and Ruddle FH. . 1987 Proc. Natl. Acad. Sci. USA 84: 9204–9208.

  18. Mannion BA, Kolesnikova TV, Lin SH, Wang S, Thompson NL and Hemler ME. . 1998 J. Biol. Chem. 273: 33127–33129.

  19. Mastroberardino L, Spindler B, Pfeiffer R, Skelly PJ, Loffing J, Shoemaker CB and Verrey F. . 1998 Nature 395: 288–291.

  20. Masuko T, Abe J, Yagita H and Hashimoto Y. . 1985 Jpn. J. Cancer. Res. 76: 386–394.

  21. Michalak M, Quackenbush EJ and Letarte M. . 1986 J. Biol. Chem. 261: 92–95.

  22. Martin GS. . 1986 Cancer Surv. 5: 199–219.

  23. Macleod CL, Finley KD and Kakuda DK. . 1994 J. Exp. Biol. 196: 109–121.

  24. Nakamura E, Sato M, Yang H, Miyagawa F, Harasaki M, Tomita K, Matsuoka S, Noma A, Iwai K and Minato N. . 1999 J. Biol. Chem. 274: 3009–3016.

  25. Nishikawa R, Ji XD, Harmon RC, Lazar CS, Gill GN, Cavenee WK and Huang HJ. . 1994 Proc. Natl. Acad. Sci. USA 91: 7727–7731.

  26. Ohgimoto S, Tabata N, Suga S, Nishio M, Ohta H, Tsurudome M, Komada H, Kawano M, Watanabe N and Ito Y. . 1995 J. Immunol. 155: 3585–3592.

  27. Parmacek MS, Karpinski BA, Gottesdiener KM, Thompson CB and Leiden JM. . 1989 Nucleic Acids. Res. 17: 1915–1931.

  28. Patterson JA, Eisinger M, Haynes BF, Berger CL and Edelson RL. . 1984 J. Invest. Dermatol. 83: 210–213.

  29. Pfeiffer R, Rossier G, Spindler B, Meier C, Kuhn L and Verrey F. . 1999 EMBO J. 18: 49–57.

  30. Pineda M, Fernandez E, Torrents D, Estevez R, Lopez C, Camps M, Lloberas J, Zorzano A and Palacin M. . 1999 J. Biol. Chem. 274: 19738–19744.

  31. Plowman GD, Culouscou JM, Whitney GS, Green JM, Carlton GW, Foy L, Neubauer MG and Shoyab M. . 1993 Proc. Natl. Acad. Sci. USA. 90: 1746–1750.

  32. Posillico JT, Srikanta S, Eisenbarth G, Quaranta V, Kajiji S and Brown EM. . 1987 J. Clin. Endocrinol. Metab. 64: 43–50.

  33. Qiu RG, Chen J, Kirn D, McCormick F and Symons M. . 1995 Nature 374: 457–459.

  34. Quackenbush EJ, Gougos A, Baumal R and Letarte M. . 1986 J. Immunol. 136: 118–124.

  35. Quackenbush E, Clabby M, Gottesdiener KM, Barbosa J, Jones NH, Strominger JL, Speck S and Leiden JM. . 1987 [published erratum appears in Proc. Natl. Acad. Sci. USA, 1987 Dec;84(23):8618]. Proc. Natl. Acad. Sci. USA 84: 6526–6530.

    CAS  Article  Google Scholar 

  36. Radeva G, Petrocelli T, Behrend E, Leung-Hagesteijn C, Filmus J, Slingerland J and Dedhar S. . 1997 J. Biol. Chem. 272: 13937–13944.

  37. Rajan DP, Kekuda R, Haung W, Wang H, Devoe LD, Leibach FH, Prasad PD and Ganapathy V. . 1999 J. Biol. Chem. 274: 29005–29010.

  38. Rossier G, Meier C, Bauch C, Summa V, Sordat B, Verrey F and Kuhn LC. . 1999 J. Biol. Chem. 274: 34948–34954.

  39. Sang J, Lim YP. Panzica M, Finch P and Thompson NL. . 1995 Cancer Res. 55: 1152–1159.

  40. Sanger F, Nicklen S and Coulson AR. . 1977 Proc. Natl. Acad. Sci. USA 74: 5463–5467.

  41. Sato H, Tamba M, Ishii T and Bannai S. . 1999 J. Biol. Chem. 274: 11455–11458.

  42. Schwartz MA, Toksoz D and Khosravi-Far R. . 1996 EMBO J. 15: 6525–6530.

  43. Schwartz MA. . 1997 J. Cell. Biol. 139: 575–578.

  44. Shin S. . 1979 Methods Enzymol. 58: 370–379.

  45. Shishidho T, Uno S, Kamohara M, Suzuki-Tsuneoka T, Hashimoto Y, Enomoto T and Masuko T. . 2000 Int. J. Cancer 87: 311–316.

  46. Tanaka T, Masuko T and Hashimoto Y. . 1988 J. Biochem. 103: 644–649.

  47. Tanaka T, Suzuki S, Masuko T and Hashimoto Y. . 1989 Jpn. J. Cancer Res. 80: 380–386.

  48. Teixeira S, Di Grandi S and Kuhn LC. . 1987 J. Biol. Chem. 262: 9574–9580.

  49. Tsurudome M, Ito M, Takebayashi S, Okumura K, Nishio M, Kawano M, Kusagawa S, Komada H and Ito Y. . 1999 J. Immunol. 162: 2462–2466.

  50. Wells RG, Lee WS, Kanai Y, Leiden JM and Hediger MA. . 1992 J. Biol. Chem. 267: 15285–15288.

  51. Warren AP, Patel K, McConkey DJ and Palacios R. . 1996 Blood 87: 3676–3687.

  52. Yagita H, Masuko T and Hashimoto Y. . 1986a Cancer Res. 46: 1478–1484.

  53. Yagita H, Masuko T, Takahashi N and Hashimoto Y. . 1986b J. Immunol. 136: 2055–2061.

  54. Yagita H and Hashimoto Y. . 1986 J. Immunol. 136: 2062–2068.

  55. Yamazaki H, Fukui Y, Ueyama Y, Tamaoki N, Kawamoto T, Taniguchi S and Shibuya M. . 1988 Mol. Cell. Biol. 8: 1816–1820.

Download references

Acknowledgements

This work was supported in part by a Grant-in-Aids for Scientific Research on Priority Areas (Cancer) from the Ministry of Education, Science, Sports and Culture of Japan.

Author information

Affiliations

Authors

Corresponding author

Correspondence to Takashi Masuko.

Rights and permissions

Reprints and Permissions

About this article

Cite this article

Hara, K., Kudoh, H., Enomoto, T. et al. Enhanced tumorigenicity caused by truncation of the extracellular domain of GP125/CD98 heavy chain. Oncogene 19, 6209–6215 (2000). https://doi.org/10.1038/sj.onc.1204019

Download citation

Keywords

  • CD98
  • transfectant
  • extracellular domain

Further reading

Search

Quick links