Recently, fusion of the prostate-specific androgen-regulated TMPRSS2 gene to the ETS family transcription factor gene ERG was reported as a common event in prostate cancer (Tomlins et al, 2005, 2006; Clark et al, 2006; Iljin et al, 2006; Perner et al, 2006; Soller et al, 2006; Wang et al, 2006a; Yoshimoto et al, 2006; Hermans et al, 2006). Less frequently TMPRSS2 becomes fused to ETV1 and ETV4. In all these cases a TMPRSS2-ETS chimaeric gene is generated resulting in high-level expression of the fused 3'-ETS gene sequences. The reported incidence of TMPRSS2:ETV1 fusion in these studies (1–2%) was, however, considerably lower than the observed incidence of ETV1 gene overexpression (
10% in prostate cancer). This prompted Tomlins et al (2007) to search for alternative mechanisms of ETV1 overexpression. They identified five new 5'-fusion ETV1 partners including the prostate-specific androgen-induced gene SLC45A3/Prostein, an endogenous retroviral element HERV-K, a prostate-specific androgen-repressed gene C15orf21, and a strongly expressed housekeeping gene HNRPA2B1. Additionally they found that in the two prostate cancer cell lines LNCaP and MDA-PCa2B, outlier expression of ETV1 was caused through the entire ETV1 gene becoming juxtaposed to sequences at 14q13.3–14q21.1. By characterising the expression of four contiguous genes within this region (SLC25A21, MIPOL1, FOXA1 and TTC6), as well as that of ETV1, in LNCaP cells they demonstrated that this region exhibited prostate-specific expression that was coordinately regulated by androgens in a castration-resistant cell line model without formation of a fusion gene. In that study only single cases of each fusion were reported, with the exception of the juxtaposition of ETV1 sequences to 14q13.3–14q21.1 where two cases were observed. It was therefore not possible to assess the relative importance of the different fusion partners in their small tumour set.
For ERG gene re-arrangements several studies have demonstrated links to clinicopathological indicators (Perner et al, 2006; Wang et al, 2006a; Demichelis et al, 2007; Nam et al, 2007). In a watchful waiting cohort of 111 patients, Demichelis et al (2007) reported a significant link between the presence of ERG alterations and prostate cancer-specific death. In a series of 165 patients who underwent prostatectomy, Nam et al (2007) found that the presence of a TMPRSS2:ERG fusion was associated with a greater probability of biochemical relapse. Additionally, we have recently demonstrated that loss of 5'-ERG sequences coupled with duplication of TMPRSS2:ERG fusion sequences predicts extremely poor cancer-specific survival independently of Gleason score and PSA level at diagnosis in a conservatively managed watchful waiting patient cohort (Attard et al, 2008). In contrast very little is known about the clinical significance of alteration at the ETV1 gene locus.
To help identify biomarkers that may be of use in the management of men with prostate cancer, we have established a retrospective cohort of 429 men whose cancers were conservatively managed (Cuzick et al, 2006). Our analyses included centrally assigned Gleason scores determined by modern grading criteria, and allowed comparisons with several additional clinical parameters. In agreement with previous studies (Johansson et al, 2004; Albertsen et al, 2005; Cuzick et al 2006) we found Gleason score to be an important determinant of cancer-specific mortality, although baseline PSA and to a lesser extent stage of disease added further predictive value. The objective of the current study is initially to use our cohort of 429 conservatively managed prostate cancer cases to assess the potential clinical significance of ETV1 gene alterations and in parallel to assess the relative frequency of each of the known ETV1 fusion partners. As we found these partners to only account for
34% of all ETV1 translocation events, we undertook 5'-RACE studies to identify novel ETV1 fusion partners in our paraffin-embedded tumour samples.
Results
Fluorescence in situ hybridisation detection of ETV1 fusions
We have used a fluorescence in situ hybridisation (FISH) ETV1 gene 'break-apart' assay to screen for ETV1 rearrangements on a Tissue Microarray (TMA) consisting of 945 trans-urethral resection of the prostate cancer cores from 429 patients. We used three overlapping BAC probes at the telomeric 3'-end (red) and three BAC probes at the centromeric 5'-end (green) of the ETV1 gene (Figure 1). Normal ETV1 loci are visualised in interphase nuclei as immediately adjacent green and red signals (Figure 1A, Class ETV1 N). When rearrangements involving the ETV1 gene were present, the 5'-centromeric and 3'-telomeric ETV1 probes separated and were visible as lone red and green signals (Figure 1B, Class ETV1 Esplit). These analyses identified ETV1 gene rearrangements in cancer from 23 patients (5.4% of all cancers). An ERG gene break-apart assay, completed as previously described (Attard et al, 2008), demonstrated that an additional 155 cancers (36%) in this series contained ERG gene rearrangements, including one patient who had both ERG and ETV1 rearrangements in distinct foci of cancer in the same prostate, as reported previously (Attard et al, 2008; Clark et al, 2008).
Figure 1.
FISH detection of ETV1 gene re-arrangements. Top: Interphase nuclei are hybridised to probes that detect sequences immediately 3' to the ETV1 gene (probe I, red) and immediately 5' to the ETV1 gene (probe II, green). The red and green signals are separated when an ETV1 gene rearrangement occurs. (A) Signals from normal un-rearranged ETV1 loci (class N). (B) Rearranged ETV1 gene with separate red (3') and green (5') probes (class ETV1 Esplit). Bottom: Map of the ETV1 gene showing the position of the BACs used as probes in FISH assays. Probe I: E1 (RP11-27B1), E2 (RP11-138H16), E3 (CTD-2008I15) labelled with Cy3. Probe II E4 (RP11-905H4), E5 (RP11-621E24), E6 (RP11-115D14) labelled with FITC. The direction of transcription of genes at this locus are indicated by arrows.
Full figure and legend (164K)Clinicopathological correlations
Tumour demographics and characteristics comparing patients with only ETV1 gene rearrangements (22 cases) with patients who lacked both ETV1 and ERG gene rearrangements (252 cases) are shown in Table 1. Correlations with clinical parameters demonstrated there were significant associations between the presence of ETV1 gene re-arrangement and Gleason score (P=0.001), baseline PSA (P=<0.0001), clinical stage (P=0.017) and age (0.04). However, despite these links to indicators of more aggressive disease there was no evidence for a difference in overall and cancer-specific survival between those cancers harbouring ETV1 gene alteration and those cancers retaining normal ERG and ETV1 loci (Class N) (HR=1.48, CI=0.87–2.53, P=0.17 and HR=-1.48, CI=0.64–3.46, P=0.39 respectively) (Supplementary Figure 1).
Heterogeneity of ETV1 fusion partners
We constructed a TMA block containing cores from all of the cancers harbouring ETV1 re-arrangements (23 tumours) and six randomly selected cancers with an ERG gene rearrangement. We used slices of this TMA to carry out break-apart assays for the 5'-fusion partners previously identified by Tomlins et al (2005, 2006, 2007): namely TMPRSS2, SLC45A3, HERV-K, C15orf21 and HNRPA2B1 (Table 2). We also used FISH assays to confirm co-localisation of 3'-ETV1 with 5'-sequences from each of the above partners as previously described by Tomlins et al (2007) (results not shown). To identify tumours with translocation of ETV1 to the androgen-regulated prostate-specific region at 14q13.3–14q21.1 we co-hybridised a TMA slice with a 3'-ETV1 FISH probe (red) and a FISH probe consisting of six BACs spanning the entire region of 14q13.3–q21.1 (green). Co-localisation of the red and green signals was taken as evidence of translocation of ETV1 to this region (Figure 2). The FISH probes used in all of these assays are listed in Supplementary Table 1.
Figure 2.
FISH detection of translocation of ETV1 to chromosome 14(q13.3–21.1). Top: Interphase nuclei are hybridised to probes that detect sequences immediately 3' to the ETV1 gene on chromosome 7 (probe I, red) and a green probe (probe V) consisting of six BACS spanning the 14q13.3–21.1 region. (A). Red and green signals are normally separated. (B) Co-localisation of red and green probes indicate juxtaposition of chr 7 ETV1 sequences with chr 14 (q 13.3–21.1). The lower panel shows the position of the BACs used for probe V: C1 (RP11-945C4), C2 (RP11-381L10), C3 (RP11-666J24), C4 (RP11-796F21), C5 (RP11-588D7), C6 (RP11-107E23) labelled with FITC. The relative position and direction of transcription of genes are indicated by the arrows.
Full figure and legend (194K)As expected, cancers with rearrangements of the ERG gene had fusions to 5'-TMPRSS2 sequences. In contrast, none of the cancers with rearrangements of the ETV1 gene exhibited fusions involving TMPRSS2 or the HERV-K retroviral sequence. In four cancers 3'-ETV1 exhibited fusion to 5'-C15orf21 sequences, two contained translocation to 14q13.3–14q21.1, one contained fusion to HNRPA2B1 and one contained fusion to SLC45A5/Prostein (Table 2). Thus only eight of the 23 cancers with re-arranged ETV1 genes had known partners. The cancers containing fusion of 5'-C15orf21 to 3'-ETV1 sequences included the previously reported case containing ERG and ETV1 rearrangements in distinct cancer foci of the same prostate (Clark et al, 2008). The recurrent fusions of the prostate-specific androgen-repressed gene C15orf21 to 3'-ETV1 sequences is of particular interest because Tomlins et al (2007) reported that this gene is not androgen driven, implying that tumours containing these fusion genes may exhibit resistance to androgen deprivation therapies. Joining of ETV1 to individual partners was too uncommon to allow survival analysis for specific gene fusions. Of the four cases with a C15orf21:ETV1 fusion, three are still alive and one died of unrelated causes.
Fusion of the ACSL3 gene to ETV1 in human prostate cancer
We performed 5'-RACE to identify novel partners that are fused to 3'-ETV1 sequences. Our studies were severely limited by the small amounts (50–200 ng) of poor quality RNA that could be prepared from the formalin-fixed tissue in this series. As obtainable RT–PCR products from these paraffin tissues were limited to
100–150 bp and the ETV1 exon breakpoint in each sample was unknown, 5'-RACE–PCR had to be independently initiated from each of the known ETV1 exon breakpoints in each sample, that is, exons 2, 4, 5 and 6. Using this strategy we successfully obtained a 5'-RACE fusion product from one RNA sample that contained an ex6 ETV1 sequence fused to a 51 bp sequence of ACSL3 ex3 sequence identifying ACSL3 as a novel ETV1 fusion partner. The structure of this ACSL3 ex3:ETV1 ex6 fusion is predicted to encode a truncated ETV1 protein as shown in Figure 3A. The presence of the ACSL3:ETV1 fusion was confirmed in this specimen by RT–PCR using 5'-ACSL3 and 3'-ETV1 primers (Figure 3B, C) and co-localisation by FISH of BAC probes corresponding to 5'-ACSL3 sequences (green) and 3'-ETV1 sequences (red) (Figure 3D, panel iii). An ACSL3 break-apart FISH assay screen of the entire TMA containing the 23 cancers with rearrangement of the ETV1 gene failed to identify additional cancers with this particular fusion. Like fusion to TMPRSS2, HNRPA2B1, HERV-K or SLC45A5/Prostein the fusion of 3'-ETV1 sequences to 5'-ACSL3 sequences is not a common event in this patient cohort. We have also demonstrated fusion of 5'-ETV1 sequences with 3'-ACSL3 sequences by FISH, indicating that the mechanism underlying formation of this fusion gene is a balanced translocation (Figure 3D, panel iv).
Figure 3.
ACSL3:ETV1 fusion. (A) ACSL3 (red) and ETV1 (blue) transcripts with ORFs in dark colour. Exons are numbered. A fusion transcript of ACSL3 exon 3 fused to ETV1 exon 6 was detected by 5'-RACE from exon 6 ETV1 sequences in prostate cancer sample 23. The ORF shown was predicted using software at www.dnalc.org. (B) Sequence across the ACSL3:ETV1 fusion boundary. Underlined regions indicate the position of primers used in RT–PCR to confirm the fusion. The predicted fusion gene initiation codon is indicated in red. ACSL3 sequence is in lower case and ETV1 sequence in upper case. (C) RT–PCR detection of an ACSL3:ETV1 fusion transcript in RNA extracted from formalin-fixed paraffin-embedded prostate cancer samples: lanes 1–12 are ETV1-rearranged tumour samples, lane 12: tumour sample 23, lane 13 negative control. (D) FISH assays to confirm fusion of ACSL3 with ETV1. Panel i: The ETV1 break-apart assay utilises probes corresponding to 3'-ETV1 sequences (red) and 5'-ETV1 sequences (green) (see also Figure 1). A nucleus with separated red and green probes confirming rearrangement of ETV1 is shown. Panel ii: The ACSL3 break-apart assay hybridised the same TMA slice used in the ETV1 break-apart assay to 3'-ACSL3 sequences (red) and 5'-ACSL3 sequences (green). These signals are coincident in the wild type, but are split on translocation of ACSL3 . Comparison of the images in panels i and ii indicates co-localisation of 3'-ETV1 with 5'-ACSL3 and co-localisation of 5'-ETV1 and 3'-ACSL3. This is confirmed by ETV1-ACSL3 co-localisation assays (panel iii) demonstrating co-localisation of 3'-ETV1 sequences (red) and 5'-ACSL3 sequences (green) and (panel iv) demonstrating co-localisation of 3'-ACSL3 sequences and 5'-ETV1 sequences (red) in the same cell. Superimposition of the images in panels iii and iv confirms co-localisation of wild-type 3'-ETV1 (panel iii) with 5'-ETV1 (panel iv) and of wild-type 3'-ACSL3 (panel iv) with 5'-ACSL3 (panel iii). The genes and their direction of transcription are indicated by the arrowheads. (E) Map of the ACSL3 gene showing the position of the BACs used as probes in FISH assays. Probe XV: A1 (RP11-157M20) labelled with FITC. Probe XIV: A2 (RP11-136M23) and A3 (RP11-749C15) labelled with Cy3. Probes XV and probes XIV correspond, respectively, to sequences immediately 5' (green) and 3' (red) to the ACSL3 gene. Direction of gene transcription indicated by arrowheads.
Full figure and legend (332K)Discussion
We have shown that the presence of ETV1 gene locus rearrangements scored in a FISH-based assay is correlated with Gleason score, associated clinical stage and baseline PSA, but interestingly was not associated with poorer survival. Similar analyses of ERG gene alterations detected by FISH also demonstrate correlation to Gleason score, clinical stage and baseline PSA (Attard et al, 2008). However, in clinical outcome correlations only the presence of a duplication of rearranged ERG together with interstitial deletion of genomic sequences between the tandemly located TMPRSS2 and ERG sequences was correlated with worse cancer-specific death (Attard et al, 2008). In analyses of alteration of the ETV1 gene it was not possible to examine the relationship between survival and duplication of the ETV1 foci because duplications were only found in five of the 23 cases examined (one C15orf21 fusion, one chr14 co-localisation, and three with unknown partners).
Previous studies have each reported single cancers with an ETV1 rearrangement (Tomlins et al, 2005, 2006; Hermans et al, 2006) with the exception of Tomlins et al (2007) who reported four clinical cases. Our study therefore represents the largest single series of primary prostate cases with an ETV1 rearrangement. Our study confirms previous observations that ETV1 may form a fusion gene with a variety of partners and shows that each individual fusion is relatively rare. Importantly, we show that the known fusion partners, including the novel ACSL3:ETV1 fusion gene, only account for 39% of cancers with an ETV1 rearrangement and it is therefore likely that many new partner genes remain to be identified.
The protein encoded by the ACSL3 gene is an isozyme of the long-chain fatty-acid coenzyme A ligase family that converts free long-chain fatty acids into fatty acyl-CoA esters, and thereby plays a key role in lipid biosynthesis and fatty acid degradation. Insights into the regulation of ACSL3 expression arise from expression array data in which the LNCaP cell line was treated with the synthetic androgen R1881. In two independent expression array data sets, ACSL3 was upregulated by androgen treatment (Hendriksen et al, 2006; Wang et al, 2006b). One study showed ACSL3 upregulation at time intervals of 2, 4, 6 and 8 h following androgen treatment (Hendriksen et al, 2006) and another study showed ACSL3 upregulation after 16 h (Wang et al, 2006b). Expression of ACSL3 was also elevated in a panel of 'androgen-sensitive' (LAPC-4, LNCaP, MDA PCa2a, MDA PCa2b, and 22Rv1) versus 'androgen-insensitive' (PPC1, PC3, and DU145) prostate cancer cell lines (Zhao et al, 2005; Tomlins et al, 2007). Expression of TMPRSS2 and SLC45A3 follow the same pattern within these datasets (Zhao et al, 2005). ACSL3 transcription can also be activated by oncostatin via the ERK-signalling pathway (Zhou et al, 2007) suggesting alternative means of regulation.
These observations raised the question of whether there are any androgen receptor (AR) binding sites capable of explaining the expression levels of ACSL3 and of the other known ETV1 partner genes. A number of groups have recently published AR ChIP-chip studies mapping AR-binding sites within the human genome (Bolton et al, 2007; Massie et al, 2007; Takayama et al, 2007; Wang et al, 2007). Wang et al (2007) identified a functional AR-binding site 13.5 kb upstream of the TMPRSS2 gene (Wang et al, 2007). The closest AR-binding sites for the other genes involved in ETS gene fusions varied from 60 kb to 1.5 Mb, although in the absence of genome-wide AR ChIP data it is possible that other AR-binding sites occur outside of the current coverage (Supplementary Table 2). Both Massie et al (2007) and Wang et al (2007) have proposed mechanisms for AR recruitment to subsets of target sequences through associations between the AR and other transcription factors for example, GATA-2, OCT11, FOXA1 and ETS1.
In conclusion our studies report a novel fusion partner for ETV1 and highlight the wide heterogeneity in the range of the ETV1 fusion partners. Interestingly fusion to the androgen repressed gene C15orf21 was the most common event suggesting the existence of a significant subgroup of cancers that may not respond in a conventional manner to androgen withdrawal therapies.
Materials and methods
Patient cohort and tissue microarrays
TMAs were constructed from 429 unselected transurethral resection of the prostate specimens taken from patients managed with no initial treatment or hormone treatment in a cohort of conservatively managed men with prostate cancer (Cuzick et al, 2006). The median age of diagnosis was 70 years (49–76 years) and the median follow up was 91 months (3–173 months). Most men were diagnosed after the age of 65 years. National approval for the collection of the cohort was obtained from the Northern Multi-Research Ethics Committee followed by local ethics committee approval at each of the collaborating hospital trusts. This work was approved by the Clinical Research and Ethics Committee at the Royal Marsden Hospital and Institute of Cancer Research.
Tissue microarrays
TMAs were constructed in 35
22
7 mm blocks of Lamb paraffin wax using a manual tissue microarrayer (Beecher Instruments, Sun Prairie, WI, USA). Up to four tumour cores of 600
m diameter were taken from each prostate. Reassignment of areas of 'cancer' or 'normal' in each core was carried out on the basis of histopathological examination of haematoxylin and eosin and p63 and AMACR-stained sections that flanked the TMA slice used for FISH studies. The morphological criteria for selection of 'normal' and 'malignant' prostatic epithelium conformed to previously published definitions (Foster, 2000; Foster et al, 2000, 2004). 'Hyperplasia', 'dysplasia' and 'PIN' were not scored in this study.
FISH studies
TMA sections (4
m) were cut onto SuperFrostPlus glass slides (VWR International, Poole, UK). Fluorescence in situ hybridisation studies, labelling of BACs including preparation of slides, probes and washing were all carried out as described previously (Attard et al, 2008; Clark J et al, 2008)
5' RACE RT–PCR from paraffin-embedded tissue
RNA was extracted from a 600
m core of paraffin-embedded tumour tissue using the RecoverAll kit as manufacturer's instructions (Ambion, UK, cat. AM1975). A total of 25–100 ng of RNA was reverse transcribed using 50 U Superscript III (Invitrogen, Paisley, UK) and 10 ng random nonamers in a 25
l reaction as manufacturer's instructions. cDNAs were treated with 0
3
l (1 U) RNAase-H (20 min), then extracted with one volume of phenol/chloroform (1 : 1 v v-1), then one volume of chloroform and then precipitated with 500 ng glycogen (Sigma UK, G1767), rinsed in 80% v v-1 ethanol, and resuspended in 15
l water. Second strand cDNA synthesis was then carried out: Klenow buffer plus 0.3
l of 10
M TAGrandom primer (GACTCGAGTCGACATCGAIIINNNNNN where I is Inosine) were added, heated to 70°C 5 min, cooled to room temperature and 40 U Klenow added (25°C 10 min, 30°C 10 min 37°C 1 h, 75°C 10 min). 1
l (2–8 ng) was used to seed a 25
l PCR mix with 0.25 U Platinum Taq (Invitrogen) plus an ETV1 exon 6 primer GCCTCATTCCCACTTGTGG, 50 rounds, 61.5°C annealing temperature. TAG primer (GACTCGAGTCGACATCGA) was then added and the reaction continued for 40 rounds at 59°C annealing. 0.25
l of this was used to seed a nested PCR using TAG primer and ETV1 exon 6 primary nest primer TTCCCACTTGTGGCTTCTG, 59°C annealing, 40 rounds. 0.25
l of this was then used to seed two PCRs, the first containing TAG primer and secondary nest ETV1 primer cccacttgtggcttctgatc, and the second containing TAG primer alone, 40 rounds 59°C. RT–PCR products were run on 2% agarose TAE gels. RACE products were subcloned using the TA cloning kit (Invitrogen) and sequenced. Sequences were searched at the human genome map web site (http://genome.ucsc.edu).
References
- Albertsen PC, Hanley JA, Barrows GH, Penson DF, Kowalczyk PD, Sanders MM, Fine J (2005) Prostate cancer and the Will Rogers phenomenon. J Natl Cancer Inst 97: 1248–1253 | PubMed |
- Attard G, Clark J, Ambroisine L, Fisher G, Kovacs G, Flohr P, Berney D, Foster C, Fletcher A, Gerald WL, Moller H, Reuter V, de Bono J, Scardino P, Cooper CS, on behalf of the Transatlantic Prostate Group (2008) Duplication of the fusion of TMPRSS2 to ERG sequences identifies fatal human prostate cancer. Oncogene 27: 253–263 | Article | PubMed | ChemPort |
- Bolton EC, So AY, Chaivorapol C, Haqq CM, Li H, Yamamoto KR (2007) Cell- and gene-specific regulation of primary target genes by the androgen receptor. Genes Dev 21: 2005–2017 | Article | PubMed | ChemPort |
- Clark J, Attard G, Jhavar S, Flohr P, Reid A, De-Bono J, Eeles R, Scardino P, Cuzick J, Fisher G, Parker MD, Foster CS, Berney D, Kovacs G, Cooper CS (2008) Complex patterns of ETS gene alteration arise during cancer development in the human prostate. Oncogene 27: 1993–2003 | Article | PubMed | ChemPort |
- Clark J, Merson S, Jhavar S, Flohr P, Edwards S, Foster CS, Eeles R, Martin FL, Phillips DH, Crundwell M, Christmas T, Thompson A, Fisher C, Kovacs G, Cooper CS (2006) Diversity of TMPRSS2-ERG fusion transcripts in the human prostate. Oncogene 26: 2667–2673 | Article | PubMed | ISI | ChemPort |
- Cuzick J, Fisher C, Kattan MW, Berney D, Oliver T, Foster CS, Moller H, Reuter V, Fearn P, Eastham J, Scardino P (2006) Long-term outcome among men with conservatively treated localsed prostate cancer. Br J Cancer 95: 1186–1194 | Article | PubMed | ISI | ChemPort |
- Demichelis F, Fall K, Perner S, Andren O, Schmidt F, Setlur SR, Hoshida Y, Mosquera JM, Pawitan Y, Lee C, Adami HO, Mucci LA, Kantoff PW, Andersson SO, Chinnaiyan AM, Johansson JE, Rubin MA (2007) TMPRSS2:ERG gene fusion associated with lethal prostate cancer in a watchful waiting cohort. Oncogene 26: 4596–4599 | Article | PubMed | ChemPort |
- Foster CS (2000) Pathology of benign prostatic hyperplasia. Prostate Suppl 9: 4–14 | Article | PubMed | ChemPort |
- Foster CS, Bostwick DG, Bonkhoff H, Damber JE, van der KT, Montironi R, Sakr WA (2000) Cellular and molecular pathology of prostate cancer precursors. Scand J Urol Nephrol Suppl 19–43 | Article | PubMed |
- Foster CS, Falconer A, Dodson AR, Norman AR, Dennis N, Fletcher A, Southgate C, Dowe A, Dearnaley D, Jhavar S, Eeles R, Feber A, Cooper CS (2004) Transcription factor E2F3 overexpressed in prostate cancer independently predicts clinical outcome. Oncogene 23: 5871–5979 | Article | PubMed | ISI | ChemPort |
- Hendriksen PJ, Dits NF, Kokame K, Veldhoven A, van Weerden WM, Bangma CH, Trapman J, Jenster G (2006) Evolution of the androgen receptor pathway during progression of prostate cancer. Cancer Res 66: 5012–5020 | Article | PubMed | ChemPort |
- Hermans KG, van Marion R, van Dekken H, Jenster G, van Weerden WM, Trapman J (2006) TMPRSS2:ERG fusion by translocation or interstitial deletion is highly relevant in androgen-dependent prostate cancer, but is bypassed in late-stage androgen receptor-negative prostate cancer. Cancer Res 66: 10658–10663 | Article | PubMed | ISI | ChemPort |
- Iljin K, Wolf M, Edgren H, Gupta S, Kilpinen S, Skotheim RI, Peltola M, Smit F, Verhaegh G, Schalken J, Nees M, Kallioniemi O (2006) TMPRSS2 fusions with oncogenic ETS factors in prostate cancer involve unbalanced genomic rearrangements and are associated with HDAC1 and epigenetic reprogramming. Cancer Res 66: 10242–10246 | Article | PubMed | ISI | ChemPort |
- Johansson JE, Andren O, Anderson SO, Dickman PW, Holmberg L, Magnuson A, Adami HO (2004) Natural history of early localised prostate cancer. JAMA 291: 2713–2719 | Article | PubMed | ISI | ChemPort |
- Massie CE, Adryan B, Barbosa-Morais NL, Lynch AG, Tran MG, Neal DE, Mills IG (2007) New androgen receptor genomic targets show an interaction with the ETS1 transcription factor. EMBO Rep 8: 871–878 | Article | PubMed | ChemPort |
- Nam RK, Sugar L, Wang Z, Yang W, Kitching R, Klotz LH, Venkateswaran V, Narod SA, Seth A (2007) Expression of TMPRSS2 ERG gene fusion in prostate cancer cells is an important prognostic factor for cancer progression. Cancer Biol Ther 6: 40–45 | Article | PubMed | ISI | ChemPort |
- Perner S, Demichelis F, Beroukhim R, Schmidt FH, Mosquera J-M, Setlur S, Tchinda J, Tomlins SA, Hofer MD, Pienta K, Keufer R, Vessella R, Sun X-W, Meyerson M, Lee C, Sellers WR, Chinnaiyan AM, Rubin M (2006) TMPRSS2:ERG fusion-associated deletions provide insight into the heterogeneity of prostate cancer. Cancer Res 66: 8337–8341 | Article | PubMed | ISI | ChemPort |
- Soller MJ, Isaksson M, Elfving P, Soller W, Lundgren R, Panagopoulos I (2006) Confirmation of the high frequency of the TMPRSS2/ERG fusion gene in prostate cancer. Genes Chromosomes Cancer 45: 717–719 | Article | PubMed | ISI | ChemPort |
- Takayama K, Kaneshiro K, Tsutsumi S, Horie-Inoue K, Ikeda K, Urano T, Ijichi N, Ouchi Y, Shirahige K, Aburatani H, Inoue S (2007) Identification of novel androgen response genes in prostate cancer cells by coupling chromatin immunoprecipitation and genomic microarray analysis. Oncogene 26: 4453–4463 | Article | PubMed | ChemPort |
- Tomlins SA, Laxman B, Dhanasekaran SM, Helgeson BE, Cao X, Morris DS, Menon A, Jing X, Cao Q, Han B, Yu J, Wang L, Montie JE, Rubin MA, Pienta KJ, Roulston D, Shah RB, Varambally S, Mehra R, Chinnaiyan AM (2007) Distinct classes of chromosomal rearrangements create oncogenic ETS gene fusions in prostate cancer. Nature 448: 595–599 | Article | PubMed | ISI | ChemPort |
- Tomlins SA, Mehra R, Rhodes DR, Smith LR, Roulston D, Helgeson BE, Cao X, Wei JT, Rubin MA, Shah RB, Chinnaiyan AM (2006) TMPRSS2:ETV4 gene fusions define a third molecular subtype of prostate cancer. Cancer Res 66: 3396–3400 | Article | PubMed | ISI | ChemPort |
- Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, Varambally S, Cao X, Tchinda J, Kuefer R, Lee C, Montie JE, Shah RB, Pienta KJ, Rubin MA, Chinnaiyan AM (2005) Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science 310: 644–648 | Article | PubMed | ISI | ChemPort |
- Wang J, Cai Y, Ren C, Ittmann M (2006a) Expression of variant TMPRSS2/ERG fusion messenger RNAs is associated with aggressive prostate cancer. Cancer Res 66: 8347–8351 | Article | PubMed | ISI | ChemPort |
- Wang G, Jones SJ, Marra MA, Sadar MD (2006b) Identification of genes targeted by the androgen and PKA signaling pathways in prostate cancer cells. Oncogene 25: 7311–7323 | Article | PubMed | ChemPort |
- Wang Q, Li W, Liu XS, Carroll JS, Janne OA, Keeton EK, Chinnaiyan AM, Pienta KJ, Brown M (2007) A hierarchical network of transcription factors governs androgen receptor-dependent prostate cancer growth. Mol Cell 27: 380–392 | Article | PubMed | ChemPort |
- Yoshimoto M, Cutz JC, Nuin PA, Joshua AM, Bayani J, Evans AJ, Zielenska M, Squire JA (2006) Interphase FISH analysis of PTEN in histologic sections shows genomic deletions in 68% of primary prostate cancer and 23% of high-grade prostatic intra-epithelial neoplasias. Cancer Genet Cytogenet 169: 128–137 | Article | PubMed | ISI | ChemPort |
- Zhao H, Kim Y, Wang P, Lapointe J, Tibshirani R, Pollack JR, Brooks JD (2005) Genome-wide characterization of gene expression variations and DNA copy number changes in prostate cancer cell lines. Prostate 63: 187–197 | Article | PubMed | ISI | ChemPort |
- Zhou Y, Abidi P, Kim A, Chen W, Huang TT, Kraemer FB, Liu J (2007) Transcriptional activation of hepatic ACSL3 and ACSL5 by oncostatin m reduces hypertriglyceridemia through enhanced beta-oxidation. Arterioscler Thromb Vasc Biol 27: 2198–2205 | Article | PubMed | ChemPort |
Acknowledgements
This work was funded by Cancer Research UK, the National Cancer Research Institute, National Institutes of Health (SPORE) the Grand Charity of Freemasons, The Rosetrees Trust, The Orchid Appeal and the Koch Foundation. Funding bodies had no involvement in the design and conduct of the study, or in collection management, analysis and interpretation of the data, or in preparation, review or approval of the paper. We thank Christine Bell for help with typing the paper.
Supplementary Information accompanies the paper on British Journal of Cancer website (http://www.nature.com/bjc)
MORE ARTICLES LIKE THIS
These links to content published by NPG are automatically generated
NEWS AND VIEWS
TMPRSS2-ERG and PTEN loss in prostate cancer
Nature Genetics News and Views (01 May 2009)
RESEARCH
Detection of TMPRSS2:ERG fusion gene in circulating prostate cancer cells
Asian Journal of Andrology Original Article
Detection of TMPRSS2:ERG fusion gene in circulating prostate cancer cells
Asian Journal of Andrology Original Article
Complex patterns of ETS gene alteration arise during cancer development in the human prostate
Oncogene Original Article
