Original Paper

Oncogene (2003) 22, 6785–6793. doi:10.1038/sj.onc.1206792

Phosphorylation of Bim-EL by Erk1/2 on serine 69 promotes its degradation via the proteasome pathway and regulates its proapoptotic function

Frederic Luciano1, Arnaud Jacquel1, Pascal Colosetti1, Magali Herrant1, Sebastien Cagnol2, Gilles Pages2 and Patrick Auberger1

  1. 1INSERM Unit 526, LNC Label, Faculté de Médecine, 28 Avenue de Valombrose, 06107 Nice Cedex 02, France
  2. 2UMR CNRS 6547, Centre Antoine Lacassagne, Avenue de valombrose, 06100 Nice Cedex 02, France

Correspondence: P Auberger, E-mail: auberger@unice.fr

Received 10 April 2003; Revised 19 May 2003; Accepted 19 May 2003.

Top

Abstract

Bim is a proapoptotic member of the Bcl-2 family that shares only the BH3 domain with this family. Three Bim proteins Bim-EL, Bim-L and Bim-S are synthesized from the same transcript. We report here that Bim-EL when phosphorylated by Erk1/2 is rapidly degraded via the proteasome pathway. Using different cellular models we evidence that serine 69 is both necessary and sufficient for Erk1/2-mediated phosphorylation and degradation of Bim-EL. In K562 cells, Phorbol 12-myristate 13-acetate activates Erk1/2 and consequently increases Bim-EL phosphorylation and degradation by the proteasome, resulting in cell survival, while the Bcr-Abl inhibitor imatinib abrogates Bim-EL phosphorylation and degradation and induces caspase activation and apoptosis. We also show that Bim-EL(S69G) promotes apoptosis more efficiently than Bim-EL-WT in K562 cells. Altogether, our findings demonstrate that phosphorylation of Bim-EL by Erk1/2 on serine 69 selectively leads to its proteasomal degradation and therefore represents a new and important mechanism of Bim regulation.

Keywords:

Bim, Erk1/2, proteasome, apoptosis

Top

Introduction

Members of the Bcl-2 protein family are essential regulators of apoptosis (Cory and Adams, 2002). The antiapoptotic members such as Bcl-2, Bcl-XL, Bcl-W, Mcl-1, A-1, Boo, Bcl-B and C. elegans CED-9 share 3–4 homology domains called the BH region. The proapoptotic members fall into two subgroups, one with 2–3 BH domains including Bax, Bak, Bok, Bcl-Xs and Bcl-G and the other with a unique BH3 domain and comprising Bad, Bik, Blk, Hrk, Bid, Bim, Noxa, Puma, Bmf and C. elegans EGL-1. Increasing evidence suggests that the BH3-only proteins are key protagonists of apoptosis (Puthalakath and Strasser, 2002). Thus, it is now well accepted that proapoptotic members of the Bcl-2 family are mandatory for the initiation of apoptosis, otherwise regulated by their antiapoptotic counterparts.

In this regard, deletion of Bim, for example, led to striking defects such as accumulation of lymphoid and myeloid cells, perturbation of T-cell development and autoimmune kidney disease (Bouillet et al., 1999, 2002). The Bim-/-lymphocytes are resistant to certain apoptotic stimuli including cytokine deprivation, but remain sensitive to other apoptotic stimuli such as glucocorticoids or DNA damage. Moreover, Bim-/-lymphocytes also exhibited normal Fas-dependent apoptosis.

Bim expression and function is regulated at both the transcriptional and post-translational levels. Transcriptional control of Bim is a relatively complex process. Three Bim proteins, namely Bim-EL, Bim-L and Bim-S, are synthesized from the same transcript (O'Connor et al., 1998), Bim-EL being preponderant. Growth factor deprivation augments Bim expression in neuronal and hematopoietic cell types (Putcha et al., 2001). It has been notably reported that IL-3 stimulation of hematopoietic cell lines represses Bim expression through the Erk pathway (Shinjyo et al., 2001).

Post-translational control is a frequent mechanism of regulation in Bcl-2 family members. Bim is regulated by sequestration to cytoskeletal structure inside the cells. In nonapoptotic cells, Bim-EL and Bim-L are thus sequestered to the microtubular dynein motor complex through direct interaction with the dynein light chain LC8 (Puthalakath et al., 1999). Bim-S does not bind to LC8, a situation that may explain the proposed greatest killing potency of Bim-S compared to Bim-EL and Bim-L. Certain stress conditions cause release of Bim-EL and Bim-L from the dynein motor complex, enabling them to bind Bcl-2 or its homologs.

One important mechanism by which the activity of proapoptotic BH3 only members is regulated is phosphorylation. In this line, in cells stimulated by growth factors, Bad is phosphorylated at several serine residues and this allows its sequestration in the cytoplasm by binding to the 14.3.3 chaperon protein (Zha et al., 1996). Phosphorylation of two residues, serine 112 and 136, depends on several kinases, including AKT, RSK PKA or Raf-1 (Datta et al., 1997; Bonni et al., 1999; Bertolotto et al., 2000). However, untill recently, no evidence of Bim phosphorylation had been reported. Two recent studies however have suggested that Bim could be regulated by phosphorylation (Shinjyo et al., 2001; Biswas and Greene, 2002). In this line, Biswas and Greene reported that nerve growth factor downregulates Bim protein and suppresses its proapoptotic activity by phosphorylation. In this study, Erk1/2 was proposed as a likely candidate for Bim phosphorylation but no direct evidence of Erk1/2-mediated Bim phosphorylation was found (Biswas and Greene, 2002).

In the present study, using different cellular model systems, we report that phosphorylation of Bim-EL by Erk1/2 on serine 69 is necessary and sufficient to promote its rapid degradation by the proteasome and to protect cells from apoptosis. Thus, phosphorylation of Bim by Erk1/2 on serine 69 represents a new mechanism whereby cells may repress apoptosis.

Top

Results

Phosphorylation of Bim-EL by the RAF/MEK/Erk pathway in different cellular models

As shown in Figure 1a exposure of Ramos B cells to an anti-IgM induced a rapid mobility shift of Bim-EL so that the totality of the protein migrated more slowly at 15 min. This mobility shift was detected as soon as 30 s, was maximal at 15–60 min, and then declined to basal levels after 6 h. The amount of Bim-EL was however several fold lower after 6–24 h than in untreated cells. Of note, anti-IgM-induced Bim-EL shift was found to parallel the phosphorylation of Erk1/2 consecutive to B-cell receptor triggering by the anti-IgM (Figure 1a). Bim-EL expression first decreased after 3 h of IgM stimulation, then increased after 6–24 h, remaining however several fold lower than in untreated cells. Interestingly, the rise of Bim-EL expression detected at 6–24 h, which likely represents resynthesis of Bim-EL, correlated with induction of apoptosis after 15–24 h, as judged by PARP cleavage (Figure 1a).

Figure 1.
Figure 1 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Phosphorylation of Bim-EL in different cell lines and primary cells. (a) Ramos cells (4 times 106) were incubated for different times at 37°C with 10 mug/ml goat anti-IgM. (b) Ramos cells (4 times 106) were incubated for 1h at 37°C with either 10 mug/ml goat anti-IgM or 10 ng/ml of PMA in the presence or absence of 2 muM GF109203X and 10 muM Uo126 (30 min of preincubation). (c) Freshly isolated thymocytes and splenocytes were incubated for 15 min at 37°C with 10 ng/ml of PMA in the presence or absence of 10 muM Uo126 (30 min of preincubation). Cells were then lysed and proteins separated by electrophoresis on 11% polyacrylamide gels. Proteins were blotted on to PVDF membranes that were incubated with either anti-Bim, anti-phospho Erk1/2 or anti-PARP antibodies

Full figure and legend (81K)

One possible explanation for the results presented in Figure 1 could be that Bim-EL is regulated by phosphorylation in accordance with two very recent reports (Shinjyo et al., 2001; Biswas and Greene, 2002). Incubation of Ramos cells with either anti-IgM or the phorbol ester PMA, two conditions that efficiently activate the Erk1/2 pathway, led to Bim-EL mobility shift (Figure 1b). Phorbol 12-myristate 13-acetate (PMA)-mediated mobility shift was abrogated by the PKC inhibitor GF109203X, but was only slightly inhibited by the specific MEK inhibitor Uo126. By contrast, anti-IgM-mediated Bim-EL shift was abrogated by Uo126, but poorly affected by GFX treatment (Figure 1b). Here again, modulation of Erk1/2 correlated with the Bim-EL-induced mobility shift (Figure 1b). In summary, our results, as a whole, show that Bim-EL is rapidly phosphorylated by Erk1/2 in anti-IgM- or PMA-stimulated Ramos B cells.

Finally, Bim-EL phosphorylation was detected in several other cellular models such as the T lymphoblastic leukemia cell line, Jurkat and the chronic myelogenous leukemia cell line K562 (not shown). Phosphorylation was also confirmed in murine immune primary cells. Indeed, when thymocytes or splenocytes were incubated with PMA in order to induce Erk1/2 phosphorylation and activation, phosphorylation of Bim-EL was detected 5 min following PMA addition, an effect abrogated by Uo126. As in the Ramos B cell line, Bim-EL phosphorylation paralleled Erk1/2 phosphorylation suggesting also the implication of this pathway in Bim-EL phosphorylation in murine thymocytes and splenocytes (Figure 1c).

To decipher the signaling pathway involved in Bim-EL phosphorylation, we next used 293 fibroblasts expressing a conditionally active, OHT-inducible form of Raf/ER. Treatment of these cells with low concentrations of tamoxifen induces robust Erk1/2 and Bim-EL phosphorylations (Figure 2). Uo126 abrogated both Erk1/2 and Bim-EL phosphorylation, while GFX, SB203102 (a JNK and P38MAPK inhibitor) and Ly294002 (a PI3 kinase inhibitor) had no effect. When 293 cells were stimulated with PMA independently of Raf:ER, we also observed a rapid phosphorylation of Erk1/2 and Bim-EL (Figure 2). PMA effect on Erk1/2 and Bim-EL was abolished by GFX, but only partly affected by Uo126. These results indicate that (i) the RAF/MEK/Erk pathway regulated Bim-EL phosphorylation in Raf/ER cells and (ii) Bim-EL phosphorylation upon PMA treatment is only partly dependent on Erk1/2 activity. In summary, our results show that Bim-EL is consistently phosphorylated by the Erk1/2 pathway in various cellular models and under different stimuli.

Figure 2.
Figure 2 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Phosphorylation of Bim-EL in RAF/ER 293 cells is strictly dependent on Erk1/2. 293 RAF/ER cells were incubated for 1h at 37°C with 1 muM of tamoxifen or 10 ng/ml of PMA in either the presence or absence of 10 muM Uo126, 2 muM GF109203X, 2 muM SB203580 and 5 muM LY294002 (30 min of preincubation). Cells were then lysed and proteins separated by electrophoresis on 11% polyacrylamide gels. Proteins were blotted on to PVDF membranes that were incubated with either anti-Bim, anti-phospho Erk1/2 or anti-Hsp60 antibodies

Full figure and legend (75K)

Serine 69 of Bim-EL is the Erk1/2 major phosphorylation site

While focusing our attention on Bim-EL phosphorylation, we also observed that Bim-L and to a lesser extent Bim-S were also subjected to a moderate increase in mobility shift (not shown). As shown in Figure 3a, Bim-EL shares two potential sites for phosphorylation by Erk1/2. One of them, serine 69 located in a PASP consensus sequence, is present only in Bim-EL, while the second one, serine 120 in a TPS sequence, is shared by both Bim-EL and Bim-L. It is also worth mentioning that no evident Erk1/2 phosphorylation site is present in Bim-S (Figure 3a).

Figure 3.
Figure 3 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Identification of the Erk phosphorylation site on Bim-EL. (a) Structure of the different Bim isoforms. (b) Identical amounts of WT GST-Bim-EL, GST-Bim-EL(S69G), GST-Bim-EL(S120G), GST-ElK1 (positive control) and GST-C (negative control) proteins were incubated with recombinant active Erk2. The phosphorylation of each recombinant protein was analysed by autoradiography after SDS–PAGE. Coomassie blue staining is shown as a loading control

Full figure and legend (118K)

To identify the potential Erk-dependent phosphorylation site(s) in Bim-EL, we generated GST-Bim-EL constructs with point mutations on the two previously mentioned serine residues. GST-Bim-EL(S69G), GST-Bim-EL(S120G) and GST-Bim-EL(S69G/S120G) proteins were subjected to in vitro phosphorylation by recombinant Erk. The same amount of each protein was used for phosphorylation experiments as assessed by Coomassie blue staining (Figure 3b). As shown in Figure 3b, wild-type (WT) GST-Bim-EL and GST-Bim-EL(S120G) proteins were identically phosphorylated by recombinant Erk, while both GST-Bim-EL(S69G) and GST-Bim-EL(S69G/S120G) proteins were not. As expected, Erk failed to phosphorylate the GST protein. As a positive control, the transcription factor Elk1, a well-identified substrate for Erk, was found to be phosphorylated to the same extent as the WT GST-Bim-EL and Bim-EL(S120G) proteins (Figure 3b).

Phosphorylation of Bim-EL on serine 69 triggers its rapid degradation by the proteasome

The proteasome pathway has been shown previously to be involved in the degradation of Bcl-2 following its phosphorylation (Breitschopf et al., 2000). This prompted us to investigate the possible participation of the proteasome in the degradation of Bim-EL. As shown in Figure 4a, induction of the Erk1/2 pathway by tamoxifen in Raf:ER 293 cells triggers phosphorylation of Bim-EL followed by its degradation (Figure 4a). By contrast, in cells preincubated with the proteasome inhibitor MG132, phosphorylation of Bim-EL occurs as well, but degradation was abolished (Figure 4a, b). Identical results were obtained with lactacystin (not shown). Taken together, our results indicate that phosphorylation of Bim-EL by Erk1/2 targets it for degradation by the proteasome pathway.

Figure 4.
Figure 4 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Effect of the proteasome inhibitor MG132 on Bim-EL degradation. 293 RAF/ER cells were incubated for different times at 37°C with 1 muM of tamoxifen or 25 muM of MG132 (1 h of preincubation). Cells were then lysed and proteins separated by electrophoresis on 11% polyacrylamide gels. Proteins were blotted onto PVDF membranes that were incubated with either anti-Bim, anti-phospho Erk1/2 or anti-Hsp60 antibodies. Hsp60 is shown as an internal control

Full figure and legend (73K)

Bim-EL is the only isoform of Bim that is proteolytically processed by the proteasome

As previously mentioned, Bim behaves as three main isoforms in human and murine cells (O'Connor et al., 1998). As serine 69 is present only in Bim-EL (Figure 3a), one should expect that Bim-L and Bim-S cannot be processed by the proteasome. To assess this possibility, constructs encoding the different forms of Bim were transiently transfected in Raf:ER fibroblasts (Figure 5a). Addition of tamoxifen for 1 h induced the characteristic phosphorylation of Bim-EL followed by its degradation at 7 h. Interestingly, neither Bim-L nor Bim-S, which did not share with Bim-EL serine 69, were significantly phosphorylated and processed in identical conditions (Figure 5a). Erk1/2 was phosphorylated to the same extent in each condition. Thus, phosphorylation of Bim on serine 69 by Erk1/2 is a unique property of Bim-EL.

Figure 5.
Figure 5 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Effect of the mutation of serine 69 and 120 on Bim-EL phosphorylation and degradation. (a) 293 Raf/ER cells were transfected with 2 mug of pEF PGKhygro vector encoding Bim-EL, Bim-L or Bim-S proteins and incubated for different times at 37°C with 1 muM of tamoxifen. (b) 293 Raf/ER cells were transfected with 2 mug of pEF PGKhygro vector encoding WT or mutant (S69G, S120G, S69/S120G) Bim-EL proteins and incubated for different times at 37°C with 1 muM of tamoxifen. Proteins were blotted on to PVDF membranes that were incubated with either anti-Bim, anti-phospho Erk1/2 or anti-Hsp60 antibodies

Full figure and legend (119K)

Mutation of serine 69 impairs proteasomal degradation of Bim-EL and increases its proapoptotic potential

If phosphorylation on serine 69 is a prerequisite for the degradation of Bim-EL by the proteasome, Bim-EL(S69G) should be insensitive to such a degradation. When transfected into Raf/ER fibroblasts, Bim-EL(S69G) and Bim-EL(S69G/S120G) were no further degraded by the proteasome, while endogenous Bim-EL, Bim-EL-WT and Bim-EL(S120G) were identically processed (Figure 5b, c). In each condition, tamoxifen was found to induce a comparable activation of the Erk1/2 pathway. Taken together, our results clearly show that serine 69 is critical for Erk1/2-mediated phosphorylation and degradation of Bim-EL by the proteasome pathway.

In the search for a convenient cellular model to assess the implication of Bim-EL phosphorylation and degradation on its proapoptotic function, we found that the chronic myelogenous leukemia cell line K562 did express Bim proteins. K562 cells are known to express the chimaeric p210BCR-ABL protein and as such exhibited a constitutively activated Erk1/2 pathway. However in K562 cells, the Erk1/2 pathway can be further activated by PMA (Figure 6a). Thus, under basal conditions, Bim-EL is constitutively phosphorylated, an effect drastically increased by PMA. Also in this cell line, phosphorylation of Bim-EL was accompanied by its degradation, which was complete after 24 h in the presence of the phorbol ester (Figure 6a). Interestingly, when K562 cells were incubated with imatinib, a Bcr/Abl inhibitor and therapeutic agent, phosphorylation of Bim-EL was abolished and as a consequence degradation did not occur (Figure 6a). Moreover, lack of Bim-EL degradation upon imatinib treatment correlated well with the inhibition of Erk1/2 phosphorylation. Finally, as expected, degradation of Bim-EL was abrogated in K562 cells pretreated with MG132. Quantitative analysis of Bim-EL expression clearly shows that both imatinib and MG132 blocked Bim-EL phosphorylation and degradation, while PMA and PMA+imatinib promoted its phosphorylation and degradation (Figure 6b). Interestingly, Imatinib, which blocks Bim-EL phosphorylation and degradation, induced apoptosis of K562 cells as assessed by a caspase assay, while PMA, which, by contrast, promotes Bim-EL phosphorylation and degradation, protects cells from apoptosis (Figure 6c). Finally, when expressed in K562 cells, Bim-EL(S69G) was more efficient than WT Bim-EL to induce apoptosis as assessed by a luciferase assay (Figure 6d).

Figure 6.
Figure 6 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

Phosphorylation of Bim-EL by Erk promotes its degradation and regulates its proapoptotic potential. (a) Modulation of Bim-EL phosphorylation affects the stability of Bim-EL in K562 cells. K562 cells were incubated for different times at 37°C with 10 ng/ml of PMA and/or 25 muM of MG132 or 2 muM of STI 571 (30 min of preincubation). Proteins were blotted onto PVDF membranes that were incubated with either anti-Bim, anti-phospho Erk1/2 or Hsp60 antibodies. Hsp60 is shown as an internal control. (b) Quantitative analysis of (a). (c) Erk inhibition correlates with high levels of Bim-EL and apoptosis. Caspase activity was assessed on cell lysates prepared from cells stimulated for different times with 2 muM imatinib and/or 10 ng/ml PMA using 0.2 mM Ac-DEVD-pNa as substrate. To measure specific caspase activity, substrate hydrolysis was determined in quadruplicate at different times in the presence or absence of 10 muM Ac-DEVD-CHO. Results are expressed as nanomoles of substrate hydrolyzed per minute and per milligram of protein and represent the mean of at least three different experiments. (d) Mutation of serine 69 potentiates the proapoptotic effect of Bim-EL. K562 cells were transiently cotransfected with 5 mug of a CMV luciferase reporter plasmid and 5 mug of empty vector or 5 mug of differents Bim constructs. When indicated, cells were incubated with 2 muM imatinib immediately after transfection. Then cells were solubilized, and luciferase activity was assayed as described in the Materials and methods section. Results are expressed as fold modulation over the basal luciferase activity of untreated Bim-EL-WT

Full figure and legend (120K)

Top

Discussion

The RAF/RAS/MEK/Erk pathway has been found to promote cell survival and inhibit apoptosis (Xia et al., 1995; Meier and Evan, 1998). It is now well established that the Erk signaling pathway promotes cell survival by a dual mechanism that modulates the cell death machinary directly by phosphorylating and thereby inhibiting the proapoptotic protein Bad, and by inducing the expression of prosurvival genes. Erk is thought to activate Rsk, which catalyzes phosphorylation of Bad at serine 112 (Bonni et al., 1999). Besides this regulation by Erk1/2, Bad is also a target for phosphorylation by the PI3K/AKT pathway. Once phosphorylated by the Erk or PI3K/AKT pathways, Bad is sequestered into the cytoplasm by binding to the 14.3.3 chaperon and is therefore unable to induce apoptosis. Bad is not the only Bcl-2 family member whose phosphorylation is important for its biological function. Two Erk sites in Bcl-2, Thr74 and Ser87, appear to be crucial for Bcl-2 stability since mutation of these two sites induced its proteasome-dependent degradation (Dimmeler et al., 1999; Breitschopf et al., 2000). Thus, phosphorylation of Bcl-2 by Erk could confer a resistance to proteolytic degradation thereby increasing the antiapoptotic potential of Bcl-2.

We describe here a new mechanism for the regulation of Bim expression in which phosphorylation at serine 69 promotes its proteasomal-dependent degradation. We first evidence that Bim-EL is phosphorylated in several cell lines and primary cells upon various stimuli. Whatever the cellular model, the phosphorylation of Bim-EL seems closely correlated to Erk1/2 phosphorylation and activation.

Generation of GST-Bim constructs mutated at serine 69 or 120, two potential consensus Erk1/2 sites, allows us to identify serine 69 as the main Erk1/2 phosphorylation site in vitro. This was confirmed in Raf/ER-transfected 293 cells where addition of tamoxifen specifically induced Erk1/2 and Bim-EL phosphorylation. Moreover, inhibitors of MEK1 but not of other kinase pathways were also shown to abolish Bim phosphorylation in Raf/ER 293 cells.

Interestingly, phosphorylation of Bim-EL at serine 69 targets it for degradation by the proteasome-dependent pathway. Accordingly, MG132, a proteasome inhibitor, was found to inhibit Bim degradation in tamoxifen-stimulated Raf/ER 293 cells. When transfected into Raf/ER cells, Bim-EL(S69G) migrated faster than WT Bim-EL in the presence of tamoxifen indicating that serine 69 is phosphorylated by Erk1/2 in vivo. A residual phosphorylation of Bim-EL(S69G) was however detected. The later observation is in agreement with phosphorylation of Bim-EL by Erk1/2-activated downstream kinases.

Bim expression and function is regulated at the transcriptional, post-transcriptional and translational levels. At least three Bim proteins, namely Bim-EL, Bim-L and Bim-S, are synthesized from the same transcript and are expressed at different levels in animals cells, Bim-EL being preponderent. Interestingly, both Bim-L and Bim-S lack amino acids 43–101 of Bim-EL. As Bim-L and Bim-S are weakly phosphorylated in intact cells, we conclude that the 43–101 region is mainly involved in the regulation of Bim-EL phosphorylation. Accordingly, informatic analysis identifies serine 87 and 93 of Bim-EL as potential substrates for PKC and PKA. This is of interest since PMA-induced Bim-EL phosphorylation in different cell lines is only partly inhibited by the MEK1 inhibitor Uo126, suggesting that PKC-dependent phosphorylation of Bim-EL may occur in the absence of Erk activation at sites other than serine 69, such as serines 87 and 93. A good candidate, among others, for such a phosphorylation could be p90Rsk since we and others have previously reported that PKC can phosphorylate Bad on Ser112 through activation of Rsk and independently of Erk1/2 (Bonni et al., 1999; Bertolotto et al., 2000). Nevertheless, although of potential importance for Bim regulation, these sites do not appear to be involved in the degradation of Bim by the proteasome pathway.

Very recently, Biswas and Greene (2002) reported the downregulation of Bim expression following stimulation of PC12 cells by NGF. This effect appears to be mediated by an Erk1/2-dependent phosphorylation of Bim possibly at serine 109 and threonine 110 (serine 115 and threonine 116 respectively in Figure 3a). Although this study clearly shows a good correlation between Erk1/2-mediated Bim phosphorylation and expression in PC12 cells, it brings no direct evidences that Bim is indeed a substrate for Erk 'in vitro' or in intact cells or that Bim(S109G) or Bim(T110A) are no more phosphorylatable by Erk. However, one interesting finding of the study by Biswas and Greene (2002) is that Bim(S109G) and Bim(T110A) seem more effective than Bim-EL in promoting apoptosis in the presence of NGF. In agreement with this finding, we show in the present study that mutation of serine 69 of Bim-EL increases its proapoptotic potential.

The observations of Biswas and Greene (2002) and our own findings concerning the Erk1/2 phosphorylation sites may seem contradictory. However, it should be pointed out that in the study by Biswas and Greene, deletion of the 97–127 Bim-EL region did not alter NGF-induced Bim-EL phosphorylation and mobility shift. Thus, serine 109 and threonine 110 are unlikely to represent the Erk1/2 phosphorylation sites. This conclusion is in agreement with our own study, which clearly identified serine 69 as the major if not unique site for phosphorylation of Bim-EL by Erk1/2. Hence, one possible explanation for the NGF-induced decreased expression of Bim reported by Biswas and Greene would be that Bim is phosphorylated at serine 69, but not at serine 109 and threonine 110. Finally, consistent with their findings, we found that Bim-EL phosphorylation was not regulated through the PI3K/AKT pathway. Interestingly, Bcl-2, which is the major target of Bim, is also regulated via the proteasome pathway (Dimmeler et al., 1999; Breitschopf et al., 2000; Brichese et al., 2002). Of note, phosphorylation of Bcl-2 at serine 87 by Erk1/2 protects Bcl-2 from degradation by the proteasome and contributes to increased cell survival (Breitschopf et al., 2000).

We describe here a unique mechanism by which phosphorylation of Bim-EL by Erk1/2 at serine 69 leads to degradation of Bim-EL by the proteasome pathway and triggers protection against cell death. Accordingly, Weston et al. (2003) recently reported that activation of Erk1/2 pathway by DeltaRaf1-ER substantially reduced Bim-EL expression and consequently blocked apoptosis. Taken together our results and those of Weston et al. indicate that inhibition of the RAS/MEK/Erk pathway regulates Bim expression at two levels: (i) induction of Bim expression and (ii) inhibition of Bim-EL degradation.

Bim-EL and Bim-L have been shown to bind to the dynein light chain LC8. In nonapoptotic cells, Bim is sequestered to the microtubule-associated dynein complex from which it is rapidly released by proapoptotic stimuli (Puthalakath et al., 1999). It is thus tempting to speculate that Erk1/2-mediated phosphorylation of Bim-EL may regulate its association with LC8. However, this possibility seems unlikely since Bim-L can bind to the dynein light chain despite the absence of amino acids 42–101. Thus, phosphorylation of Bim-EL by Erk1/2 is not required for its association with LC8. Interestingly, in a very recent report, Lei and Davis (2003) elegantly demonstrated that phosphorylation of Bim by JNK causes its release from the dynein motor complex leading to apoptosis (Figure 7).

Figure 7.
Figure 7 - Unfortunately we are unable to provide accessible alternative text for this. If you require assistance to access this image, please contact help@nature.com or the author

A model for the regulation of Bim by phosphorylation. Phosphorylation of Bim by JNK on both threonine 118 and serine 120 induces its release from the dynein motor complex. Consequently, Bim can interact with Bcl-2 at the mitochondrial cell surface, leading to release of cytochrome c and induction of apoptosis (Lei and Davies, 2003). Phosphorylation of Bim-EL by ERK on serine 69 triggers its degradation by the proteasome pathway and promotes cell survival (present study). Interestingly, phosphorylation of Bcl-2 by Erk inhibits its degradation by the proteasome pathway (Dimmeler et al., 1999)

Full figure and legend (87K)

The results obtained in the K562 cell line are noteworthy. K562 cells have been established from a patient with chronic myelogenous leukemia and as such express the P210 BCR/ABL chimeric protein that confers them resistance to apoptosis. In these cells, the Erk1/2 pathway is constitutively activated. As expected, in this cell line, Bim-EL is phosphorylated under basal conditions, but its phosphorylation status can be further increased by PMA. In control and PMA-stimulated cells, the turnover of phospho-Bim-EL is rapid, exhibiting a half-life of less than 3 h. Inhibition of Bcr/Abl activity by imatinib resulted in the abrogation of Erk1/2 phosphorylation and to an accumulation of Bim-EL. Accumulation of Bim-EL correlated with an increase in K562 cell apoptosis showing that resistance of K562 cells to apoptosis may be linked to Bim-EL phosphorylation and degradation by the proteasome pathway.

In conclusion, our data identified the phosphorylation of the BH3 only protein Bim by the Ras/Raf/MEK/Erk cascade as a general mechanism occurring in various primary cells and cell lines under different stimuli. Interestingly, phosphorylation of Bim-EL at Ser69 targets its for degradation by the proteasome pathway. Phosphorylation of Bcl-2 by the Erk pathway has been previously shown to protect it from proteosomal degradation and to promote cell survival (Figure 7). Our study provides an additional and somewhat unique mechanism whereby Erk may also promote cell survival via the proteasome-dependent degradation and inactivation of the BH3 only member of the Bcl-2 family, Bim.

Top

Experimental procedures

Reagents and antibodies

PMA, tamoxifen, sodium fluoride, sodium orthovanadate, phenylmethylsulfonyl fluoride, aprotinin and leupeptin were purchased from Sigma. RPMI, DMEM and fetal calf serum (FCS) were from Life Technologies, Inc. U0126, SB203580, LY294002 and GF109203X were purchased from Calbiochem (France). MG132 was from Alexis Biochemicals. Imatinib was provided by Novartis Pharma, Basel, Switzerland. Mouse anti-human IgM was from Jackson Immuno Research. Hsp60 antibodies were purchased from Santa Cruz Biotechnology, anti-phospho-Erk1/2 and BIM-BOD antibodies was purchased from Sigma and anti-PARP antibody was from Biomol. Peroxidase-conjugated, anti-mouse and anti-goat antibodies were from Dakopatts and anti-rabbit antibody from Cell Signaling Technology. Recombinant active Erk2 was purchased from New England BioLabs.

Cells

The human B lymphoma cell line Ramos (EBV-) has been described elsewhere (Luciano et al., 2001). It was grown at 37°C under 5% CO2 in RPMI 1640 medium supplemented with 10% FCS, 50 muM beta-mercaptoethanol and 100 Ug/ml penicillin/streptomycin and chronic myelogenous leukemia cells K562 were grown at 37°C under 5% CO2 in RPMI 1640 medium supplemented with 5% FCS and 100 mug/ml penicillin/streptomycin. 293 RAF/ER cells are a derivative of 293 cells that stably expressed a fusion protein comprised of the catalytic domain of Raf-1 and the hormone binding domain of the estrogen receptor. These cells were cultivated in Dulbecco's modified Eagle's medium (Gibco BRL) without phenol red containing 10% FCS, 100 Ug/ml penicillin/streptomycin and G418 (300 mug/ml). Freshly prepared thymocytes and splenocytes from 12 weeks old mice were plated in RPMI 1640 medium supplemented with 10% FCS at 37°C under 5% CO2 as previously described (Pages et al., 1999).

Plasmid constructs and site-directed mutagenesis

Bim-EL, Bim-L and Bim-S cDNA cloned into pEF PGKhygro vector were a generous gift of Drs David Huang and Andrea Strasser, Melbourne. The different point mutations of the MAPK consensus phosphorylation sites of BimEL were obtained using a QuickChange Site-directed mutagenesis supplied by Stratagene. Two mutations were introduced that replace serine 69 and 120 by glycines. The primers (MWG) used were for Bim-EL(S69G): sense 5' CCACCGGCCGGCCCTGGCCC 3', antisense 5' GGGCCAGGGCCGGCCGGTGG 3'; and for Bim-EL(S118G) sense 5' CAAACCCCAGG-TCCTCCTTGT 3', antisense 5' ACAAGGAGGACCT-GGGGTTTG 3'. Mutations were verified by sequencing.

To generate Bim-GST fusion proteins, Bim-EL-WT, Bim-EL(S69G), Bim-EL(S120G) and Bim-EL(S69/S120G) cDNA were excised from the pEF PGKhygro vector and introduced in the pGEX-6P1 vector (Amersham Pharmacia Biotech) within EcoRI/BamHI sites. GST fusion proteins were produced in the bacterial strains BL21 and were purified as described before (Smith and Johnson, 1988).

Transfection and luciferase assays

Bim-EL-WT, Bim-EL(S69G), Bim-EL(S120G), Bim-EL(S69/S120G), Bim-L and Bim-S were transiently expressed in 293 RAF/ER cells by using the calcium phosphate technique. After 48 h, cells were lysed in buffer B. A total of 150 mug of proteins was electrophoresed on an 11% polyacrylamide gel and blotted to a PVDF membrane. For luciferase assays, K562 cells were transiently cotransfected by electroporation with a pCMV luciferase plasmid (5 mug) and the different Bim-EL constructs (5 mug). Four million K562 cells were resuspended in 500 mul of RPMI and placed in a 0.4 cm gap cuvette with 10 mug of total plasmid DNA. Electroporation was performed with a simple electric shock (250 V, 960 muF) using an electroporator (BTX ECM 830, centronics). Each 4 million cells were separated into three wells and cells were incubated directly after transfection with or 2 muM Imatinib for 20 h. Then soluble extracts (20 mul) were harvested in 50 mul of lysis reporter buffer (Promega) and assayed in triplicate for luciferase activity. Luciferase activity was normalized by protein amount.

Kinase assay

The assay was performed in kinase buffer (20 mM Tris, pH 7.5, 10 mM p-nitrophenyl phosphate, 10 mM MgCl2, 2 mM dithiothreitol) with 30 U of recombinant active p42 MAPK/Erk2, 5 mug of the different GST/BimEL or GST/ELK-1 fusion proteins and 5 muCi of 50 muM [gamma-32P]ATP for 30 min at 30°C. The reaction was stopped by addition of Laemmli sample buffer and resolved on SDS–PAGE.

Western blot assays

Cells were incubated with different effectors for the times indicated in the figure legends, and then lysed in buffer B containing 50 mM Hepes (pH 7.4), 150 mM NaCl, 20 mM EDTA, 100 muM NaF, 10 mM Na3VO4, 1 mM phenylmethylsulfonyl fluoride, 1 mM leupeptin, 20 mug/ml aprotinin and 1% Triton X-100. Proteins (100 mug) were separated on 8–12% polyacrylamide gel and transferred to the PVDF membrane (Immobilon, Millipore) (Ricci et al., 2001a; Luciano et al., 2002). After blocking nonspecific binding sites, the membranes were incubated with specific antibodies. The membranes were washed three times with TNA-1% NP40 (Tris 50 mM, NaCl 150 mM, pH 7.5) and incubated further with horseradish peroxidase-conjugated antibody for 60 min at room temperature. Immunoblots were revealed by autoradiography using the enhanced chemiluminescence detection kit (Amersham).

Caspase activity measurement

Each assay (in triplicate) was performed with 100 mug of protein prepared from K562 cells incubated 24 h in the presence of either 10 ng/ml of PMA, 2 muM imatinib or the combination of both effectors as decribed previously (Ricci et al., 2001b). Briefly, cellular extracts were incubated in a 96-well plate, with 0.2 mM of Ac-DEVD-pNA as substrate for various times at 37°C. Caspase activity was measured at 410 nm in the presence or absence of 10 muM of Ac-DEVD-CHO. The specific caspase activity was expressed in nmoles of paranitroaniline released per min and per mg of protein.

Top

References

  1. Bertolotto C, Maulon L, Filippa N, Baier G and Auberger P. (2000). J. Biol. Chem., 275, 37246–37250. | Article | PubMed | ISI | ChemPort |
  2. Biswas SC and Greene LA. (2002). J. Biol. Chem., 277, 49511–49516. | Article | PubMed | ISI | ChemPort |
  3. Bonni A, Brunet A, West AE, Datta SR, Takasu MA and Greenberg ME. (1999). Science, 286, 1358–1362. | Article | PubMed | ISI | ChemPort |
  4. Bouillet P, Metcalf D, Huang DC, Tarlinton DM, Kay TW, Kontgen F, Adams JM and Strasser A. (1999). Science, 286, 1735–1738. | Article | PubMed | ISI | ChemPort |
  5. Bouillet P, Purton JF, Godfrey DI, Zhang LC, Coultas L, Puthalakath H, Pellegrini M, Cory S, Adams JM and Strasser A. (2002). Nature, 415, 922–926. | Article | PubMed | ISI | ChemPort |
  6. Breitschopf K, Haendeler J, Malchow P, Zeiher AM and Dimmeler S. (2000). Mol. Cell. Biol., 20, 1886–1896. | Article | PubMed | ISI | ChemPort |
  7. Brichese L, Barboule N, Heliez C and Valette A. (2002). Exp. Cell. Res., 278, 101–111. | Article | PubMed | ChemPort |
  8. Cory S and Adams JM. (2002). Nat. Rev. Cancer, 2, 647–656. | Article | PubMed | ISI | ChemPort |
  9. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y and Greenberg ME. (1997). Cell, 91, 231–241. | Article | PubMed | ISI | ChemPort |
  10. Dimmeler S, Breitschopf K, Haendeler J and Zeiher AM. (1999). J. Exp. Med., 189, 1815–1822. | Article | PubMed | ISI | ChemPort |
  11. Lei K and Davis RJ. (2003). Proc. Natl. Acad. Sci. USA, 100, 2432–2437. | Article | PubMed | ChemPort |
  12. Luciano F, Ricci JE and Auberger P. (2001). Oncogene, 20, 4935–4941. | Article | PubMed | ISI | ChemPort |
  13. Luciano F, Ricci JE, Herrant M, Bertolotto C, Mari B, Cousin JL and Auberger P. (2002). Leukemia, 16, 700–707. | Article | PubMed | ISI | ChemPort |
  14. Meier P and Evan G. (1998). Cell, 95, 295–298. | PubMed | ISI | ChemPort |
  15. O'Connor L, Strasser A, O'Reilly LA, Hausmann G, Adams JM, Cory S and Huang DC. (1998). EMBO J., 17, 384–395. | Article | PubMed | ISI | ChemPort |
  16. Pages G, Guerin S, Grall D, Bonino F, Smith A, Anjuere F, Auberger P and Pouyssegur J. (1999). Science, 286, 1374–1377. | Article | PubMed | ISI | ChemPort |
  17. Putcha GV, Moulder KL, Golden JP, Bouillet P, Adams JA, Strasser A and Johnson EM. (2001). Neuron, 29, 615–628. | Article | PubMed | ISI | ChemPort |
  18. Puthalakath H, Huang DC, O'Reilly LA, King SM and Strasser A. (1999). Mol. Cell, 3, 287–296. | Article | PubMed | ISI | ChemPort |
  19. Puthalakath H and Strasser A. (2002). Cell Death Differ., 9, 505–512. | Article | PubMed | ISI | ChemPort |
  20. Ricci JE, Lang V, Luciano F, Belhacene N, Giordanengo V, Michel F, Bismuth G and Auberger P. (2001a). Faseb J., 15, 1777–1779. | PubMed | ChemPort |
  21. Ricci JE, Maulon L, Battaglione-Hofman V, Bertolotto C, Luciano F, Mari B, Hofman P and Auberger P. (2001b). Eur. Cytokine Netw., 12, 126–134. | PubMed | ISI | ChemPort |
  22. Shinjyo T, Kuribara R, Inukai T, Hosoi H, Kinoshita T, Miyajima A, Houghton PJ, Look AT, Ozawa K and Inaba T. (2001). Mol. Cell. Biol., 21, 854–864. | Article | PubMed | ISI | ChemPort |
  23. Smith DB and Johnson KS. (1988). Gene, 67, 31–40. | Article | PubMed | ISI | ChemPort |
  24. Weston CR, Balmanno K, Chalmers C, Hadfield K, Molton SA, Ley R, Wagner EF and Cook SJ. (2003). Oncogene, 22, 1281–1293. | Article | PubMed | ISI | ChemPort |
  25. Xia Z, Dickens M, Raingeaud J, Davis RJ and Greenberg ME. (1995). Science, 270, 1326. | Article | PubMed | ISI | ChemPort |
  26. Zha J, Harada H, Yang E, Jockel J and Korsmeyer SJ. (1996). Cell, 87, 619–628. | Article | PubMed | ISI | ChemPort |
Top

Acknowledgements

This work was supported by INSERM, The Ligue Nationale contre le Cancer (LNC, Equipe labellisée). We are undebted to Dr David Huang and Dr Andreas Strasser (WEHI, Melbourne, Australia) for the kind gift of Bim constructs. FL is a fellowship from the LNC.

Extra navigation

.

naturejobs

ADVERTISEMENT