Full Paper

Genes and Immunity (2004) 5, 444–450. doi:10.1038/sj.gene.6364113 Published online 24 June 2004

CCR5-Delta32 mutation is strongly associated with primary sclerosing cholangitis

R Eri1, J R Jonsson2, N Pandeya3, D M Purdie3, A D Clouston2, N Martin4, D Duffy4, E E Powell2,5, J Fawcett6, T H J Florin1,7 and G L Radford-Smith1,8

  1. 1Brisbane IBD Research Group, Clinical Research Centre, Royal Brisbane Hospital Research Foundation, Brisbane, Australia
  2. 2University of Queensland School of Medicine, Southern Division, Princess Alexandra Hospital, Brisbane, Australia
  3. 3Queensland Institute of Medical Research, Population and Clinical Sciences Division, Brisbane, Australia
  4. 4Queensland Institute of Medical Research, Genetic Epidemiology Unit, Brisbane, Australia
  5. 5Department of Gastroenterology and Hepatology, Princess Alexandra Hospital, Brisbane, Australia
  6. 6Queensland Liver Transplant Service, Brisbane, Brisbane, Australia
  7. 7University of Queensland Department of Medicine, Mater Health Services Adult Hospital, Brisbane, Australia
  8. 8Department of Gastroenterology, Ned Hanlon Building, Royal Brisbane and Women's Hospital, Brisbane, Australia

Correspondence: Dr G Radford-Smith, Department of Gastroenterology, Level 9A, Ned Hanlon Building, Brisbane 4029, Australia. E-mail: graham_radford-smith@health.qld.gov.au

Received 21 January 2004; Revised 5 April 2004; Accepted 5 April 2004; Published online 24 June 2004.

Top

Abstract

CCR5 plays a key role in the distribution of CD45RO+ T cells and contributes to generation of a T helper 1 immune response. CCR5-Delta32 is a 32-bp deletion associated with significant reduction in cell surface expression of the receptor. We investigated the role of CCR5-Delta32 on susceptibility to ulcerative colitis (UC), Crohn's disease (CD) and primary sclerosing cholangitis (PSC). Genotype and allelic association analyses were performed in 162 patients with UC, 131 with CD, 71 with PSC and 419 matched controls. There was a significant difference in CCR5 genotype (OR 2.27, P=0.003) between patients with sclerosing cholangitis and controls. Similarly, CCR5-Delta32 allele frequency was significantly higher in sclerosing cholangitis (17.6%) compared to controls (9.9%, OR 2.47, P=0.007) and inflammatory bowel disease patients without sclerosing cholangitis (11.3%, OR 1.9, P=0.027). There were no significant differences in CCR5 genotype or allele frequency between those with either UC or CD and controls. Genotypes with the CCR5-Delta32 variant were increased in patients with severe liver disease defined by portal hypertension and/or transplantation (45%) compared to those with mild liver disease (21%, OR 3.17, P=0.03). The CCR5-Delta32 mutation may influence disease susceptibility and severity in patients with PSC.

Keywords:

CCR5-Delta32, sclerosing cholangitis, lymphocyte trafficking

Top

Introduction

Inflammatory bowel disease (IBD) represents one of the major chronic disorders of the gastrointestinal tract in developed countries. The majority of patients are diagnosed with either ulcerative colitis (UC) or Crohn's disease (CD) and recent epidemiological studies suggest that the combined prevalence of these diseases may be as high as 0.5% of the general population.1 Both diseases are associated with episodes of acute or chronic inflammation affecting either the large bowel alone (UC) or both the small and the large bowel (CD).2 In CD, this intestinal inflammation is characterized by the presence of activated T-lymphocytes and macrophages, and disease pathogenesis is based on an inappropriate response to some commensal bacteria in a genetically susceptible host.3 In UC, the inflammatory cell infiltrate is characterized by a large number of plasma cells secreting IgG, which by binding complement contributes to tissue damage and ongoing disease.4 Within IBD, there is a subgroup of patients who develop primary sclerosing cholangitis (PSC), a chronic fibrosing liver disease characterized by progressive destruction of both intrahepatic and extrahepatic bile ducts by a combination of inflammation and fibrosis.5 A majority of PSC patients have UC (60–100%), whereas a much smaller number of UC patients develop the liver disease (2.4–7.5%) in Caucasian populations.6 Both diseases share certain autoimmune features including their close association with other autoimmune diseases and the presence of both an antineutrophil cytoplasmic antibody (ANCA) and antibody to tropomyosin.7 Other studies on the mucosal immune system in UC patients have demonstrated large numbers of IgG plasma cells and elevated interleukin-5 (IL-5) levels, properties that support a humoral or T helper (Th)2 immune response.8

The role of genetic susceptibility to CD has recently been strengthened by the successful identification of the NOD2 gene on chromosome 16 using linkage analysis and positional cloning.9, 10 In contrast, genetic studies in UC and PSC have predominantly used an association approach and focused on the HLA region on chromosome 6 and on key immunoregulatory genes including tumour necrosis factor alpha (TNF-alpha).11, 12 This may be in part due to a smaller number of affected sib-pairs in UC cohorts, a paucity of multiply affected PSC families, and the later age of presentation in PSC patients. Interest in the genetics of PSC has been recently rekindled by two association analyses investigating the relevance of the TNF-alpha and stromolysin genes in the development of this disease.12, 13 While the association with the TNF2 allele was considered secondary to the known association with the A1-B8-DRB1*0301-DQA1*0501-DQB1*0201 haplotype, the association with the stromolysin gene was thought to be an independent one that may also influence disease progression. However, the patients in this second study were not HLA typed.13

Recent interest in immunoregulatory genes has also focused on the chemokine family that are intimately involved in leucocyte trafficking and recruitment, and therefore are likely to play a crucial role in determining which cells migrate to the injured and/or inflamed bowel and liver.14, 15 Colonic epithelium shows upregulation of RANTES (regulated upon activation normal T-cell expressed and secreted), which is the natural ligand for the chemokine receptor CCR5.16 During episodes of intestinal inflammation, CCR5 is upregulated on activated Th1-type intestinal lamina propria and intraepithelial lymphocytes as well as dendritic cells, supporting a role for this chemokine in lymphocyte recruitment to the gut.17 CCR5 may also play a role in lymphocyte recruitment and immune responses within the liver. This receptor, together with CXCR3, is expressed at much higher levels on T cells isolated from the liver compared to the peripheral blood.18

A 32-bp deletion in this gene (CCR5-Delta32 mutation) results in a nonfunctioning receptor that is trapped in the endoplasmic reticulum and therefore not expressed at the cell surface.19, 20 The mutation is found in relatively high frequencies in the European population with an allele frequency of 10%.21 CCR5 is a coreceptor for the M-tropic strain of human immunodeficiency virus (HIV) and as a result CCR5-Delta32 homozygotes are afforded complete immunity from this strain, while heterozygotes show resistance to infection and a delay in the onset of acquired immunodeficiency syndrome (AIDS) compared to the wild-type counterparts.22, 23, 24, 25 In chronic inflammatory disorders, the CCR5-Delta32 mutation shows a negative association with rheumatoid arthritis,26 which in turn is associated with a predominantly Th1 immune response. In patients with multiple sclerosis, the mutation is associated with a delayed age of onset of the disease and a lower risk of recurrent clinical disease activity.27, 28 There have been six published papers on CCR5-Delta32 in IBD populations. One study found a significant association between CCR5-Delta32 homozygosity and perianal CD.29 There were no associations with disease susceptibility or other clinical features of IBD, and none of these studies included PSC patients.30, 31, 32, 33, 34 PSC patients have been included in two studies appearing in abstract form only.35, 36 No association with CCR5-Delta32 was found in the first analysis, but a significant positive association was reported in the second abstract.36 There are no phenotypic details given in either of these abstracts.

We have carried out a detailed analysis of the frequency of the CCR5-Delta32 mutation in an unselected series of IBD patients from the Brisbane IBD Research Group database at the Royal Brisbane Hospital (RBH) and a consecutive series of PSC patients from the IBD database (RBH and Mater Hospital) and the Queensland Liver Transplant Service (Princess Alexandra Hospital). The study has investigated the role of this mutation in disease susceptibility and in shaping the characteristics of both the intestinal and liver disease.

Top

Results

Patient characteristics

Details of the major clinical characteristics of each patient group are given in Table 1. There was complete clinical information for all patients with UC or CD and for 65/71 patients with PSC. Over half of the PSC patients had aggressive disease based on the need for liver transplantation (52%) and/or the presence of portal hypertension (59%). Patients with PSC were significantly older (mean age=51 years) than those with only UC (mean age=46 years) or CD (mean age=41 years) (P=0.02 and P<0.001, respectively). This was associated with a significantly longer duration of their underlying IBD (21 years (PSC) vs 14 years (UC) vs 13 years (CD), P=0.0001 and P<0.0001, respectively). As expected, the majority of PSC patients had extensive colitis,37, 38, 39 which was significantly more common in PSC-UC compared to UC alone (P=0.02). Need for immunosuppression was less common for PSC-IBD patients (P=0.02). Smoking behaviour was significantly different between patients with PSC and those with UC (P=0.0005) or CD (P=0.0004).


Allele frequencies and disease susceptibility

Genotyping for the CCR5-Delta32 mutation was successfully performed on all patients and controls. None of the patients and only two of the controls were homozygous for the mutated CCR5 gene, all other patients being either heterozygous or homozygous for the wild-type allele. There was no evidence of deviation from Hardy–Weinberg equilibrium (HWE) in patients (P>0.05 for all patient subgroups) or in controls (P=0.93). Comparison of those carrying a mutation vs wild-type individuals did not show any significant differences in age of diagnosis, disease duration, sex or smoking status. Individuals heterozygous for the CCR5-Delta32 allele were significantly more common in the PSC group (35.2%) compared to controls (19.3%, OR 2.27, P=0.003, Table 2). Similarly, the frequency of the CCR5-Delta32 allele was greater in patients with PSC (17.6%) compared to controls (9.9%, P=0.007) and patients with IBD alone (11.3%, OR 1.9, P=0.027, Table 3).



Patients with PSC but without underlying IBD (n=10, mean disease duration 15.6 years) had a similarly elevated CCR5-Delta32 heterozygous genotype frequency (50%, Table 2) and allele frequency (25%, Table 3). Those with UC alone did not show any significant differences in CCR5 genotype (OR 1.37, P=0.15, Table 2) or CCR5-Delta32 allele frequency (P=0.23, Table 3) compared to controls. Complete HLA genotyping was available for the 37 PSC transplant patients. We therefore compared the HLA allelic distribution among CCR5 wild-type individuals vs those carrying a Delta32 mutation. Distinguishing wild-type and heterozygous subjects for CCR5 did not demonstrate any significant difference in the distribution of the known PSC susceptibility alleles, HLA B8 (P=0.4), DR-2 (P=0.4), DR-3 (P=0.8) or DR-6 (P=0.3), between the two groups (data not shown).

The CCR5-Delta32 allele frequency was similar in CD patients (9.9%) to that found in controls (OR 1.16, P=0.59). Further subgroup analysis within the CD population, including age at diagnosis, disease behaviour including the presence or absence of perianal disease, need for immunosuppression and need for intestinal resection, did not reveal any association between the CCR5-Delta32 mutation and these characteristics (data not shown).

CCR5 genotype, CCR5-Delta32 allele frequency and disease characteristics

This mutation was specifically associated with disease severity in PSC with CCR5-Delta32 heterozygotes more frequent in the severe group (45%, Table 2) compared to the rest (21%, OR 3.17, P=0.03). The CCR5-Delta32 allele frequency was similarly more common in this severe group (23%) compared to the other PSC patients (10.3%, P=0.06). Analysis of CCR5 genotype based on transplantation alone showed a very similar distribution, with Delta32 significantly over-represented in transplant cases (46%) compared to nontransplant cases (24%, OR 2.76, P=0.05). There were five patients with portal hypertension who did not undergo transplantation: two because of extensive cholangiocarcinoma and three because of age and significant comorbidities. These five patients were included in the severe group for all the above analyses. In all, 10 patients with PSC developed cholangiocarcinomas and their CCR5 genotype (40%, P=0.73) and CCR5-Delta32 allele frequency (20%, P=0.99) were similar to the PSC group as a whole.

The CCR5-Delta32 allele frequency in subtotal or total UC was 11.8%, which was not significantly different from those patients with distal disease (13.2%, P=0.71, Table 3) after adjusting for confounders. Thus, the higher frequency of CCR5-Delta32 in PSC-UC was not explained by disease extent. Nor was there a significant relationship between severity of UC (as defined by colectomy or immunosuppression) and the presence of the CCR5-Delta32 allele (P>0.09). Similarly, there were no significant differences in the CCR5 genotypes carried by these subgroups of UC compared to controls. Patients with PSC had greater CCR5-Delta32 carriage rate than those with UC but this did not reach statistical significance (P=0.1) and diminished further after adjusting for potential confounders including age, disease duration, distribution and smoking status (P=0.78).

Top

Discussion

Recent studies have confirmed the association between PSC and certain HLA haplotypes, as well as suggesting a role for polymorphisms within the matrix metalloproteinase family.12, 13 This study provides evidence for an association between PSC and the chemokine receptor family, with a significantly increased frequency of CCR5-Delta32 heterozygotes (P=0.003) and a significantly higher CCR5-Delta32 allele frequency (P=0.007) in PSC patients compared to matched controls. CCR5-Delta32 was also significantly commoner in PSC compared to a large, unselected series of patients with IBD alone (P=0.027).

CCR5 represents a good candidate gene for patients with chronic liver disease in that it has an important role in the trafficking of activated mononuclear cells including CD4+ and CD8+ memory T-lymphocytes to sites of inflammation, by binding chemokines including MIP-1alpha (macrophage inflammatory protein-1alpha), MIP-1beta and RANTES.14, 15 Furthermore, CCR5 expression is preferentially associated with a Th1 subset of lymphocytes, which secrete proinflammatory cytokines including TNF-alpha and gamma-interferon.40, 41 Carriage of at least one mutated copy of the gene is associated with reduced CCR5 expression on the cell surface and may influence the strength and direction of the immune response in these individuals.19 This has been confirmed in animal studies including the CCR5 knockout mouse that develops a Th2-driven response in preference to a Th1 response, to a range of inflammatory stimuli.42 The data presented in this study support a role for the CCR5-Delta32 mutation in PSC disease susceptibility and disease severity.

The pathogenesis of PSC remains unknown. However, there are a number of studies that support a role for an aberrant immune response in the pathogenesis of the disease including the close association with organ-specific autoimmune disorders, the presence of a number of autoantibodies in these patients and the significant link with HLA class I and class II genes. Importantly, the association between PSC and some of these immune disorders is significantly stronger than their association with UC or IBD alone. This includes the links with autoimmune disorders,43 with anticolon antibodies44 and with HLA-B8 and DR03.45, 46 The potential confounding effect of HLA genotype on the association between CCR5-Delta32 and PSC was analysed in a subgroup of liver patients with severe disease and hence the strongest association with the mutation. No significant difference was found in the distribution of PSC-related HLA genotypes (HLA-B8, DR-2, DR-3 and DR-6) in CCR5-Delta32 heterozygotes compared to wild-type individuals.

The increased frequency of the CCR5-Delta32 allele that we have found in PSC patients compared to IBD alone or to controls may skew the immune response to recurrent or high levels of antigenic stimuli in the liver in a direction that favours chronic, recurrent inflammation over resolution of the inflammatory response. This may involve a switch to a Th2 response or some other mechanism. A murine model lacking CCR5 has provided a clue to the immune response associated with the CCR5-Delta32 allele. These CCR5-deficient animals showed a macrophage defect with significantly reduced levels of IL-1 and IL-6 compared to wild type, but normal levels of IL-10 and TNF-alpha. Further evidence for macrophage dysfunction was revealed by a significantly reduced hepatic clearance of Listeria infection again compared to wild-type mice. However, the CCR5-deficient mice showed increased humoral responses to T-cell-dependent antigenic challenge, a potentially interesting parallel to the humoral response in patients with PSC.47

A 'physiological' inflammatory response already exists in the portal tracts of normal liver in the form of CCR5-positive lymphocytes.18 Ligands for CCR5, including MIP-1alpha and MIP-1beta, are constitutively expressed on portal vessels, thus allowing recruitment of CCR5-positive lymphocytes to these areas as part of an immunosurveillance role. This expression may be enhanced during the development of inflammatory liver diseases such as chronic hepatitis C and alcoholic hepatitis,18, 48 and may also be increased in both acute and chronic liver allograft rejection.49 The results of the current study suggest that the immunosurveillance role played by CCR5-positive lymphocytes may be compromised under special circumstances. These may include reduced CCR5 expression, a potential increase in antigenic load within the portal vein associated with colonic inflammation and the presence of other modifying genes that push the response towards inflammation and fibrosis rather than resolution.

In this study, controls were matched for age and ethnicity from a large, community-based twin registry. In addition, the control allele frequency was consistent with previous studies from Caucasian populations.24 Importantly, the PSC cohort in this study was particularly well characterized. Relevant and detailed clinical information was available for over 90% of the patients and, specifically, the diagnosis of PSC was based on both radiological and histological records for all patients included in the study. The inclusion of a large cohort of both UC and CD patients in our study has also permitted investigation of the relationship between PSC and UC, and examination of the effects of the CCR5-Delta32 mutation on a Th1-mediated disorder, CD.

Carriage of the CCR5-Delta32 allele was greater for PSC compared to UC, and both were higher than controls. However, this only reached statistical significance for the PSC group and was specifically associated with severe liver disease indicated by the presence of portal hypertension or need for transplantation. This was further supported by the results of the phenotype–genotype analysis, with a higher CCR5-Delta32 carriage rate in severe PSC patients compared to the rest of this group (OR 3.17, P=0.03). Further analysis examining the effects of refractory or extensive UC with PSC did not demonstrate any significant association between the CCR5-Delta32 allele and the characteristics of the underlying IBD.

The strong association between CCR5-Delta32 and severe liver disease in PSC is further evidence to suggest that this disorder displays significant clinical and genetic heterogeneity. The results support recent clinical observations on the natural history of PSC and genetic studies that link certain HLA genotypes with severe, progressive disease.50, 51 Importantly, our analysis of the PSC transplant population carrying a high rate of CCR5-Delta32 indicated that any association with this mutation was independent of the HLA.51 Investigation of the CCR5-Delta32 mutation in other forms of chronic liver disease is limited to hepatitis C and patients who have undergone liver transplantation.52, 53, 54, 55 In one of three studies on hepatitis C, the CCR5-Delta32 mutation was associated with significantly less portal inflammation but greater fibrosis,52 while in the other two studies Delta32 was not associated with any specific outcomes in this population.53, 54 In contrast, analysis of CCR5-Delta32 in 146 patients undergoing liver transplantation for multiple different indications demonstrated a significant association between Delta32 and development of ischaemic-type biliary lesions postoperatively.55

The functional significance of the CCR5-Delta32 mutation has been extensively investigated both in homozygotes and heterozygotes, and in association with infectious disease and inflammatory disease outcomes. Heterozygotes demonstrate reduced CCR5 expression, which is thought to be almost exclusively related to gene dosage and not receptor sequestration.22 Nevertheless, the novel association also raises the possibility of the CCR5 gene being in linkage disequilibrium with other gene(s). Despite this possibility, the CCR5 gene remains an attractive candidate gene for PSC in view of the well-characterized functional effects of the mutation and the role of the receptor in the immune response. Reduced CCR5 expression would reduce recruitment of lymphocytes and other mononuclear cells to the liver. Patients with progressive PSC may mount an inappropriate response to certain environmental pathogens either acquired from the peripheral blood or from the gut, which is aggravated by the presence of the CCR5-Delta32 mutation.

In summary, we have found a significant association between the CCR5-Delta32 mutation and PSC, but not with either UC or CD. The results do not support a significant association with UC extent or severity but do indicate that the mutation may influence PSC progression, with a significantly stronger association seen in patients with severe liver disease compared to those with mild disease.

Top

Materials and methods

Patients and controls

In total, 162 patients with UC, 131 patients with CD and 71 patients with PSC were included in the study. The diagnosis of either UC or CD was based on standard clinical, radiological and histological criteria.56 The diagnosis of PSC relied upon typical radiological and histological appearances with all patients included in the study having at least an ERCP (endoscopic retrograde cholangiopancreatogram) or MRCP (magnetic resonance cholangiopancreatogram) and a liver biopsy.

Disease severity in UC and CD was based on the need for immunosuppression to control the disease (at least 12 continuous months of azathioprine, 6-mercaptopurine, methotrexate or mycophenolate) or failure of medical therapy requiring intestinal resection. In the PSC group, patients were divided into those with portal hypertension and/or liver transplant (severe, progressive disease) or those without either of these parameters (mild disease). The presence of portal hypertension was based on the results of both gastroscopy and abdominal contrast CT scan.

Patients with UC or CD were recruited from the Brisbane IBD database as a consecutive series. The database records the details of patients with IBD seen at the major public hospitals within Brisbane as part of a clinical research initiative. PSC patients were similarly recruited from this database and from the Queensland liver transplant service. Nontransplant patients were either from within Brisbane or referred from smaller units within Queensland to the RBH and Mater hospitals, as tertiary institutions. Transplant patients were similarly referred from within Brisbane and Queensland, with a smaller number from New Zealand. All patients included in the study were Caucasian.

In total, 419 healthy controls were obtained from samples of the Australian twin registry collected for other purposes. Only one twin from each monozygotic pair was randomly selected for the control sample and the twins were unselected for any disease phenotype. They were matched on age and ethnicity with all PSC patients and a subset of the UC and CD patients. Ethical approval was obtained from the research ethics committee of the hospital (RBH) and from the research institute where the genotyping was performed (Queensland Institute of Medical Research).

DNA extraction

Genomic DNA was extracted from EDTA-preserved whole blood using a salting out technique57 for all IBD and 50 PSC cases. DNA was extracted from formalin-fixed, paraffin-embedded tissue sections from the remaining 21 PSC patients using a previously described technique.58

Genotyping

Genomic DNA (100 ng per polymerase chain reaction (PCR)) from each individual was amplified by an allele-specific PCR technique in a total volume of 21 mul, in buffer containing 100 mM Tris-Cl, pH 8.8, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each dNTPs, 1 U Taq polymerase and 12.5 pmol of each primer. The primer sequences were as follows: sense, ATCACTTGGGTGGTGGCTGTGTTTGCGT CTC; antisense, AGTAGCAGATGACCATGACAAGCAGCGGCAG, corresponding to bases 505–535 and 667–697, respectively, of the published sequence.59 Cycling conditions were as follows: 94°C for 5 min, followed by 30 cycles of 94°C, 30 s; 70°C, 30 s with a 1 s increment per cycle, using an MJ research thermal cycler. The polymorphism was detected following electrophoresis of the products in 10% polyacrylamide gels, staining with ethidium bromide and visualization on a UV transilluminator. Allele sizes were 193 bp for normal and 161 bp for the deletion allele.

All samples were genotyped for the mutation on two separate occasions and there was complete concordance for the two sets of results when analysed by two independent observers (RE and GR-S) who were blinded to the clinical status of the patients at the time of gel analysis. In addition to the CCR5 genotyping, HLA genotypes were available for all the transplanted patients (n=37).

Statistical analysis

HWE was assessed for patients and controls by comparing the observed numbers of different genotypes with those expected under HWE for the estimated allele frequency and by comparing Pearson's goodness-of-statistic with a chi2 distribution with one degree of freedom. The crude associations between CCR5 mutation status and patient characteristics were assessed using the Pearson's chi2 statistic, along with the relevant odds ratios (and 95% confidence intervals) to quantify the size of association. Logistic regression analysis was also conducted to assess the significance of the associations between patient factors and CCR5 mutations, after adjusting for the potential confounding by age, duration of disease, location and smoking status. Odds ratios were calculated to estimate the relative risk of a particular disease class in those people who were carriers of a mutated CCR5 allele.

Top

References

  1. Montgomery SM, Morris DL, Thompson NP, Subhani J, Pounder RE, Wakefield AJ. Prevalence of inflammatory bowel disease in British 26 year olds: national longitudinal birth cohort. Br Med J 1998; 316: 1058–1059.
  2. Podolsky DK. Inflammatory bowel disease (1). N Engl J Med 1991; 325: 928–937. | PubMed | ISI | ChemPort |
  3. Shanahan F. Crohn's disease. Lancet 2002; 359: 62–69. | Article | PubMed | ISI | ChemPort |
  4. Thoree VC, Golby SJ, Boursier L et al. Related IgA1 and IgG-producing cells in blood and diseased mucosa in ulcerative colitis. Gut 2002; 51: 44–50. | Article | PubMed |
  5. Chapman RW. Aetiology and natural history of primary sclerosing cholangitis: a decade of progress? Gut 1991; 32: 1433–1435. | PubMed | ISI | ChemPort |
  6. Broome U, Olsson R, Loof L et al. Natural history and prognostic factors in 305 Swedish patients with primary sclerosing cholangitis. Gut 1990; 31: 961–963. | PubMed | ISI | ChemPort |
  7. Snook J. Are the inflammatory bowel diseases autoimmune disorders? Gut 1990; 31: 961–963. | PubMed | ISI | ChemPort |
  8. Radford-Smith GL. Ulcerative colitis—an immunological disease? Bailliers Clin Gastroenterol 1997; 11: 35–52.
  9. Hugot JP, Chamaillard M, Zouali H et al. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohn's disease. Nature 2001; 411: 599–603. | Article | PubMed | ISI | ChemPort |
  10. Ogura Y, Bonen DK, Inohara N et al. A frameshift mutation in NOD2 associated with susceptibility to Crohn's disease. Nature 2001; 411: 603–606. | Article | PubMed | ISI | ChemPort |
  11. Satsangi J, Welsh KI, Bunce M et al. Contribution of genes of the major histocompatibility complex to susceptibility and disease phenotype in inflammatory bowel disease. Lancet 1996; 347: 1212–1217. | Article | PubMed | ISI | ChemPort |
  12. Mitchell SA, Grove J, Spurkland A et al. Association of the tumour necrosis factor alpha –308 but not the interleukin 10–627 promoter polymorphism with genetic susceptibility to primary sclerosing cholangitis. Gut 2001; 49: 288–294. | Article | PubMed |
  13. Satsangi J, Chapman RW, Haldar N et al. A functional polymorphism of the stromelysin gene (MMP-3) influences susceptibility to primary sclerosing cholangitis. Gastroenterology 2001; 121: 124–130. | PubMed |
  14. Mackay CR. Chemokines: immunology's high impact factors. Nat Immunol 2001; 2: 95–101. | Article | PubMed | ISI | ChemPort |
  15. Gerard C, Rollins BJ. Chemokines and disease. Nat Immunol 2001; 2: 108–115. | Article | PubMed | ISI | ChemPort |
  16. Dwinell MB, Eckmann L, Leopard JD, Varki NM, Kagnoff MF. Chemokine receptor expression by human intestinal epithelial cells. Gastroenterology 1999; 2: 359–367.
  17. Agace WW, Roberts I, Wu L, Greinede C, Ebert EC, Parker CM. Human intestinal lamina propria and intraepithelial lymphocytes express receptors specific for chemokines induced by inflammation. Eur J Immunol 2000; 30: 819–826. | Article | PubMed | ISI | ChemPort |
  18. Shields PL, Morland CM, Salmon M, Qin S, Hubscher SG, Adams DH. Chemokine and chemokine receptor interactions provide a mechanism for selective T cell recruitment to specific liver compartments within hepatitis C-infected liver. J Immunol 1999; 163: 6236–6243. | PubMed | ISI | ChemPort |
  19. Venkatesan S, Petrovic A, Van Ryk DI, Locati M, Weissman D, Murphy PM. Reduced cell surface expression of CCR5 in CCR5Delta 32 heterozygotes is mediated by gene dosage, rather than by receptor sequestration. J Biol Chem 2001; 277: 2287–2301. | Article | PubMed |
  20. Blanpain C, Lee B, Tackoen M et al. Multiple nonfunctional alleles of CCR5 are frequent in various human populations. Blood 2000; 96: 1638–1645. | PubMed | ISI | ChemPort |
  21. Stephens JC, Reich DE, Goldstein DB et al. Dating the origin of the CCR5-Delta32 AIDS-resistance allele by the coalescence of haplotypes. Am J Hum Genet 1998; 62: 1507–1515. | Article | PubMed | ISI | ChemPort |
  22. Dean M, Carrington M, Winkler C et al. Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene. Science 1996; 273: 1856–1862. | Article | PubMed | ISI | ChemPort |
  23. Huang Y, Paxton WA, Wolinsky SM et al. The role of a mutant CCR5 allele in HIV-1 transmission and disease progression. Nat Med 1996; 3: 252–253.
  24. Zimmerman PA, Buckler-White A, Alkhatib G et al. Inherited resistance to HIV-1 conferred by an inactivating mutation in CC chemokine receptor 5: studies in populations with contrasting clinical phenotypes, defined racial background, and quantified risk. Mol Med 1997; 3: 23–36. | PubMed | ISI | ChemPort |
  25. Marmor M, Sheppard HW, Donnell D et al. Homozygous and heterozygous CCR5-Delta32 genotypes are associated with resistance to HIV infection. J Acquir Immune Defic Syndr 2001; 27: 472–481. | PubMed | ISI | ChemPort |
  26. Gomez-Reino JJ, Pablos JL, Carreira PE et al. Association of rheumatoid arthritis with a functional chemokine receptor, CCR5. Arthritis Rheum 1999; 42: 989–992. | Article | PubMed | ISI | ChemPort |
  27. Barcellos LF, Schito AM, Rimmler J et al. CC-chemokine receptor 5 polymorphism and age of onset in familial multiple sclerosis. Immunogenetics 2000; 51: 281–288. | Article | PubMed | ISI | ChemPort |
  28. Sellebjerg F, Madsen HO, Jensen CV, Jensen J, Garred P. CCR5 delta32, matrix metalloproteinase-9 and disease activity in multiple sclerosis. J Neuroimmunol 2000; 102: 98–106. | Article | PubMed | ISI | ChemPort |
  29. Rector A, Vermeire S, Thoelen I et al. Analysis of the CC chemokine receptor 5 (CCR5) delta-32 polymorphism in inflammatory bowel disease. Hum Genet 2001; 180: 190–193. | Article |
  30. Craggs A, Welfare M, Donaldson PT, Mansfield JC. The CC chemokine receptor 5 delta32 mutation is not associated with inflammatory bowel disease (IBD) in NE England. Genes Immun 2001; 2: 114–116. | Article |
  31. Martin K, Heinzlmann M, Borchers R, Mack M, Loeschke K, Folwaczny C. Delta 32 mutation of the chemokine-receptor 5 gene in inflammatory bowel disease. Clin Immunol 2001; 98: 18–22. | Article | PubMed | ISI | ChemPort |
  32. Herfarth H, Pollok-Kopp B, Goke M, Press A, Oppermann M. Polymorphism of CC chemokine receptors CCR2 and CCR5 in Crohn's disease. Immunol Lett 2001; 77: 113–117. | Article | PubMed | ISI | ChemPort |
  33. Hampe J, Lynch NJ, Daniels S et al. Fine mapping of the chromosome 3p susceptibility locus in inflammatory bowel disease. Gut 2001; 48: 191–197. | Article | PubMed | ISI | ChemPort |
  34. Paavola P, Helio T, Kiuru M et al. Genetic analysis in Finnish families with inflammatory bowel disease supports linkage to chromosome 3p21. Eur J Hum Genet 2001; 9: 328–334. | Article |
  35. Donaldson PT, Agarwal K, Saarinen S et al. Investigation of CCR5-Delta32 deletion and Fas/Apo-1 (CD95) single nucleotide polymorphisms in primary sclerosing cholangitis (PSC). Hepatology 2000; 32: 174A.
  36. Satsangi J, Simmons J, Marshall S et al. CCR5-Delta32 polymorphism in inflammatory bowel disease: further association with ulcerative colitis and with primary sclerosing cholangitis. Gastroenterology 2000; 118: A337.
  37. Fausa O, Schrumpf E, Elgjo K. Relationship of inflammatory bowel disease and primary sclerosing cholangitis. Semin Liver Dis 1991; 11: 31–39. | PubMed | ISI | ChemPort |
  38. Boberg KM, Schrumpf E, Fausa O et al. Hepatobiliary disease in ulcerative colitis. An analysis of 18 patients with hepatobiliary lesions classified as small-duct primary sclerosing cholangitis. Scand J Gastroenterol 1994; 29: 744–752. | PubMed |
  39. Sandborn WJ, Loftus Jr EV, Ahlquist DA. Association of primary sclerosing cholangitis and colorectal cancer in patients with ulcerative colitis: is it true and does it matter? Gastroenterology 1998; 115: 236–237. | PubMed |
  40. Loetscher P, Uguccioni M, Bordoli L et al. CCR5 is characteristic of Th1 lymphocytes. Nature 1998; 391: 344–345. | Article | PubMed | ISI | ChemPort |
  41. Qin S, Rottman JB, Myers P et al. The chemokine receptors CXCR3 and CCR5 mark subsets of T cells associated with certain inflammatory reactions. J Clin Invest 1998; 101: 746–754. | PubMed | ISI | ChemPort |
  42. Andres PG, Beck PL, Mizoguchi A et al. Mice with a selective deletion of the CC chemokine receptors 5 and 2 are protected from dextran sodium sulfate-mediated colitis: lack of CC chemokine receptor 5 expression results in an NK1.1+lymphocyte-associated Th2 type immune response in the intestine. J Immunol 2000; 164: 6303–6312. | PubMed | ISI | ChemPort |
  43. Saarinen S, Olerup O, Broome U. Increased frequencies of autoimmune diseases in patients with with primary sclerosing cholangitis. Am J Gastroenterol 2000; 95: 3195–3199. | PubMed |
  44. Chapman RW, Cottone M, Selby WS, Shepherd HA, Sherlock S, Jewell DP. Serum autoantibodies, ulcerative colitis and primary sclerosing cholangitis. Gut 1986; 27: 86–91. | PubMed |
  45. Schrumpf E, Gjone E. Hepatobiliary disease in ulcerative colitis. Scand J Gastroenterol 1982; 17: 961–964. | PubMed |
  46. Chapman RW, Varghese Z, Gaul R, Patel G, Kokinon N, Sherlock S. Association of primary sclerosing cholangitis with HLA-B8. Gut 1983; 24: 38–41. | PubMed |
  47. Zhou Y, Kurihara T, Ryseck RP et al. Impaired macrophage function and enhanced T cell-dependent immune response in mice lacking CCR5, the mouse homologue of the major HIV-1 coreceptor. J Immunol 1998; 160: 4018–4025. | PubMed | ISI | ChemPort |
  48. Afford SC, Fisher NC, Neil DA et al. Distinct patterns of chemokine expression are associated with leukocyte recruitment in alcoholic hepatitis and alcoholic cirrhosis. J Pathol 1998; 186: 82–89. | Article | PubMed | ISI | ChemPort |
  49. Goddard S, Williams A, Morland C et al. Differential expression of chemokines and chemokine receptors shapes the inflammatory response in rejecting human liver transplants. Transplantation 2001; 72: 1957–1967. | Article | PubMed | ISI | ChemPort |
  50. Bjornsson E, Boberg KM, Cullen S et al. Patients with small duct primary sclerosing cholangitis have a favourable long term prognosis. Gut 2002; 51: 731–735. | Article | PubMed |
  51. Boberg KM, Spurkland A, Rocca G et al. The HLA-DR3, DQ2 heterozygous genotype is associated with an accelerated progression of primary sclerosing cholangitis. Scand J Gastroenterol 2001; 36: 886–890. | Article | PubMed | ISI | ChemPort |
  52. Hellier S, Frodsham AJ, Hennig BJ et al. Association of genetic variants of the chemokine receptor CCR5 and its ligands, RANTES and MCP-2, with outcome of HCV infection. Hepatology 2003; 38: 1468–1476. | PubMed | ISI | ChemPort |
  53. Promrat K, McDermott DH, Gonzalez CM et al. Association of chemokine system polymorphisms with clinical outcomes and treatment responses of chronic hepatitis C. Gastroenterology 2003; 124: 352–360. | Article | PubMed | ChemPort |
  54. Wasmuth HE, Werth A, Mueller T et al. CC chemokine receptor 5 Delta32 polymorphism in two independent cohorts of hepatitis C virus infected patients without hemophilia. J Mol Med 2004; 82: 64–69. | Article | PubMed | ChemPort |
  55. Moench C, Uhrig A, Lohse AW, Otto G. CC chemokine receptor 5 Delta32 polymorphism—a risk factor for ischaemic-type biliary lesions following orthotopic liver transplantation. Liver Transplant 2004; 10: 434–439. | Article |
  56. Lennard-Jones JE. Classification of inflammatory bowel disease. Scand J Gastroenterol Suppl 1989; 170: 2–6. | PubMed | ChemPort |
  57. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988; 16: 1215. | Article | PubMed | ISI | ChemPort |
  58. Levi S, Urbano-Ispizua A, Gill R et al. Multiple K-ras codon 12 mutations in cholangiocarcinomas demonstrated with a sensitive polymerase chain reaction technique. Cancer Res 1991; 51: 3497–3502. | PubMed | ISI | ChemPort |
  59. Raport CJ, Gosling J, Schweickart VL, Gray PW, Charo IF. Molecular cloning and functional characterization of a novel human CC chemokine receptor (CCR5) for RANTES, MIP-1beta, and MIP-1alpha. J Biol Chem 1996; 271: 17161–17166. | Article | PubMed | ISI | ChemPort |
Top

Acknowledgements

Dr Eri was funded by a research grant from the Queensland Cancer Fund (2000–2002). The Brisbane IBD Research Group's database is supported by an educational grant from Pfizer Australia.

Top

MORE ARTICLES LIKE THIS

These links to content published by NPG are automatically generated

NEWS AND VIEWS

New susceptibility genes for ulcerative colitis

Nature Genetics News and Views (01 Jun 2008)

Primary sclerosing cholangitis The importance of treating stenoses and infections

Nature Reviews Gastroenterology & Hepatology News and Views (01 Dec 2009)

Primary sclerosing cholangitis What is the role of ursodeoxycholic acid in therapy for PSC?

Nature Reviews Gastroenterology & Hepatology News and Views (01 Feb 2010)