|
|
|
| October 2001, Volume 15, Number 10, Pages 1495-1504 |
| Table of contents Previous Article Next [PDF] |
 |
| Original Manuscript |
| A new recurrent and specific cryptic translocation, t(5;14)(q35;q32), is associated with expression of the Hox11L2 gene in T acute lymphoblastic leukemia |
 |
| O A Bernard1, M Busson-LeConiat1, P Ballerini2, M Mauchauffé1, V Della Valle1, R Monni1, F Nguyen Khac1, T Mercher1, V Penard-Lacronique1, P Pasturaud3, L Gressin3, R Heilig4, M-T Daniel5, M Lessard6 and R Berger1 |
 |
1U434 INSERM-CEPH and SD401 No. 434 CNRS, Paris, France
2Service d'Hématologie Biologique, Hôpital Trousseau, Paris, France
3CEPH, Paris, France
4Génoscope, Evry, France
5Laboratoire Central d'Hématologie, Hôpital Saint-Louis, Paris, France
6Laboratoire d'Hématologie, Hôpitaux Universitaires de Strasbourg, France
|
 |
Correspondence to: R Berger, U434 INSERM-CEPH, 27 rue Juliette Dodu, 75010 Paris, France; Fax: 331 53 72 51 92
|
 |
| Abstract |
 | FISH identified a cryptic t(5;14)(q35;q32) in T acute lymphoblastic leukemia (ALL), whereas it was not observed in B ALL samples. This translocation is present in five out of 23 (22%) children and adolescents with T ALL tested. RanBP17, a gene coding for a member of the importin protein family, and Hox11Like2, an orphan homeobox gene were mapped close to the chromosome 5 breakpoints and CTIP2, which is highly expressed during normal T cell differentiation, was localized in the vicinity of the chromosome 14 breakpoints. The Hox11L2 gene was found to be transcriptionally activated as a result of the translocation, probably under the influence of CTIP2 transcriptional regulation elements. These data establish the t(5;14)(q35;q32) as a major abnormality, and Hox11 family member activation as an important pathway in T ALL leukemogenesis. Leukemia (2001) 15, 1495-1504. |
 |
| Keywords |
 | T ALL; FISH; t(5;14); CTIP2; Hox11L2 |
 |  |
Introduction
T cell acute lymphoblastic leukemia (T ALL) is associated with a normal karyotype in 25 to 40% of patients, a higher percentage than in B cell lineage ALL.1,2,3,4 Fluorescence in situ hybridization (FISH) techniques have improved the detection of subtle chromosome abnormalities, allowing the identification of the B ALL specific t(12;21)(p13;q22),5 but spectral karyotype analysis of T ALL samples did not uncover new recurrent chromosomal abnormalities.6 Since abnormalities of chromosome 14, most of them affecting the TCR genes, are common in T ALL, we searched for abnormalities of this chromosome in patients with T ALL using FISH techniques. We now report the identification and characterization of a previously undescribed recurrent chromosomal translocation.
|
 Materials and methods
Patients
Thirty patients with T ALL, previously cytogenetically examined in Hôpital Saint-Louis, Paris, were selected on the basis of cell pellet availability and prepared for cytogenetic studies. There were 16 children between 3 and 14 years of age, seven adolescents (15 and 17 years) and seven adults (18-37 years) (Tables 1 and 2). As controls, 10 children with B cell lineage ALL were also examined. Patients 6 to 8, identified as carrying the t(5;14) in the Laboratoire d'Hématologie (Strasbourg, France), are reported elsewhere (Hélias et al., submitted for publication).
Cytogenetic studies
Cytogenetic studies were performed in patients examined in Hôpital Saint-Louis on bone marrow and/or blood cells after short-term culture for 17 and 24 h. In addition, PHA-stimulated blood samples were also examined after 72 h in vitro culture in three patients. RHG banding techniques were applied in every case, including the three patients from Strasbourg. Karyotypes are summarized in Tables 1, 2 and 3.
Fluorescence in situ hybridization (FISH)
FISH analyses were carried out with the usual techniques.5 In addition to whole chromosomes 5 and 14 painting probes (from INSERM U301 and Appligene Oncor, respectively), YACs (CEPH library) located to 5q34-q35 were used as probes in FISH studies on metaphases of leukemic samples. BAC clones, chosen after consultation of the human chromosome 5 map, were then used in FISH experiments in order to refine the localization of the breakpoints on chromosome 5 (Figure 1a). To locate the breakpoints on chromosome 14 a series of probes covering the IGH locus to 14q32 (BAC 158A2, gift from S Romana (Hôpital Necker, Paris, France), and Cos a1+a2, gift of European Concerted Action, Marseille, France), the TCL1 locus (BACs 1090N10 and 164H13) and the AKT1 locus (BAC 940A3) was used first. Other BAC clones were selected from available chromosome 14 maps or isolated upon PCR screening of the CEPH library and used to locate the breakpoints on chromosome 14 (Figure 1b). To delineate more precisely the localization of the rearrangements, selected BAC clones were hybridized to metaphases of patients with t(5;14).
Molecular studies
Enough frozen material was available for extensive molecular studies for patients 3 and 4. RNA was extracted using cesium chloride method or Rnable reagent (Eurobio, Les Ullis, France) and analyzed according to standard protocols. PCR with primers A+B and C+D (see below) were performed to isolated two probes corresponding to the 3' untranslated region of Hox11L2. Anchored PCR was performed as described using oligodT priming and 5-59 and 5-60 for the first and second PCR, respectively.
Bispecific RT-PCR experiments were performed starting from random-primed cDNA. The specificity of the amplified fragments was checked by direct nucleotide sequencing. Primer used are as follows: 5-61: gcgaattcTGGTA GATCTGGGTGAAGATG; 5-35: CCAGTCAAACAGCA TGGTGT; 5-59 (AATGACCTTTCTGTTGGTTA); 5-60 (gcgaattcAAAACCACACGAGTGAACAC; nucleotides in lowercase letters were added for cloning purposes); Hox11L2F: GCGCATCGGCCACCCCTACCAGA; Hox11L2R: CCGCTCC GCCTCCCGCTCCTC; A: AGGTGGGCGGCGGGCAGAGTCC; B: GCCGGGGGTCGCCGAGCATTAT; C: AGGCCGTCCCCA GGTCAAATCCAC; D: CAGTCCCGCAGCCCGCATAGAACG.
Computer analysis was performed locally or at the NCBI site (http://www.ncbi.nlm.nih.gov). Accession numbers for the BAC clones appear on the Figures. Others are as follows: NM 018014 (human BCL11A/CITP1), NM 016707 (mouse Evi9), AF186018 (CTIP1), NM 022898 (human BCL11B/CTIP2), NM 021399 (mouse CTIP2), AB043584 (human Rit alpha), AB043551 (mouse Rit alpha), CAA08834 (human Hox11), NP 068701 (mouse Hox11) AAC23900 (chicken Hox11), AAG14453 (xenopus Hox11), NP 001525 (human Hox11L1), Q61663 (mouse Hox11L1), XP 003705 (human Hox11L2), NP 064300 (mouse Hox11L2), AAC23901 (chicken Hox11L2), AAG14452 (xenopus Hox11L2).
|
 Results
FISH analysis using chromosome 14 painting probe was performed in a first step on the 30 patients with T ALL who were previously cytogenetically examined in our laboratory. In five of them (Tables 2 and 4) a translocation t(5;14), undetected with banding technique alone, was observed. A chromosome 5 painting probe was used to confirm the reciprocal t(5;14) in these patients. The t(5;14) was not detected in 10 children with B type ALL.
Breakpoint on chromosome 5
YAC clones mapped to the long arm of chromosome 5 were used in FISH experiments on patient samples. Out of several YACs tested, split signals (hybridization signals on normal 5, rearranged 5 and 14) were observed using three YACs probes, 885A6, 874C6, and 912B5, in patient 1. The first two YACs generated signals of apparently similar intensity on both derivative chromosomes, whereas YAC 912B5 consistently generated a smaller signal on the derivative 5 than on derivative 14. Splitting of YAC 885A6 was observed in the five already identified patients (1 to 5), but neither in the 25 other T ALL patients, nor in the 10 B ALL samples of this series. Using this YAC, split signal was also observed in patients 6 to 8. In patient 8, two rearranged chromosomes 5 were present while normal chromosome 5 was lacking.
To further localize the breakpoint on chromosome 5, BACs from the chromosome 5q35 map (see Figure 1a) were used, eventually allowing the location of the breakpoints within sequences covered by BAC 45L16. This BAC generated split signals in five patients with t(5;14) (2, 4, 6 to 8). Additional BAC clones were chosen on the basis of available end sequences (2008H22, 2248N14) or isolated from the CEPH BAC library (593F7). In patient 1, splitting of the juxta telomeric BAC 2249B15 was obvious, with signals on the two chromosomes 5 and one 14. An extra signal was always observed on 10p12 in control and patient metaphases. BAC 593F7 generated split signals in patients 1, 2, 4, 6 to 8. BAC 2248N14 was split in patient 4. Taken together, these results showed that the chromosome 5 breakpoints lie within a restricted area of chromosome 5 and the majority of them are clustered in the sequences between the ends of the BACs 45L16 and 2248N14, between introns 21 and 24 of the RanBP17 gene (see below). Due to the shortage of material, two patients (3 and 5) could not be extensively analyzed by FISH.
Breakpoints on chromosome 14
To delineate the interval containing the breakpoints on 14q32, molecular probes encompassing the IGH, TCL1, and AKT1 loci were used at first. The FISH experiments demonstrated that the chromosome 14 breakpoints were located between the AKT1 (centromeric) and TCL1 (telomeric) loci, without evidence of direct involvement of these two genes. In order to narrow the localization of the breakpoint, BAC clones selected from the chromosome 14 map were used as FISH probes on t(5;14) bearing cells. The results are summarized in Figure 1b. No single BAC was found to encompass all the breakpoints. BAC 68I8 generated split signal in patient 2, BAC 1082A3 gave split signal in patients 6 and 8, while BACs 1127D7 and 3104H21 were split in patients 1 and 4, respectively. In patient 7, the breakpoint was located within BAC 2576L4 (Figure 1b). Thus, the chromosome 14 breakpoints of the seven patients tested are interspersed in a 700 kb area of chromosome 14 sequences.
Molecular studies
In order to identify a candidate gene involved in the t(5;14), we identified and mapped transcribed sequences with respect to the chromosome 14 genomic sequences surrounding the breakpoints. Extensive blast analysis did not allow the identification of known genes or reliable EST clusters within this chromosomal region. At the telomeric end of the breakpoint region, clone 3104H21 was found to contain transcribed sequences corresponding to the recently described CTIP2/hRIT/BCL11B gene (see Ref. 7 and Materials and methods). Comparison of cDNA and genomic sequences allowed us to sketch the structure of the human CTIP2 gene (Figure 2a) which is similar to the one of CTIP1/Evi9 gene.7,8 CTIP2 possesses at least three exons, a large 3' exon on BAC 3104H21 and two exons lying further telomeric on BAC 889B13. Importantly, CTIP2 is oriented 5' telomere-3' centromere, and apparently ends at nucleotide 223219 of BAC 3104H21. The murine COUP TF-interacting protein 2 (CTIP2) and the related CTIP1 are Krüppel-like zinc finger proteins expressed in the brain and have been isolated because of their interaction with the chicken ovalbumin upstream promoter transcription factor (COUP-TF) subfamily of orphan nuclear receptors.7 Those receptors are generally considered to repress transcription and CTIP1 has been shown to potentiate the repression by ARP1/COUP-TFII in an acetylase independant fashion.7 Evi9 was isolated as activated by retroviral insertion in murine leukemia.8,9 The human homologous genes BCL11A for CTIP1/Evi9 and BCL11B/hRit for CTIP2 have also been isolated (see Figure 2b for a schema of the human CTIP2 protein).
To investigate the expression pattern of CTIP2 in humans, the insert of an EST (H09748), derived from the CTIP2 locus was used as a probe in Northern blot experiments. A strong signal of approximate size of 9 kb was observed in normal tissues containing T lymphocytes (thymus, peripheral blood, spleen) and in brain (Figure 2c). It is also detected in T ALL-derived samples after only 4 h exposure (Figure 2d). On RNA extracted from two t(5;14) samples (patients 3 and 4) and two T ALL samples (T1 and T2) devoid of t(5;14), the probe reacted with one or two species depending on the samples. The molecular basis of these two species remains to be determined. A larger transcript is observed in the lane corresponding to patient 4 confirming the direct involvement of the CTIP2 gene, suggested by the location of the chromosome 14 breakpoint within BAC 3104H21 (see Figure 1b). Taken together, our data suggest that human CTIP2 is highly expressed during normal and pathological T lymphoid differentiation, but do not support disregulation of this gene as an important recurrent consequence of the t(5;14).
A similar approach was undertaken to study the region around the breakpoint on chromosome 5. Interestingly, an EST cluster was found to lie within the 2249B15 sequences. This cluster turned out to correspond to the 3' end of a gene encoding a protein closely related to the RanBP16 protein and hereafter called RanBP17.10,11 Comparison between RanBP16 and RanBP17 mRNA and genomic sequences allowed us to determine the structure of the RanBP17 gene (see Figure 3a and Table 5). It turned out to be quite large, more than 200 kb lying over three BAC clones, and to encompass most of the chromosome 5 breakpoints. Expression pattern was investigated using a 1.1 kb RanBP17 cDNA probe (exons 1 to 8). As shown Figure 3b, the probe reacted with a 4 kb species in RNA extracted from several human tissues. When investigated for in human leukemic samples, RanBP17 expression was observed in some samples such as megakaryocytic leukemic cell lines (see Figure 3c).
Based on these structural data, the t(5;14) could result in the dissociation of the body of the gene from its normal 3' end. We used anchored PCR techniques to isolate potentially abnormal 3' end of RanBP17 transcripts from patient 4 RNA. Sequence analysis of cloned cDNA fragments revealed premature termination of RanBP17 transcripts, which ends in the 20th intron of the gene. No fusion cDNA containing chromosome 14 sequences was isolated. RT-PCR experiments were performed starting from patients 3 and 4 and from two T ALL control samples (T1, T2) using primers designed to detect intron 20 containing mature mRNA. Such mRNA species could easily be detected in patient 4, but not in patient 3 material nor in control samples (data not shown). RanBP17 expression was also examined by Northern blot analysis of RNA extracted from these samples, using as a probe a 1.8 kb cDNA fragment corresponding to exons 1 to 18. As shown Figure 3c, transcription of RanBP17 was not detectable in those samples. In patient 4, a low expression could be observed at a size of 2.5 kb, in agreement with the predicted size of the abnormal RanBP17 transcript in this patient. These data indicate the low level of expression of a truncated RanBP17 transcript containing intron 20 in RNA of patient 4. The lack of RanBP17 abnormal transcripts in patient 3 material suggests that disruption of this gene is not a crucial and recurrent consequence of the t(5;14).
Further analysis of the available chromosome 5 genomic sequences surrounding the breakpoint indicated the location of the Hox11L2 gene only 10 kb downstream of the 3' end of RanBP17 in a similar orientation on the chromosome. The predicted product of Hox11L2 is closely related to the Hox11 protein, whose gene is known to be rearranged in T ALL associated translocations.12,13,14,15,16 To check for Hox11L2 expression, RT-PCR experiments were performed which would amplify a 242 bp Hox11L2 cDNA fragment. As shown in Figure 4b, the expected fragment was observed in lanes corresponding to patients, 2, 3, 4 bearing t(5;14), but not from control T ALL samples or negative controls. The same results could be obtained starting with material from patients 6, 7 and 8 (data not shown). A mixture of two fragments from the 3' untranslated region of Hox11L2 was used in Northern blotting experiments, the result of which is presented Figure 4c. Small transcripts (size <2 kb) are observed in lanes corresponding to patients 3 and 4, but not in other lanes such as control leukemic samples (T1 and T2) or Jurkatt, Meg01 and HEL cell lines. Taken together our data suggest that the t(5;14) results in the ectopic activation of the Hox11L2 gene.
|
 Discussion
Rearrangements of chromosome 5 involving various breakpoint localizations have been reported in various subtypes of ALL.17 Translocation t(5;14)(q31;q32) which juxtaposes the immunoglobulin heavy chain and the IL3 genes, resulting in overexpression of the latter is among the first recurrent translocations involving 5q described in B ALL.18 The development of FISH techniques makes it easier to recognise rearrangements undetected by chromosome banding techniques alone, as exemplified by the t(12;21)(p13;q22) in childhood B ALL5 and the t(5;11)(q35;p15.5) in childhood acute myeloid leukemia (AML).19
T ALL is known to have a peculiar high frequency of 'normal karyotype'. We used a chromosome 14 specific FISH probe to analyze the status of this chromosome in patients with T ALL. We thereby uncovered a new cryptic translocation t(5;14)(q35;q32) present in both children and adolescent T ALL samples, which appears to be frequent since it was found in five out of 30 patients (16.7%) and in five of 23 (22%) in children and adolescents in our series. This translocation would be specific since it was not observed in adults with T ALL or in children with B ALL. Despite slight variations from one patient to another, the t(5;14) samples exhibited immature cortical T cell markers (CD1a). At the molecular cytogenetic level, most of the t(5;14)(q35;q32) breakpoints are clustered on band 5q35 within a single BAC clone in five out of six patients, whereas the chromosome 14 breakpoints are spread out along several hundred kilobases on band 14q32 and their localization by FISH was only possible by using several BACs. The practical consequence is that painting probes or a combination of a YAC probe for chromosome 5 and painting probe for 14 are, to date, the most efficient tools to detect the translocation. BAC probes would be used in a second step to refine the chromosomal breakpoint localization.
On 5q35, the RanBP17 gene, which lies in a 5' telomere-3' centromere orientation, is structurally altered within its 3' moiety as a result of the t(5;14). Based on its high similarity with RanBP16,10,11 RanBP17 encodes a member of the importin- superfamily of nuclear transport receptors (or karyopherins), which are involved in the transport of proteins through nuclear pores of the nucleocytoplasmic membrane (see Ref. 20 for review). It could not be unambiguously demonstrated that the rearrangement of RanBP17 is the important result of the t(5;14). It is not constantly overexpressed, as a normal or truncated species in the t(5;14) samples tested. It cannot be fused to CTIP2 to result in a hybrid gene since both genes are inversely oriented on the chromosomes and we did not find any evidence of inversion at the chromosome breakpoints. Because it is not detectably expressed in T lymphocytes, RanBP17 is unlikely to be inactivated by the translocation. In fact, the expression of RanBP17 in some human leukemic cell lines suggests that transcription of this gene during some steps of hematopoietic differentiation could favor the occurrence of the t(5;14) by opening the chromatin structure in this region of chromosome 5.
The Hox11L2 gene which lies telomeric to RanBP17 on chromosome 5 seems to be the important gene affected by the translocation. Indeed, transcription of Hox11L2 could be demonstrated in the five patients with t(5;14) studied, but not in T ALL patients' samples lacking this translocation. Interestingly, the t(5;14)(q33;q11), also observed in T ALL,21 but involving the TCR / locus on chromosome 14, has been reported to affect the RanBP17 gene on chromosome 5.10 We did not investigate such samples in our series, but it would be of interest to analyze Hox11L2 expression in these patients.
Hox 11L2, along with Hox11 and Hox11L1, belongs to a three-member family of homeobox-encoding genes which are localized outside the four homeobox genes clusters.16 The HOX11 protein has been shown to regulate transcription through site-specific DNA binding and to possess transforming properties in animal models.16,22,23,24,25 All three Hox11 family members exhibit a restricted pattern of expression, since they are expressed essentially in neural tissues during development and also in liver and pancreas of adult mice.26,27,28,29,30 The corresponding knock-out models indicated a very specific role of these proteins during normal embryogenesis. Hox11 is a central player in controlling spleen formation, perhaps through regulating cell survival,31,32 and the two other genes appear important for specific neuronal functions.33,34 Interspecies conservation of the primary sequences of these proteins is observed outside the homeobox domain suggesting common important biological functions (Figure 4d). It is noteworthy that Hox11L2 appears more closely related to Hox11 than Hox11L1. Because of their frequent and specific involvement by transcriptional activation in lymphoid leukemogenesis, the Hox11L2 and Hox11 gene products deserve further investigation.
Unexpectedly, extensive database searches did not allow the identification of a gene, in the vicinity of the majority of the chromosome 14 breakpoints. CTIP2, the closest gene, lies in a 5' telomere-3' centromere orientation, several hundred kb telomeric to the area containing most of the chromosome 14 breakpoints. The CTIP2 gene encodes a member of the zinc finger family of transcriptional regulators closely related to CTIP1, which exhibits autonomous repressive properties.7 BCL11A, the human counterpart of CTIP1, is involved in a t(2;14) translocation observed in B leukemia and lymphoma.35 Except in one instance, CTIP2 is not structurally altered as a result of the t(5;14) in our patients, as judged from its presently known structure. This gene is however expressed at very high level during T lymphoid differentiation and this expression may favor the translocation process by opening the chromatin structure of this region of chromosome 14. CTIP2 is also expected to provide strong transcriptional activator elements which induces overexpression of Hox11L2, as a result of the t(5;14). It is likely that the observed high T cell expression of CTIP2 within hematopoietic differentiation underlies the association between t(5;14) and T ALL. To date, transcriptional activation, leading to ectopic expression of a normal product, appears to be the most frequent consequence of genomic abnormalities in T ALL, whereas gene fusion leading to expression of chimeric product apparently occurs less frequently.
Characterization of 'hidden' rearrangements, whose detection was dramatically improved using FISH techniques, is a major goal of actual cytogenetics. As examplified by the TAL1 story, which was firstly isolated as rearranged by a translocation involving the TCR / locus and later shown to be frequently activated as a result of the inframicroscopic SIL-TAL1 fusion (see Ref. 36 for review), analysis of rare aberrations can be the first step toward the discovery of frequent molecular abnormalities. In addition, it should be kept in mind that other 'cryptic' rearrangements may await characterization. Finally, the description of this new cryptic translocation will lower the frequency of the so-called 'normal karyotypes' in T ALL samples. Molecular tools described here will now allow the accurate estimation of the frequency of Hox11 gene family activation in lymphoid malignancies, its specificity and potential prognostic significance.
|
 | Acknowledgements
This work was supported by INSERM and the Ligue Nationale Contre le Cancer. Thomas Mercher and Richard Monni are recipients of fellowships from the Ministère de l'Education Nationale. Florence Nguyen Khac is supported by the Académie Nationale de Médecine. We thank W Vainschenker for providing us with the M70E cell line.
|  |
| References |
 |
1 Raimondi SC, Behm FG, Roberson PK, Pui CH, Rivera GK, Murphy SB, Williams DL. Cytogenetics of childhood T-cell leukemia. Blood 1988; 72: 1560-1566, MEDLINE
2 Berger R, Le Coniat M, Vecchione D, Derre J, Chen SJ. Cytogenetic studies of 44 T-cell acute lymphoblastic leukemias. Cancer Genet Cytogenet 1990; 44: 69-75, MEDLINE
3 Berger R. Cytogenetics in adult acute lymphoblastic leukemia. Rev Clin Exp Hematol 1998; 5: 68-84,
4 Heerema NA, Sather HN, Sensel MG, Kraft P, Nachman JB, Steinherz PG, Lange BJ, Hutchinson RS, Reaman GH, Trigg ME, Arthur DC, Gaynon PS, Uckun FM. Frequency and clinical significance of cytogenetic abnormalities in pediatric T-lineage acute lymphoblastic leukemia: a report from the Children's Cancer Group. J Clin Oncol 1998; 16: 1270-1278, MEDLINE
5 Romana SP, Le Coniat M, Berger R. t(12;21): a new recurrent translocation in acute lymphoblastic leukemia. Genes Chromosomes Cancer 1994; 9: 186-191, MEDLINE
6 Rowley JD, Reshmi S, Carlson K, Roulston D. Spectral karyotype analysis of T-cell acute leukemia. Blood 1999; 93: 2038-2042, MEDLINE
7 Avram D, Fields A, Pretty On Top K, Nevrivy DJ, Ishmael JE, Leid M. Isolation of a novel family of C(2)H(2) zinc finger proteins implicated in transcriptional repression mediated by chicken ovalbumin upstream promoter transcription factor (COUP-TF) orphan nuclear receptors. J Biol Chem 2000; 275: 10315-10322, MEDLINE
8 Nakamura T, Yamazaki Y, Saiki Y, Moriyama M, Largaespada DA, Jenkins NA, Copeland NG. Evi9 encodes a novel zinc finger protein that physically interacts with BCL6, a known human B-cell proto-oncogene product. Mol Cell Biol 2000; 20: 3178-3186, MEDLINE
9 Saiki Y, Yamazaki Y, Yoshida M, Katoh O, Nakamura T. Human EVI9, a homologue of the mouse myeloid leukemia gene, is expressed in the hematopoietic progenitors and down-regulated during myeloid differentiation of HL60 cells. Genomics 2000; 70: 387-391, Article MEDLINE
10 Koch P, Bohlmann I, Schafer M, Hansen-Hagge TE, Kiyoi H, Wilda M, Hameister H, Bartram CR, Janssen JW. Identification of a novel putative Ran-binding protein and its close homologue. Biochem Biophys Res Commun 2000; 278: 241-249, MEDLINE
11 Kutay U, Hartmann E, Treichel N, Calado A, Carmo-Fonseca M, Prehn S, Kraft R, Gorlich D, Bischoff FR. Identification of two novel RanGTP-binding proteins belonging to the importin beta superfamily. J Biol Chem 2000; 275: 40163-40168, MEDLINE
12 Dube ID, Kamel-Reid S, Yuan CC, Lu M, Wu X, Corpus G, Raimondi SC, Crist WM, Carroll AJ, Minowada J et al. A novel human homeobox gene lies at the chromosome 10 breakpoint in lymphoid neoplasias with chromosomal translocation t(10;14). Blood 1991; 78: 2996-3003, MEDLINE
13 Hatano M, Roberts CW, Minden M, Crist WM, Korsmeyer SJ. Deregulation of a homeobox gene, HOX11, by the t(10;14) in T cell leukemia. Science 1991; 253: 79-82, MEDLINE
14 Kennedy MA, Gonzalez-Sarmiento R, Kees UR, Lampert F, Dear N, Boehm T, Rabbitts TH. HOX11, a homeobox-containing T-cell oncogene on human chromosome 10q24. Proc Natl Acad Sci USA 1991; 88: 8900-8904, MEDLINE
15 Lu M, Gong ZY, Shen WF, Ho AD. The tcl-3 proto-oncogene altered by chromosomal translocation in T-cell leukemia codes for a homeobox protein. Embo J 1991; 10: 2905-2910, MEDLINE
16 Dear TN, Sanchez-Garcia I, Rabbitts TH. The HOX11 gene encodes a DNA-binding nuclear transcription factor belonging to a distinct family of homeobox genes. Proc Natl Acad Sci USA 1993; 90: 4431-4435, MEDLINE
17 Mitelman F, Johansson B, Mertens F. Catalog of Chromosome Aberrations in Cancers. Wiley-Liss, New York, 1998,
18 Meeker TC, Hardy D, Willman C, Hogan T, Abrams J. Activation of the interleukin-3 gene by chromosome translocation in acute lymphocytic leukemia with eosinophilia. Blood 1990; 76: 285-289, MEDLINE
19 Jaju RJ, Haas OA, Neat M, Harbott J, Saha V, Boultwood J, Brown JM, Pirc-Danoewinata H, Krings BW, Muller U, Morris SW, Wainscoat JS, Kearney L. A new recurrent translocation, t(5;11)(q35;p15.5), associated with del(5q) in childhood acute myeloid leukemia. The UK Cancer Cytogenetics Group (UKCCG). Blood 1999; 94: 773-780, MEDLINE
20 Gorlich D, Kutay U. Transport between the cell nucleus and the cytoplasm. Annu Rev Cell Dev Biol 1999; 15: 607-660, MEDLINE
21 Whitlock JA, Raimondi SC, Harbott J, Morris SW, McCurley TL, Hansen-Hagge TE, Ludwig WD, Weimann G, Bartram CR. t(5;14)(q33-34;q11), a new recurring cytogenetic abnormality in childhood acute leukemia. Leukemia 1994; 8: 1539-1543, MEDLINE
22 Zhang N, Shen W, Ho AD, Lu M. Three distinct domains in the HOX-11 homeobox oncoprotein are required for optimal transactivation. Oncogene 1996; 13: 1781-1787, MEDLINE
23 Hawley RG, Fong AZ, Reis MD, Zhang N, Lu M, Hawley TS. Transforming function of the HOX11/TCL3 homeobox gene. Cancer Res 1997; 57: 337-345, MEDLINE
24 Hough MR, Reis MD, Singaraja R, Bryce DM, Kamel-Reid S, Dardick I, Breitman ML, Dube ID. A model for spontaneous B-lineage lymphomas in IgHmu-HOX11 transgenic mice. Proc Natl Acad Sci USA 1998; 95: 13853-13858, MEDLINE
25 Keller G, Wall C, Fong AZ, Hawley TS, Hawley RG. Overexpression of HOX11 leads to the immortalization of embryonic precursors with both primitive and definitive hematopoietic potential. Blood 1998; 92: 877-887, MEDLINE
26 Raju K, Tang S, Dube ID, Kamel-Reid S, Bryce DM, Breitman ML. Characterization and developmental expression of Tlx-1, the murine homolog of HOX11. Mech Dev 1993; 44: 51-64, MEDLINE
27 Hatano M, Iitsuka Y, Yamamoto H, Dezawa M, Yusa S, Kohno Y, Tokuhisa T. Ncx, a Hox11 related gene, is expressed in a variety of tissues derived from neural crest cells. Anat Embryol (Berl) 1997; 195: 419-425, MEDLINE
28 Logan C, Wingate RJ, McKay IJ, Lumsden A. Tlx-1 and Tlx-3 homeobox gene expression in cranial sensory ganglia and hindbrain of the chick embryo: markers of patterned connectivity. J Neurosci 1998; 18: 5389-5402, MEDLINE
29 Patterson KD, Krieg PA. Hox11-family genes XHox11 and XHox11L2 in xenopus: XHox11L2 expression is restricted to a subset of the primary sensory neurons. Dev Dyn 1999; 214: 34-43, MEDLINE
30 Uchiyama K, Otsuka R, Hanaoka K. CHox11L2, a Hox11 related gene, is expressed in the peripheral nervous system and subpopulation of the spinal cord during chick development. Neurosci Lett 1999; 273: 97-100, MEDLINE
31 Roberts CW, Shutter JR, Korsmeyer SJ. Hox11 controls the genesis of the spleen. Nature 1994; 368: 747-749, MEDLINE
32 Dear TN, Colledge WH, Carlton MB, Lavenir I, Larson T, Smith AJ, Warren AJ, Evans MJ, Sofroniew MV, Rabbitts TH. The Hox11 gene is essential for cell survival during spleen development. Development 1995; 121: 2909-2915, MEDLINE
33 Hatano M, Aoki T, Dezawa M, Yusa S, Iitsuka Y, Koseki H, Taniguchi M, Tokuhisa T. A novel pathogenesis of megacolon in Ncx/Hox11L.1 deficient mice. J Clin Invest 1997; 100: 795-801, MEDLINE
34 Shirasawa S, Arata A, Onimaru H, Roth KA, Brown GA, Horning S, Arata S, Okumura K, Sasazuki T, Korsmeyer SJ. Rnx deficiency results in congenital central hypoventilation. Nat Genet 2000; 24: 287-290, Article MEDLINE
35 Sonoki T, Satterwhite E, Willis TG, Siebert R, Nowak R, Arriola EL, Liu H, Harder L, Gesk S, Steinemann D, Oscier DG, Schelgelberger B, Tucker PW, Dyers MJS. The BCL11 gene family: deregulated expression of BCL11A in lymphoma. Blood 2000; 96: (Suppl. 1) 542a,
36 Begley CG, Green AR. The SCL gene: from case report to critical hematopoietic regulator. Blood 1999; 93: 2760-2770, MEDLINE
|
 |
| Figures |
 |
Figure 1 FISH analysis of the t(5;14) translocation. (a) Map of the chromosome 5 BAC clones used in this study. The map is derived from data obtained in Genebank (http://www.ncbi.nlm.nih.gov/) and from chromosome 5 maps (http://www-hgc.lbl.gov/). The name of the BACs and the accession number of the corresponding sequences are indicated. The arrowheads point to the BAC clones that give split signals on indicated patients' metaphases. Location and orientation of the RanBP17 and Hox11L2 genes are shown, but not to scale. Note that data are derived from unfinished BAC sequences and overlaps between those sequences are not to scale. Other BAC clones were located using BAC ends sequence data. (b) Map of the chromosome 14 BAC clones used in this study. The map is derived from data obtained in Genebank and from Genoscope (http://www.genoscope.cns.fr). The name of the BACs and the accession number of the corresponding sequences are indicated. The arrowheads point to the BAC clones that give split signals on indicated patients' metaphases. Location and orientation of the human CTIP2 gene is indicated but is not drawn to scale. |
Figure 2 Molecular analysis of the human CTIP2 gene. (a) Partial structure of the human CTIP 2 gene on chromosome 14, as deduced from comparison between human cDNA and genomic sequences. Exon sequences are in upper case letters and intron sequences are in lower case letters. The putative translational initiator condon is underlined. Predicted exons 1 and 2 are on BAC 889B13 sequences, whereas the third exon lies on the overlap between BACs 3104H21 and 2348N10. (b) Structure of the predicted human CTIP2 protein. Black boxes indicate the location of the predicted C2H2 zinc fingers. (c) Nothern blot analysis of human CTIP2 expression in normal tissues using a probe derived from the 3' untranslated sequences of the gene. This probe reacts with abundant 9 kb RNA species in thymus, spleen and peripheral blood lymphocytes (PBL). A faint signal is also detectable at 5 kb which might correspond to additional RNA species. (d) Northern blot analysis of human CTIP2 expression in malignant cell lines and patient samples. Loading is 15 g of total RNA for all samples except Meg01 and HEL, for which it was 2 g of polyA+ RNA. A short exposure time allows detection of two CTIP2 RNA species (shown by arrows) in some, but not all samples. T1 and T2 are control T ALL samples. CTIP2 expression is easily detected in Jurkatt (T ALL cell line) RNA upon longer exposure time. A larger, abnormal transcript, detected in patient 4 RNA is indicated by an arrowhead. |
Figure 3 Molecular analyses of the human RanBP17 gene. (a) Proposed structure of the human RanBP17 gene on chromosome 5 as deduced from comparison between human cDNA sequences and chromosome 5 genomic sequences. Exon sequences are in upper case letters and intronic sequences are in lower case letters. The putative translation initiator condon is underlined. (b) Northern blot analysis of RanBP17 expression in normal tissues using a cDNA probe spanning exons 1 to 8 of the gene. A 4 kb transcript is detected in some, but not all lanes and is shown by an arrow). (c) Northern blot analysis of RanBP17 expression in patient samples using a cDNA probe spanning exons 1 to 18 of the gene. A normally sized 4 kb transcript, indicated by an arrow, is detected in lanes corresponding to erythroid (HEL) and megakaryocytic cell lines (Meg01 and MO7E), but not in those corresponding to patient samples or Jurkatt. A faint smear of apparent size of 2.5 kb, is observed in the lane corresponding to patient 4 and is indicated by an asterisk. Difference in migration between Meg01 and HEL samples and the others is attributed to polyA+RNA loading instead of total RNA. (d) Nucleotide sequence of truncated RanBP17 transcript. Exon 20 sequences are underlined. Coding sequences appear in uppercase letters and non-coding sequences in lowercase letters. The underlined PolyA run is found in both cDNA fragments and intron 20 sequences. The methionine (amino acid 744 of the normal predicted RanBP17 protein), encoded by the last codon of exon 20 is indicated. |
Figure 4 Molecular analysis of the human Hox11L2 gene. (a) Partial map of the RanBP17 and Hox11L2 genes on chromosome 5. Exons appear as empty boxes. The transcribed sequences (hatched box) isolated in patient 4 and the cryptic polyadenylation site present in intron 20 are shown. The extremities of some of the BAC clones used in this study are indicated (see also Table 5). The majority (but not all) of the chromosome 5 breakpoints is predicted to lie within a restricted area, between introns 20 and 24 of RanBP17, upstream of the Hox11L2 sequences. (b) RT-PCR analysis of Hox11L2 expression in malignant samples. A specific 242 bp fragment is amplified from patients with t(5;14), but not from two control samples (T1 and T2) or Hela. A human ARNT cDNA fragment was amplified separately to ensure the integrity of the RNA samples (data not shown). -, No template. (c) Northern blot analysis of Hox11L2 expression in patient samples. A probe corresponding to the predicted 3' untranslated region of Hox11L2 (see Materials and methods) was used to probe the same membrane as Figures 2d and 3c. Note that the normal Hox11L2 transcript is not yet known. (d) Comparison of Hox11 family member proteins. The conserved regions and the homeobox domain are underlined (adapted from quoted reference). The conserved region C region encompass the pentapeptide potentially interacting with the PBX proteins. |
 |
| Tables |
 |
Table 1 Karyotypes of 25 patients with T cell ALL |
Table 2 Hematologic data of 8 patients with ALL and t(5;14) |
Table 3 Cytogenetic data of five patients with T-ALL and t(5;14) |
Table 4 Immunophenotype of five patients with T ALL and t(5;14) |
Table 5 Relationships between RanBP17 exons and BACs used |
 |
 |
 |
| Received 19 June 2001; accepted 30 June 2001 |
 |
| October 2001, Volume 15, Number 10, Pages 1495-1504 |
 |
| Table of contents Previous Article Next [PDF] |
|
|