Nature Genetics
28, 216 - 217 (2001)
doi:10.1038/90046
Sox9 induces testis development in XX transgenic miceValerie P.I. Vidal1, 4, Marie-Christine Chaboissier1, 4, Dirk G. de Rooij2
& Andreas Schedl1, 31 MDC for Molecular Medicine, Robert-Rössle-Strasse 10, 13092 Berlin, Germany. 2 Department of Cell Biology, University Medical Center Utrecht, Utrecht, Netherlands. 3 Present address: Institute of Human Genetics, University of Newcastle upon Tyne, UK. 4 These authors contributed equally to this work.
Correspondence should be addressed to Andreas Schedl andreas.schedl@ncl.ac.ukMutations in SOX9 are associated with male-to-female sex reversal in humans1,
2. To analyze Sox9 function during sex determination, we ectopically expressed this gene in XX gonads. Here, we show that Sox9 is sufficient to induce testis formation in mice, indicating that it can substitute for the sex-determining gene Sry.
Sex determination in mice is initiated at embryonic day 10.5 (E10.5) with expression of the Y chromosome-linked gene Sry (ref. 3). One of the first genes induced in male gonads after Sry expression is the Sry homolog Sox9 (refs. 4,5). The DNA-binding domains of both proteins are highly conserved and can functionally substitute for each other6. SOX9/Sox9 is required for expression of the Mullerian inhibiting substance (MIS/Mis; refs. 7,8), but additional functions during sex determination remain elusive.
To clarify the role of Sox9 during sex determination, we ectopically expressed it in undifferentiated gonads of transgenic mice. The mouse gene Sox9 (including introns) is expressed under control of regulatory regions of the Wilms' tumor suppressor gene Wt1, which is expressed at E10.5 in the urogenital ridge of both XX and XY animals. Because regulatory regions of Wt1 are poorly characterized, we used a yeast artificial chromosome (YAC) 'knock-in' approach9, in which Sox9 was fused with the start codon of the Wt1 locus encoded by a 620-kilobase mouse YAC (ref. 10; Fig. 1a) and used the resulting construct to generate transgenic animals11.
 | | Figure 1. Construct design and analysis of transgenic animals. |  |  |  | a, Schematic of the transgene. The Sox9 genomic locus (exons and introns) was fused in-frame with the major ATG of Wt1 and introduced into the YAC620mWt1 by homologous recombination in yeast. E1, exon 1; IVS-pA, intervening sequence fused to polyadenylation signal; LYS2, lysine 2 yeast marker; 5'UTR, 5' untranslated region. b, Molecular analysis of transgenic animals and comparison with their phenotypes. Wt1-Sox9, a region overlapping the Wt1 promoter and Sox9 open reading frame, was amplified by PCR to identify transgenic animals (primers sWTp 5'−CATCCGAGCCGCACCTCATG−3', SS2 5'−GCTGGAGCCGTTGACGCG). Zfy/Pax6, the Y chromosome-linked Zfy, was amplified by PCR (oligonucleotides ZFY5 5'−GACTAGACATGTCTTAACATCTGTCC−3' and ZFY3 5'−CCTATTGCATGGACTGCAGCTTATG−3'); as an internal control, oligonucleotides specific for Pax6 (H499 5'−CTTTCTCCAGAGCCTCAATCTG−3' and H500 5'−GCAACAGGAAGGAGGGGGAGA−3') were added. F0, founders; F1, offspring of founder 92.
Full Figure and legend (12K) |
|  | Two XX animals showed a female-to-male sex reversal and were infertile. Moreover, founder 92, a fertile XY male, transmitted the transgene to its offspring (Fig. 1b). All XX transgenic animals (21/21) were phenotypically male (Fig. 2a−d) and had normal mounting behavior.
 | | Figure 2. Analysis of gonads in wildtype and transgenic animals. |  |  |  | a−d, Urogenital systems of 2-day-old animals. In contrast with wildtype females (c), XX mice carrying the transgene (d) have descended testes (arrow). B, bladder; T, testis, O, ovary, K, kidney; A, adrenal. Whole-mount in situ hybridization with anti-sense Sox9 (e−h) and Mis (i−l) probes demonstrate a male-specific expression pattern in sex-reversed animals. m−p, Histological analysis of adult gonads (2- m sections; hematoxylin and eosin staining). Testes of sex-reversed animals (p) contain Sertoli and Leydig cells but lack germ cells because of the presence of two X chromosomes.
Full Figure and legend (105K) |
|  | In situ hybridization and reverse transcription polymerase chain reaction (PCR) analysis from E10.5 to adulthood demonstrate expression of Sox9 from the transgene in the developing gonads (Fig. 2e−h; data not shown). Expression of Mis at E13.5 (data not shown) and E16.5 (Fig. 2i−l) is seen within the developing sex cords. Moreover, male reproductive ducts develop normally, which indicates the presence of functional Sertoli cells. The slightly less organized pattern of the seminiferous tubules is probably caused by ectopic expression of Sox9 driven by the Wt1 promoter.
At E13.5, the testes of XX transgenic animals are histologically indistinguishable from those of XY wildtype littermates. Adult testes contain seminiferous tubules showing a lumen lined by apparently normal Sertoli cells (Fig. 2m−p). Many Leydig cells are present in the interstitial tissue. As expected from a male with two X chromosomes, germ cells are absent12, which explains the reduced testis size.
A mouse line with a transgene inserted 1 Mb upstream of Sox9 shows a comparable female-to-male sex-reversed phenotype13. Sox9 is expressed in XX gonads, but it is impossible to conclude whether the expression of Sox9 triggers the sex reversal or whether Sox9 is activated as part of the sex determination cascade. Our data clearly demonstrate that Sox9 is sufficient to induce male development and indicate that it can substitute for Sry function. Hence, the duplication of the region containing SOX9, as found in a sex-reversed human14, may be caused by ectopic activation of the duplicated SOX9 in XX gonads. Therefore, SRY may act only as a molecular switch15 to activate the evolutionarily more conserved SOX9, which in turn initiates the male differentiation program.
Received 20 March 2001; Accepted 25 May 2001
REFERENCES
- Wagner, T. et al. Cell 79, 1111−1120 (1994). | Article | PubMed | ISI | ChemPort |
- Foster, J.W. et al. Nature 372, 525−530 (1994). | Article | PubMed | ISI | ChemPort |
- Swain, A. & Lovell Badge, R. Genes Dev. 13, 755−767 (1999). | PubMed | ISI | ChemPort |
- Morais da Silva, S. et al. Nature Genet. 14, 62−68 (1996). | Article | PubMed | ChemPort |
- Kent, J., Wheatley, S.C., Andrews, J.E., Sinclair, A.H. & Koopman, P. Development 122, 2813−2822 (1996). | PubMed | ISI | ChemPort |
- Bergstrom, D.E., Young, M., Albrecht, K.H. & Eicher, E.M. Genesis. 28, 111−124 (2000). | Article | PubMed | ISI | ChemPort |
- De Santa Barbara, P. et al. Mol. Cell Biol. 18, 6653−6665 (1998). | PubMed | ChemPort |
- Arango, N.A., Lovell-Badge, R. & Behringer, R.R. Cell 99, 409−419 (1999). | Article | PubMed | ISI | ChemPort |
- Moore, A.W. et al. Mech. Dev. 79, 169−184 (1998). | Article | PubMed | ISI | ChemPort |
- Scholz, H. et al. J. Biol. Chem. 272, 32836−32846 (1997). | Article | PubMed | ISI | ChemPort |
- Schedl, A., Montoliu, L., Kelsey, G. & Schutz, G. Nature 362, 258−261 (1993). | Article | PubMed | ISI | ChemPort |
- Hunt, P.A. et al. Mol. Reprod. Dev. 49, 101−111 (1998). | Article | PubMed | ISI | ChemPort |
- Bishop, C.E. et al. Nature Genet. 26, 490−494 (2000). | Article | PubMed | ISI | ChemPort |
- Huang, B., Wang, S., Ning, Y., Lamb, A.N. & Bartley, J. Am. J. Med. Genet. 87, 349−353 (1999). | Article | PubMed | ISI | ChemPort |
- Pask, A. & Graves, J.A. Cell Mol. Life Sci. 55, 864−875 (1999). | Article | PubMed | ISI | ChemPort |
Acknowledgments We thank U. Ziegler, S. Schmidt, S. Lützkendorf and D. Landrock for excellent technical assistance. This work was supported by the Volkswagen Stiftung and EC-grant QLRT00741.
|