Introduction

Apoptosis is important for the clearance of damaged or variant cells, and alterations in apoptosis may contribute to the pathogenesis of cancer and other disorders.^1,2,3,4 Key regulators of the apoptotic pathway include pro- and antiapoptotic members of the Bcl-2 family, caspase proteases, which cleave cellular proteins, and the family of IAP proteins, which regulate the activity of activated caspases.^5,6,7 Serine/threonine protein kinases are also known to regulate apoptosis, including the phosphoinositide 3-kinase/AKT pathway,^8,9 members of the mitogen-activated protein kinase family (MAPKs),^10,11,12 and the protein kinase C (PKC) pathway.^{13,14,15,16,17}

The PKC family consists of 11 isoforms, with individual isoforms exhibiting varying substrate specificity, as well as differences in their subcellular localization and response to specific stimuli.^18,19 This argues that specific isoforms of PKC play unique roles in transducing cell signals. In support of this, both pro- and antiapoptotic isoforms of PKC have been described. For example, PKC is required for apoptosis induced by genotoxins,¹⁶ phorbol ester,²⁰ and Fas ligand,²¹ while PKC and PKC protect against apoptosis.^22,23 Accumulated evidence suggests an antiapoptotic/proproliferative function for PKC. PKC is overexpressed in a variety of tumor cells and has been suggested to play a role in the proliferation of gliomas,²⁴ liver,²⁵ and endometrial tumors.²⁶ Depletion of PKC induces apoptosis in glioblastoma multiforme cells²⁷ and in COS-7 cells.¹⁷ Two studies have explored the molecular mechanism by which PKC protects against apoptosis. Ruvolo et al.²⁸ have shown that PKC can phosphorylate Bcl-2 in vitro, and that overexpression of PKC results in increased Bcl-2 phosphorylation and suppression of apoptosis in human pre-B REH cells. Li et al.²⁹ demonstrate that in 32D cells, PKC overexpression stimulates the prosurvival protein kinase, AKT, and suppresses apoptosis following growth factor withdrawal.

Our studies have focused on understanding the contribution of specific isoforms of PKC to apoptosis in salivary epithelial cells. We have previously shown that activation of PKC by phorbol ester is sufficient to induce an apoptotic program in parotid salivary epithelial cells¹⁵ and that PKC is essential for genotoxin-induced cell death in these cells.^13,16 Here, we demonstrate that inhibition of endogenous PKC induces an apoptotic program in salivary epithelial cells. As we have previously reported for other apoptotic stimuli, induction of apoptosis under these conditions requires PKC activity, suggesting that in salivary epithelial cells PKC may function to regulate entry into the apoptotic pathway.

Results

Inhibition of endogenous PKC activity induces apoptosis

We have previously reported that both the expression and the specific activity of protein kinase C- (PKC) is increased in parotid C5 cells induced to undergo apoptosis by treatment with etoposide.¹⁶ In the present studies, we have used an inhibitory form of PKC to explore the function of endogenous PKC in the apoptotic pathway. Parotid C5 cells were transduced with increasing amounts of an adenoviral vector, which expresses a kinase inhibitory mutant of PKC (PKCKD), or with the control adenovirus, AdlacZ. Experiments were matched for relative levels of expression of PKCKD, as viral infectivity varied somewhat between experiments. As shown in Figure 1, compared to nontransduced cells (panel 1), parotid C5 cells that express PKCKD (panels 2–5) are rounded up and detached from the monolayer, characteristic of cells undergoing apoptosis. In contrast, these changes are not seen in cells that express the control adenovirus, AdLacZ (panel 6). Appearance of the apoptotic morphology is evident at 18–24 h after transduction, and maximal by 42 h after transduction, while maximal expression of PKCKD is observed at 12–18 h and remains stable throughout the course of apoptosis (data not shown). To determine if the morphologic changes in PKCKD-expressing cells are associated with the accumulation of fragmented DNA, transduced parotid C5 cells were stained with propidium iodide, and the percent sub-G1 DNA was determined by FACS analysis. As shown in Figure 2a, while there is little detectable sub-G1 DNA in untreated cells, inhibition of endogenous PKC results in a dramatic increase in sub-G1 DNA which increases in a dose-dependent manner with the amount of PKCKD expressed. Figure 2b shows quantification of sub-G1 DNA in a similar experiment. As seen here, expression of PKCKD, but not the control adenovirus, AdlacZ, resulted in a dose-dependent accumulation of sub-G1 DNA. At the highest level of PKCKD expression, nearly 50% of the cellular DNA was in the sub-G1 peak, a value similar to that observed in parotid C5 cells treated with 50 M etoposide for 18 h. As shown in Figure 6b, expression of PKCKD in parotid C5 cells likewise resulted in a dose-dependent induction of caspase-3 activity. These data indicate that inhibition of endogenous PKC induces an apoptotic program in parotid C5 cells.

Figure 1.

Inhibition of endogenous PKC induces apoptosis in parotid C5 cells. Subconfluent parotid C5 cells were transduced with PKCKD or AdlacZ (LacZ) for 42 h. The figure shows nontransduced cells (1), cells transduced with PKCKD at an MOI of 6, 12, 25, and 50 (2, 3, 4, and 5 respectively), cells transduced with AdlacZ at an MOI of 68 (6). The appearance of the cells was examined microscopically to assess the apoptotic morphology.

Full figure and legend (89K)

Figure 2.

Inhibition of endogenous PKC induces DNA fragmentation in parotid C5 cells. (a) Subconfluent parotid C5 cells were transduced with PKCKD 42 h at the MOI indicated in parentheses. Cells (adherent and floating) were collected, permeabilized with saponin and stained with propidium iodide as described in Materials and Methods. DNA content was analyzed by FACS. The sub-G1 DNA peak, marked by the double-headed arrow, indicates fragmented DNA. (b) Quantification of DNA fragmentation in parotid C5 cells expressing PKCKD or AdlacZ. Subconfluent parotid C5 cells were transduced with PKCKD or AdlacZ (LacZ) at the indicated MOI for 42 h. The graph shows quantification of sub-G1 DNA in a single experiment which is representative of three similar experiments. C=untreated cells; E=cells treated with 50 M etoposide for 18 h.

Full figure and legend (73K)

Figure 6.

Apoptosis induced by inhibition of PKC requires PKC activity. (a) Subconfluent parotid C5 cells were left untreated (1), transduced with PKCKD at an MOI of 50 (2), transduced with PKCKD at an MOI of 250 (3), or transduced with PKCKD (MOI=50) together with PKCKD (MOI=250) (4) for 42 h. The appearance of the cells was examined microscopically to assess the apoptotic morphology. (b and c) Subconfluent parotid C5 cells were transduced with PKCKD, PKCKD, or both at the indicated MOI. Sub-G1 DNA (b) and caspase-3 activity (c) were assayed as described in Materials and Methods. These experiments were repeated three or more times with similar results.

Full figure and legend (121K)

Activation of specific signal transduction pathways is well documented in cells induced to undergo apoptosis. In particular, members of the MAPK family are activated in response to stimulation with mitogenic or apoptotic agents. In some, but not all, cells, activation of the c-Jun-N-terminal kinase (JNK) pathway has been shown to be required for the apoptotic response to genotoxins and other agents. We have previously demonstrated activation of the JNK pathway, and inactivation of the MAPK pathway in parotid C5 cells induced to undergo apoptosis with etoposide¹⁶ and phorbol ester.¹⁵ Furthermore, inhibition of PKC activity blocks activation of JNK and inactivation of ERK in etoposide-treated cells, linking PKC to the regulation of these pathways.¹⁶ To determine if JNK activity is altered in parotid C5 cells induced to undergo apoptosis by expression of PKCKD, JNK activity was assayed in parotid C5 cells transduced with increasing amounts of PKCKD. As shown in Figure 3a, transduction with increasing amounts of PKCDN resulted in increased PKC protein expression. When JNK activity was assayed in the same experiment, an increase in JNK activity was observed that correlated with increased expression of PKCKD (Figure 3b). As seen here, JNK is activated up to nine-fold in cells transduced with PKCKD for 24 h. Analysis of the time course of JNK activation demonstrates an increase in JNK activity by 12 h after transduction and maximal activation by 18–24 h (data not shown). No increase in JNK activity is seen in nontransduced cells, or in cells transduced with the AdLacZ control virus. Since an increase in JNK activity could be explained by increased JNK protein expression, we determined the expression of JNK protein in cells transduced with PKCDN (Figure 3c). No change in JNK protein expression was observed, indicating that the increase in JNK activity observed is because of activation of the kinase.

Figure 3.

Inhibition of endogenous PKC results in the activation of c-terminal Jun kinase. (a) Parotid C5 cells were transduced with increasing amounts of PKCKD or AdLacZ for 24 h. U=untreated. Top: Cell lysates were prepared and assayed for PKC expression by immunoblot. Bottom: The blot was stripped and reprobed for actin to show equal protein loading. (b) JNK activity was assayed using the GST-Jun kinase assay as described in Materials and Methods. The reaction products were displayed on a 10% SDS-polyacrylamide gel. An autoradiogram of the dried gel is shown (top) with a graph that shows quantification of the assay (bottom). The data are expressed as fold activation over untreated cells and is representative of three similar experiments. (c) Cell lysates from the above experiment were analyzed for total JNK protein by immunoblot. The blot was stripped and reprobed for actin.

Full figure and legend (50K)

Inhibition of ERK activity and the reciprocal activation of JNK has been shown to correlate with the initiation of apoptosis in calphostin C-induced cell death in glioma cells,³⁰ growth factor withdrawn PC-12 cells,³¹ Fas-induced Jurkat cells,¹² and UV-irradiated fibroblasts.²³ To determine if ERK activity is altered in parotid C5 cells transduced with PKCKD, active ERK1 and ERK2 were assayed using an antiactive ERK antibody that specifically recognizes the phosphorylated (active) forms of these kinases. As shown in Figure 4, expression of PKCKD (top), but not AdLacZ, increased the abundance of phosphorylated ERK1 and ERK2 (middle), indicating an increase in the active forms of these kinases. When these blots were reprobed with an anti-ERK antibody that recognizes total ERK, an increase in both ERK 1 and ERK2 protein abundance was observed (bottom), indicating that PKCKD also increases ERK protein expression. These studies suggest that, in contrast to parotid C5 cells induced to undergo apoptosis with genotoxins,¹⁶ the JNK and ERK pathways are not inversely regulated when apoptosis is induced by inhibition of endogenous PKC.

Figure 4.

Inhibition of endogenous PKC results in an increase in ERK expression and activity. Parotid C5 cells were transduced with increasing amounts of PKCKD or AdLacZ for 24 h. Cell lysates were resolved on a 10% SDS-polyacrylamide gel and immunoblotted with anti-PKC (top panel) or anti-active ERK2 which cross-reacts with both phosphorylated ERK1 and ERK2 (middle panel). The immunoblot was stripped and reprobed with an anti-ERK antibody that recognizes total ERK1 and ERK2 (bottom panel). The positions of both ERK1 (solid arrow) and ERK2 (open arrow) are noted on the left side of each panel. These experiments were repeated three or more times with similar results.

Full figure and legend (26K)

The activation of caspase-3 and cleavage of cellular proteins is a hallmark of apoptosis induced by most stimuli.^32,33 Among the numerous caspase-3 substrates described in apoptotic cells are the PKC isoforms, PKC,³⁴ and PKC.³⁵ Caspase cleavage of PKC results in the generation of a constitutively active catalytic fragment that is sufficient to induce apoptosis when expressed in a variety of cell types. Caspase cleavage of PKC likewise results in the generation of a fragment with catalytic activity,³⁵ although the function of this fragment in apoptotic cells has not been addressed. To determine if these PKC isoforms are cleaved in parotid C5 cells undergoing apoptosis in response to inhibition of endogenous PKC, PKC and PKC protein expression was analyzed by immunoblot. As shown in Figure 5, increased expression of PKCKD (top) results in cleavage of endogenous PKC into a 40 kDa fragment identical to that seen in etoposide-treated cells (middle). Likewise, PKC is also cleaved into two fragments in cells expressing PKCKD (bottom), which appear to be identical in molecular weight to the caspase cleavage fragments produced in response to etoposide.

Figure 5.

Inhibition of endogenous PKC results in cleavage of PKC and PKC. Subconfluent parotid C5 cells were left untreated (UT), treated with 50 M etoposide for 18 h (E), or transduced with PKCKD at the indicated MOI for 42 h. Cells were harvested and PKC isoform expression was analyzed by immunoblot as described in Materials and Methods. The blot was stripped and reprobed for actin to show equal protein loading. Arrows indicate position of the molecular weight markers. This experiment was repeated three times with similar results.

Full figure and legend (37K)

Apoptosis induced by the inhibition of endogenous PKC requires PKC

PKC has been implicated as an intermediate in apoptosis induced by a variety of agents with distinct mechanisms of action. These include phorbol ester,^14,20 Fas/CD95,²¹ and etoposide.¹⁶ To ask if apoptosis induced by inhibition of PKC requires PKC activity, parotid C5 cells were transduced with PKCKD or PKCKD alone, or cotransduced with both adenoviruses. As shown in Figure 6a, transduction of PKCKD together with PKCKD (panel 1) greatly inhibits the ability of PKCKD (panel 2) to induce apoptosis as assayed by changes in cell morphology. To determine if this block in apoptosis correlates with suppression of DNA fragmentation, parotid C5 cells were transduced with either virus, both viruses, or the control virus, AdlacZ, for 42 h and the percent of sub-G1 DNA was assayed. As shown in Figure 6b, coexpression of PKCKD suppresses PKCKD-induced DNA fragmentation by about 40%. To determine if PKC is required for PKCKD-induced caspase-3 activity, caspase-3 activity was assayed in cells transduced with either virus alone or both viruses. As shown in Figure 6c, expression of PKCKD results in a dose-dependent induction of caspase-3 activity, while no increase in caspase activity was seen in cells transduced with AdlacZ. Cotransduction with PKCKD together with PKCKD however greatly suppressed the induction of caspase-3 activity by PKCKD. These data indicate that apoptosis induced by the inhibition of endogenous PKCKD proceeds through a PKC-dependent pathway.

Discussion

The role of PKC in apoptosis is controversial, with data supporting both pro- and antiapoptotic functions. In the current studies, we have examined the role of PKC, a PKC isoform associated with proliferation in many cell types.^{24,36,37,38,39} Our studies suggest that PKC is essential for the survival of salivary epithelial cells, and that in the absence of PKC activity, apoptosis is initiated. Apoptosis can be inhibited by expression of an inhibitory form of PKC, indicating that apoptosis induced under these conditions requires PKC activity. This is in agreement with previous studies from our laboratory that have demonstrated an essential role for PKC in apoptosis induced by a wide variety of agents.^13,16 Thus, PKC and PKC appear to have reciprocal functions in salivary epithelial cells, with PKC functioning as a survival factor, while PKC functions to regulate entry into the apoptotic pathway.

Our current studies indicate that inhibition of PKC by expression of a kinase negative mutant is sufficient to induce apoptosis, suggesting that PKC functions to suppress apoptosis in parotid C5 cells. We have previously reported that the expression and activity of both PKC and PKC1 increase following treatment of parotid C5 cells with etoposide.¹⁶ An increase in PKC protein abundance in etoposide-treated cells can also be shown in Figure 5. Shao et al.⁴⁰ also show that PKC is activated following induction of apoptosis by genotoxic agents in HL-60 myeloid cells. In the light of our current findings, this increase in PKC in response to genotoxins may represent a survival signal. Previous studies from our laboratory have shown that transfection of parotid C5 cells with a plasmid that expresses a kinase dead mutant of PKC did not induce apoptosis.¹⁵ The apparent discrepancy between these studies and our current observation may be owing to the higher level of expression achieved by adenoviral-facilitated expression of PKCKD (Matassa and Reyland, unpublished data). Importantly, our current findings are in line with studies from other investigators including Whelan and Parker,¹⁷ who showed that loss of PKC function induced apoptosis in COS-1 and U937 cells. In addition, specific targeting of PKC by antisense oligonucleotides or ribozymes blocks the growth of gliomas and increases apoptosis,^38,39 and inhibits the growth of lymphoma cells.⁴¹ Several studies suggest that the prosurvival function of PKC may result from direct regulation of specific components of the apoptotic machinery. Ruvolo et al.²⁵ show that activation of mitochondrial PKC results in phosphorylation of the antiapoptotic protein, Bcl-2. In these studies, overexpression of PKC correlated with increased resistance to etoposide-induced apoptosis and increased phosphorylation of Bcl-2.²⁸ Li et al.²⁹ report that overexpression of PKC activates the prosurvival function of serine–threonine kinase, Akt, and suppresses apoptosis induced by growth factor withdrawal.

Activation of the c-Jun terminal kinases (JNKs) has been shown to promote either apoptosis or survival signaling depending on the cellular context.⁴² In particular, the sustained or persistent activation of JNK has been associated with apoptosis in a number of cell types.^43,44,45 We have previously reported that in salivary epithelial cells, apoptosis induced by etoposide or TPA correlates with sustained activation of JNK.^15,46 Treatment of parotid C5 cells with etoposide resulted in the activation of JNK in 4–6 h, which was maintained throughout the time course of apoptosis,⁴⁶ while treatment of parotid cells with TPA resulted in a biphasic activation of JNKs with the later phase commencing by 4 h.¹⁵ In the current studies, we extend these observations to show that sustained activation of JNK also occurs in parotid C5 cells induced to undergo apoptosis by inhibition of PKC. Activation of JNK occurred as early as 12 h after transduction and was maximal at 18–24 h (data not shown). These studies suggest that activation of JNK is an early event in the response of salivary epithelial cells to apoptotic stimuli. This is supported by studies in JNK null MEF cells in which a marked deficiency in mitochondrial-dependent apoptosis is observed including a block in cytochrome c release, an early event in the apoptotic pathway.⁴⁷

In contrast to the JNK pathway, most studies indicate that activation of extracellular regulated kinases (ERKs) protects against apoptosis,^31,48,49 while more limited data suggest a role for ERK activation in promoting apoptosis.^50,51,52 Indeed, we have previously shown that ERK is inactivated in parotid C5 cells induced to undergo apoptosis by treatment with etoposide⁴⁶ or TPA.¹⁵ However, the data presented in the current manuscript show that apoptosis associated with PKC inhibition correlates with an increase in the expression of ERK1 and ERK2 protein as well as an increase in the abundance of the phosphorylated or activated forms of these kinases. While this may indicate that PKC normally functions to suppress ERK expression and activity in parotid C5 cells, this seems unlikely given a variety of reports which demonstrate that PKC, as well as other PKC isoforms, activate ERK.^53,54,55 A more likely explanation is that activation of ERK1/2 and its increased expression is a component of the apoptotic pathway induced by the loss of PKC activity, and does not reflect loss of a normal physiologic function of PKC. Interestingly, PKC has also been shown to be a positive regulator of ERK,^50,55,56 and expression of a dominant negative PKC construct blocked the activation of ERK in cells induced to undergo apoptosis by treatment with UV light.⁵⁰ We show that PKC is activated during apoptosis in parotid C5 cells which express PKCKD (Figure 5) and that PKCKD-induced apoptosis requires PKC activity (Figure 6); thus, activation of PKC may account for the activation of ERK under these conditions.

Our current studies clearly define distinct and opposing functions for PKC and PKC in salivary epithelial cells. Studies by Mandil et al.²⁴ suggest that these two isoforms play similar opposing roles in glioma cells. Here, we link these isoforms in the apoptotic pathway by demonstrating that apoptosis induced by PKC inhibition is dependent upon PKC activity. Similar to these other apoptotic agents, inhibition of PKC suppresses caspase activation as well as DNA fragmentation, indicating that PKC functions at an early point in the apoptotic pathway. However, expression of PKC KD does not totally block PKCKD-induced apoptosis, suggesting that apoptosis induced by inhibition of PKC may also involve an additional pathway that is independent of PKC. The requirement of PKC for apoptosis in response to diverse signals, including inhibition of endogenous PKC, suggests that PKC may function to regulate entry into the apoptotic pathway in epithelial and perhaps other cell types.

Materials and Methods

Cells and cell culture

The isolation of the salivary parotid C5 cell line has been described elsewhere.⁵⁷ Cells were cultured on Primaria 60 mm culture dishes (Falcon Plastics, Franklin Lakes, NJ, USA) in a 1 : 1 mixture of Dulbeccos modified Eagle media/Nutrient mixture F-12 (DMEM/F12) supplemented with 2.5% fetal calf serum, 5 g/ml transferrin, 1.1 M hydrocortisone, 0.1 M retinoic acid, 2.0 nM T3, 5 g/ml insulin, 80 ng/ml epidermal growth factor (Collaborative Biomedical Products, Bedford, MA, USA), 5 mM L-glutamine, 50 g/ml gentamicin sulfate, and a trace element mixture (Biofluids, Rockville, MD, USA). Tissue culture reagents were obtained from GIBCO/BRL (Gaithersburg, MD, USA) unless otherwise indicated. Etoposide was purchased from Sigma-Aldrich.

Construction of adenoviral vectors and transduction of parotid C5 cells

Generation of the wild-type and kinase dead recombinant rat PKC adenoviruses has been previously described.⁵⁸ The kinase dead mutant (K376R) has been shown to function as an isoform-specific dominant inhibitory kinase.⁵⁹ To make the kinase dead mutant of PKC (PKCKD), mutagenesis was performed using a primer that targeted the conserved lysine in the ATP-binding domain (TACGCCATCAGGATCCTGAAG) of the mouse PKC cDNA. The resulting mutant (K368R) cDNA was subcloned into the adenoviral shuttle vector, pXCMV, and recombinant adenovirus was prepared essentially as described.⁶⁰ An adenoviral vector expressing the -galactosidase gene (AdlacZ) was a generous gift of J Schaack, University of Colorado Health Sciences Center.⁶¹ Adenoviruses were titered on 293 HEK cells using a focus forming assay, which detects expression of the adenoviral protein E2.⁶²

Subconfluent parotid C5 cells were transduced with AdlacZ or PKCKD for 1 h at different multiplicites of transduction (MOIs) (6–100 focus forming units (ffu)/cell) in DMEM/F12 supplemented as described above but without the addition of serum. Following the transduction period, the virus-containing media were replaced with supplemented DMEM/F12 containing 2.5% FBS and cells were incubated for an additional 42 h.

Immunoblotting

Adherent and floating cells were collected as previously described¹⁶ and resuspended in 1 ml of JNK lysis buffer (25 mM HEPES, pH 7.5, 20 mM -glycerophosphate, 0.1 mM sodium orthovanadate, 0.1% Triton X-100, 0.3 M NaCl, 1.5 mM MgCl₂, 0.2 mM EDTA, 0.5 mM DTT, 10 mM NaF, and 4 g/ml each aprotinin and leupeptin). The lysate was allowed to sit on ice for 30 min and then clarified by spinning at 12 500 rpm for 5 min in a refrigerated Savant SRF13 K microfuge. Protein concentration was determined using a Bradford assay kit purchased from Biorad. Cell lysates (25–50 g) were resolved by 10% SDS-PAGE, transferred to an Immobilon membrane (Millipore), and immunoblotted with the desired antibody as described previously.¹⁶ Enhanced chemiluminescence (ECL; Amersham) followed by autoradiography was used to detect the signal. Antibodies to JNK, actin, and PKC were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The anti-PKC antibodies recognize an epitope in the carboxy-terminal portion of the protein. For immunoblots from cells transduced with PKCKD, the PKC and PKC antibodies were preabsorbed with four times excess of PKC blocking peptide (Santa Cruz) by shaking for 1 h at room temperature. The antiactive ERK2 antibody, which cross-reacts with both phosphorylated ERK1 and ERK2, was obtained from Promega Biotechnology (Madison, WI, USA). An anti-MAP kinase antibody, which cross-reacts with both ERK1 and ERK2, was obtained from Upstate Biotechnology (Lake Placid, NY, USA).

Measurement of caspase activity

N-acetyl-Asp-Glu-Val-Asp-p-nitroaniline (Ac-DEVD-pNA) (caspase-3) cleavage was assayed as previously described.⁴⁶

Preparation of cells for fluorescence-activated cell sorting (FACS)

The medium, containing floating cells, was removed and saved. Cells were removed from a P60 dish by the addition of 3 ml cell dispersion solution (0.25% trypsin-EDTA, 68 M EGTA, pH 7.4, 100 g/ml pronase) and incubation at 37°C for 15 min. An equal volume of trypsin inhibitor cocktail (86 mM NaCl, 30 mM KCl, 1 mM NaH₂PO₄, 3 mM MgSO₄, 0.5 mM CaCl, 15 mM glucose, 18 mM NaCO₃, 0.5 mM adenosine, 20 mM taurine, 2 mM DL-carnitine, 0.5% bovine serum albumin, and 80 g/ml trypsin inhibitor (Sigma)) was added and a single-cell suspension was made by pushing cells 4 through a 20 gauge needle, 2 through a 23 gauge needle, and 2 through a 26 gauge needle. Suspended cells were combined with the medium containing floating cells and centrifuged at 1000 g for 3 min. The pellet was washed once with PBS and the cells were then resuspended in the desired reagent.

Analysis of DNA content

Cells were prepared for FACS as described above and the cell pellet was resuspended in 0.5 ml of saponin–propidium iodide solution (0.3 mg/ml saponin, 25 g/ml propidium iodide, 10 mM EDTA, and 5 g/ml RNase). Cells were stained for 5–24 h at 4°C in the dark prior to the FACS analysis.

Kinase assay for JNK activity

The GST-c-Jun (1–79) expression vector was kindly provided by Dr. Lynn Heasley (University of Colorado Health Sciences Center, Denver, CO, USA), and the fusion proteins were prepared as described.⁶³ JNK activation was assayed using the GST-Jun kinase assay⁶⁴ as previously described.¹⁶ The reaction products were resolved on a 10% SDS polyacrylamide gel. The position of GST-Jun was determined by staining the gel, and the extent of GST-Jun phosphorylation was determined by autoradiography.

References

1. Hickman JA (1996) Apoptosis and chemotherapy resistance. Eur. J. Cancer 32A: 921–926
2. Dewey WC, Ling CC and Meyn RE (1995) Radiation-induced apoptosis: relevance to radiotherapy. Int. J. Radiat. Oncol. Biol. Phys. 33: 781–796 | Article | PubMed | ISI | ChemPort |
3. Enoch T and Norbury C (1995) Cellular responses to DNA damage: cell-cycle checkpoints, apoptosis and the roles of p53 and ATM. Trends Biochem. Sci. 20: 426–430 | Article | PubMed | ISI | ChemPort |
4. Harms-Ringdahl M, Nicotera P and Radford IR (1996) Radiation induced apoptosis. Mutat. Res. 366: 171–179 | PubMed | ChemPort |
5. Green D (2000) Apoptotic pathways: paper wraps stone blunts scissors. Cell 102: 1–4 | Article | PubMed | ISI | ChemPort |
6. Deveraux Q and Reed J (1999) IAP family proteins – suppressors of apoptosis. Genes Dev. 13: 239–252 | PubMed | ISI | ChemPort |
7. Kroemer G (1997) The proto-oncogene Bcl-2 and its role in regulating apoptosis. Nat. Med. 3: 614–620 | Article | PubMed | ISI | ChemPort |
8. Kennedy SG, Wagner AJ, Conzen SD, Jordan J, Bellacosa A, Tsichlis PN and Hay N (1997) The PI 3-kinase/AKT signaling pathway delivers an anti-apoptotic signal. Gene Dev. 11: 701–713 | Article | PubMed | ISI | ChemPort |
9. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y and Greenberg ME (1997) Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Science 91: 231–241 | Article | ChemPort |
10. Seimiya H, Mashima T, Toho M and Tsuruo T (1997) c-Jun NH₂-terminal kinase-mediated activation of interleukin-1 converting enzyme/CED-3-like protease during anticancer drug-induced apoptosis. J. Biol. Chem. 272: 4631–4636 | Article | PubMed | ISI | ChemPort |
11. Frasch SC, Nick JA, Fadok VA, Bratton DL, Worthen GS and Henson PM (1998) p38 mitogen-activated protein kinase-dependent and -independent intracellular signal transduction pathways leading to apoptosis in human neutrophils. J. Biol. Chem. 273: 8389–8397 | Article | PubMed | ISI | ChemPort |
12. Juo P, Kuo CJ, Reynolds SE, Konz RF, Raingeaud J, Davis RJ, Biemann H and Blenis J (1997) Fas activation of the p38 mitogen-activated protein kinase signalling pathway requires ICE/CED-3 family proteases. Mol. Cell. Biol. 17: 24–35 | PubMed | ISI | ChemPort |
13. Matassa A, Carpenter L, Biden T, Humphries M and Reyland M (2001) PKC is required for mitochondrial-dependent apoptosis in salivary epithelial cells. J. Biol. Chem. 276: 29 719–29 728
14. Fujii T, Garcia-Bermejo ML, Bernabo JL, Caamano J, Ohba M, Kuroki T, Li L, Yuspa SH and Kazanietz MG (2000) Involvement of protein kinase C in phorbol ester-induced apoptosis in LNCaP prostate cancer cells. Lack of proteolytic cleavage of PKC. J. Biol. Chem. 275: 7574–7582 | Article | PubMed | ISI | ChemPort |
15. Reyland M, Barzen K, Anderson S, Quissell D and Matassa A (2000) Activation of PKC is sufficient to induce an apoptotic program in salivary gland acinar cells. Cell Death Differ., 7: 1200–1209 | Article | PubMed | ISI | ChemPort |
16. Reyland M, Anderson S, Matassa A, Barzen K and Quissell D (1999) Protein kinase C delta is essential for etoposide-induced apoptosis in salivary acinar cells. J. Biol. Chem. 274: 11 915–11 923
17. Whelan DHR and Parker PJ (1998) Loss of protein kinase C function induces an apoptotic response. Oncogene 16: 1939–1944 | Article | PubMed | ISI | ChemPort |
18. Jaken S (1996) Protein kinase C isozymes and substrates. Curr. Opin. Cell Biol. 8: 168–173 | Article | PubMed | ISI | ChemPort |
19. Nishikawa K, Toker A, Johannes F-J, Songyang Z and Cantley L (1997) Determination of the specific substrate sequence motifs of protein kinase C isozymes. J. Biol. Chem. 272: 952–960 | Article | PubMed | ISI | ChemPort |
20. Majumder PK, Pandey P, Sun X, Cheng K, Datta R, Saxena S, Kharbanda S and Kufe D (2000) Mitochondrial translocation of protein kinase C in phorbol ester-induced cytochrome c release and apoptosis. J. Biol. Chem. 275: 21 793–21 796
21. Khwaja A and Tatton L (1999) Caspase-mediated proteolysis and activation of protein kinase C plays a central role in neutrophil apoptosis. Blood 94: 291–301 | PubMed | ISI | ChemPort |
22. Pongracz J, Tuffley W, Johnson GD, Deacon EM, Burnett D, Stockley RA and Lord JM (1995) Changes in protein kinase C isoenzyme expression associated with apoptosis in U937 myelomonocytic cells. Exp. Cell Res. 218: 430–438 | Article | PubMed | ISI | ChemPort |
23. Berra E, Municio M, Sanz L, Frutos S, Diaz-Meco M and Moscat J (1997) Positioning atypical protein kinase C isoforms in the UV-induced apoptotic signaling cascade. Mol. Cell. Biol. 17: 4346–4354 | PubMed | ISI | ChemPort |
24. Mandil R, Ashkenazi E, Blass M, Kronfeld I, Kazimirsky G, Rosenthal G, Umansky F, Lorenzo PS, Blumberg PM and Brodie C (2001) Protein kinase C and protein kinase C play opposite roles in the proliferation and apoptosis of glioma cells. Cancer Res. 61: 4612–4619 | PubMed | ISI | ChemPort |
25. Lin S, Wu L, Huang S, Hsu H, Hsieh S, Chi C and Au L (2000) In vitro and in vivo suppression of growth of rat liver epithelial tumor cells by antisense oligonucleotide against protein kinase C-alpha. J. Hepatol. 33: 601–608 | Article | PubMed | ISI | ChemPort |
26. Fournier D, Chisamore M, Lurain J, Rademaker A, Jordan V and Tonetti D (2001) Protein kinase C alpha expression is inversely related to ER status in endometrial carcinoma: possilbe role in AP-1-mediated proliferation of ER-negative endometrial cancer. Gynecol. Oncol. 81: 366–372 | Article | PubMed | ISI | ChemPort |
27. Shen L, Dean N and Glazer R (1999) Induction of p53-dependent, insulin-like growth factor-binding protein-3-mediated apoptosis in glioblastoma multiforme cells by a protein kinase C antisense oligonucleotide. Mol. Pharmacol. 55: 396–402 | PubMed | ISI | ChemPort |
28. Ruvolo PP, Deng X, Carr BK and May WS (1998) A functional role for mitochondrial protein kinase C Bcl-2 phosphorylation and suppression of apoptosis. J. Biol. Chem. 273: 25 436–25 442
29. Li W, Zhang J, Flechner L, Hyun T, Yam A, Franke T and Pierce J (1999) Protein kinase C- overexpression stimulates Akt activity and suppresses apoptosis induced by interleukin 3 withdrawal. Oncogene 18: 6564–6572 | Article | PubMed | ISI | ChemPort |
30. Ozaki I, Tani E, Ikemoto H, Kitagawa H and Fujikawa H (1999) Activation of stress-activated protein kinase/c-Jun NH2-terminal kinase and p38 kinase in calphostin c-induced apoptosis requires caspase-3-like proteases but is dispensable for cell death. J. Biol. Chem. 274: 5310–5317 | Article | PubMed | ISI | ChemPort |
31. Xia Z, Dickens M, Raingeaud J, Davis RJ and Greenberg ME (1995) Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270: 1326–1331 | Article | PubMed | ISI | ChemPort |
32. Salvesen G and Dixit V (1997) Caspases: intracellular signaling by proteolysis. Cell 91: 443–446 | Article | PubMed | ISI | ChemPort |
33. Nunez G, Benedict M, Hu Y and Inohara N (1998) Caspases: the proteases of the apoptotic pathway. Oncogene 17: 3237–3245 | Article | PubMed | ISI |
34. Emoto Y, Manome Y, Meinhardt G, Kisaki H, Kharbanda S, Robertson M, Ghayur T, Wong W, Kamen R, Weichselbaum R and Kufe D (1995) Proteolytic activation of protein kinase C by an Ice-like Protease in apoptotic cells. EMBO J. 14: 6148–6156 | PubMed | ISI | ChemPort |
35. Smith L, Chen L, Reyland ME, DeVries TA, Talanian RV, Omura S and Smith JB (2000) Activation of atypical protein kinase C by caspase processing and degradation by the ubiquitin–proteasome system. J. Biol. Chem. 275: 40 620–40 627
36. Capiati D, Vazquez G, Tellez Inon M and Boland R (2000) Antisense oligonucleotides targeted against protein kinase C inhibit proliferation of cultured avain myoblasts. Cell Proliferation 33: 307–315 | Article | PubMed | ISI | ChemPort |
37. Besson A and Yong VW (2000) Involvement of p21 waf1/Cip1 in protein kinase-a induced cell cycle progression. Mol. Cell. Biol. 20: 4580–4590 | Article | PubMed | ISI | ChemPort |
38. Sioud M and Sorenson D (1998) A nuclease-resistant protein kinase C ribozyme blocks glioma cell growth. Nat. Biotechnol. 16: 556–561 | Article | PubMed | ISI | ChemPort |
39. Ahmad S, Mineta T, Martuza RL and Glazer RI (1994) Antisense expression of protein kinase C alpha inhibits the growth and tumorigenicity of human glioblastoma cells. Neurosurgery 35: 904–908 | PubMed | ISI | ChemPort |
40. Shao R-G, Cao C-X and Pommier Y (1997) Activation of PKC downstream from aspases during apoptosis induced by 7-aydroxystaurosporine or the topoisomerase inhibitors, camptothecin and etoposide, in human myeloid leukemia HL60 Cells. J. Biol. Chem. 272: 31 321–31 325
41. Keenan C, Thompson S, Knox K and Pears C (1999) Protein kinase C- is essential for Ramos-BL B cell survival. Cell Immunol. 196: 104–109 | Article | PubMed | ISI | ChemPort |
42. Davis R (2000) Signal transduction by the JNK group of MAP kinases. Cell 103: 239–252 | Article | PubMed | ISI | ChemPort |
43. Osborn N and Chambers T (1996) Role of the stress-activated/c-Jun NH₂-terminal protein kinase pathway in the cellular response to adriamycin and other chemotherapeutic drugs. J. Biol. Chem. 271: 30 950–30 955
44. Chen Y, Meyer CF and Tan T-H (1996) Persistent activation of c-Jun N-terminal kinase 1 (JNK1) in gamma radiation-induced apoptosis. J. Biol. Chem. 271: 631–634 | Article | PubMed | ISI | ChemPort |
45. Chen YR, Wang X, Templeton D, Davis RJ and Tan TH (1996) The role of c-Jun N-terminal kinase (JNK) in apoptosis induced by ultraviolet C and gamma radiation. Duration of JNK activation may determine cell death and proliferation. J. Biol. Chem. 271: 31 929–31 936
46. Andererson S, Reyland M, Hunter S, Deisher L, Barzen K and Quissell D (1999) Etoposide-induced activation of c-Jun N-terminal kinase (JNK) correlates with drug-induced apoptosis in salivary gland acinar cells. Cell Death Differ. 6: 454–462 | Article | PubMed |
47. Tournier C, Hess P, Yang DD, Xu J, Turner TK, Nimnual A, Bar-Sagi D, Jones SN, Flavell RA and Davis RJ (2000) Requirement of JNK for stressinduced activation of the cytochrome c-mediated death pathway. Science 288: 870–874 | Article | PubMed | ISI | ChemPort |
48. Gardner AM and Johnson GL (1996) Fibroblast growth factor-2 suppression of tumor necrosis factor a-mediated apoptosis requires ras and the activation of mitogen-activated protein kinase. J. Biol. Chem. 271: 14 560–14 566
49. Nelson JM and Fry DW (2001) Akt, MAPK (Erk1/2), and p38 Act in concert to promote apoptosis in response to ErbB receptor family inhibition. J. Biol. Chem. 276: 14 842–14 847
50. Chen N, Ma W, Huange C and Dong Z (1999) Translocation of Protein Kinase C-epsilon and Protein Kinase C-delta to membrane is required for ultraviolet b-induced activation of mitogen-activated protein kinases and apoptosis. J. Biol. Chem. 274: 15 389–15 394
51. Jimenez L, Zanella C, Fung H, Janssen Y, Vacek P, Charland C, Goldberg J and Mossman B (1997) Role of extracellular signal-regulated protein kinases in apoptosis by asbestos and H₂O₂. Am. J. Physiol. 273: L1029–L1035 | PubMed | ISI | ChemPort |
52. Sellers LA, Alderton F, Carruthers AM, Schindler M and Humphrey PPA (2000) Receptor isoforms mediate opposing proliferative effects through G beta gamma-activated p38 or Akt pathways. Mol. Cell. Biol. 20: 5974–5985 | Article | PubMed | ISI | ChemPort |
53. Lo L, Cheng J, Chiu J, Wung B, Liu Y and Wang D (2001) Endothelial exposure to hypoxia induces Egr-1 expression involving PKC-mediated Ras/Raf-1/ERK1/2 pathway. J. Cell Physiol. 188: 304–312 | Article | PubMed | ISI | ChemPort |
54. Schonwasser DC, Marais RM, Marshall CJ and Parker PJ (1998) Activation of the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway by conventional, novel, and atypical protein kinase C isotypes. Mol. Cell. Biol. 18: 790–798 | PubMed | ISI | ChemPort |
55. Ueda Y, Hirai S-I, Osada S-I, Suzuki A, Mizuno K and Ohno S (1996) Protein kinase C activates the MEK-ERK pathway in a manner independent of Ras and dependent on Raf. J. Biol. Chem. 271: 23 512–23 519
56. Miranti C, Ohno S and Brugge J (1999) Protein kinase C regulates integrin-induced activation of extracellular regulated kinase pathway upstream of Shc. J. Biol. Chem. 274: 10 571–10 581
57. Quissell DO, Barzen KA, Redman RS, Camden JM and Turner JT (1998) Development and characterization of SV40 immortalized rat parotid acinar cell lines. In Vitro Cell Dev. Biol. 34: 58–67 | Article | ISI | ChemPort |
58. Carpenter L, Cordery D and Biden TJ (2001) Protein kinase C activation by interleukin-1beta stabilizes inducible nitric-oxide synthase mRNA in pancreatic cells. J. Biol. Chem. 276: 5368–5374 | Article | PubMed | ISI | ChemPort |
59. Li W, Yu J-C, Shin D-Y and Pierce JH (1995) Characterization of a protein kinase C- ATP binding mutant. J. Biol. Chem. 270: 8311–8318 | Article | PubMed | ISI | ChemPort |
60. Graham F and Prevec L (1995) Methods for construction of adenovirus vectors. Mol. Biotechnol. 3: 207–220 | PubMed | ISI | ChemPort |
61. Schaack J, Langer S and Guo X (1995) Efficient selection of recombinant adenoviruses using vecotrs that express -galactosidase. J. Virol. 69: 3920–3923 | PubMed | ISI | ChemPort |
62. Nevins J, DeGregori J, Jakoi J and Leone G (1997) Functional analysis of E2F transcription factor. Methods Enzymol. 283: 205–219 | PubMed | ISI | ChemPort |
63. Butterfield L, Storey B, Maas L and Heasley L (1997) c-Jun NH2-terminal kinase regulation of the apoptotic response of small cell lung cancer cells to ultraviolet radiation. J. Biol. Chem. 272: 10 110–10 116
64. Minden A, Lin A, McMahon M, Lange-Carter CA, Derijard B, Davis RJ, Johnson GL and Karin M (1994) Differential activation of ERK and JNK mitogen-activated protein kinase by Raf-1 and MEKK. Science 266: 1719–1723 | Article | PubMed | ISI | ChemPort |

Acknowledgements

This research was supported by a grant DE12422 from the National Institutes of Health to MER.