Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Article
  • Published:

FGF2-induced chromatin remodeling regulates CNTF-mediated gene expression and astrocyte differentiation

Nature Neuroscience volume 7, pages 229–235 (2004)Cite this article

Abstract

The generation of distinct cell types during development depends on the competence of progenitor populations to differentiate along specific lineages. Here we investigate the mechanisms that regulate competence of rodent cortical progenitors to differentiate into astrocytes in response to ciliary neurotrophic factor (CNTF). We found that fibroblast growth factor 2 (FGF2), which by itself does not induce astrocyte-specific gene expression, regulates the ability of CNTF to induce expression of glial fibrillary acidic protein (GFAP). FGF2 facilitates access of the STAT/CBP (signal transducer and activator of transcription/CRE binding protein) complex to the GFAP promoter by inducing Lys4 methylation and suppressing Lys9 methylation of histone H3 at the STAT binding site. Histone methylation at this site is specific to the cell's state of differentiation. In progenitors, the promoter is bound by Lys9-methylated histones, and in astrocytes, it is bound by Lys4-methylated histones, indicating that astrocyte differentiation in vivo involves this switch in chromatin state. Our observations indicate that extracellular signals can regulate access of transcription factors to genomic promoters by local chromatin modification, and thereby regulate developmental competence.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Figure 1: FGF2 induces CNTF responsiveness in cortical cells.
Figure 2: Effects of FGF2 and CNTF on cortical cell fates examined by clonal analysis.
Figure 3: FGF2 regulates histone methylation and facilitates recruitment of the STAT/CBP complex to the GFAP promoter.
Figure 4: Comparison of histone methylation levels among progenitors, neurons and astrocytes.

Similar content being viewed by others

References

  1. Davis, A.A. & Temple, S. A self-renewing multipotential stem cell in embryonic rat cerebral cortex. Nature 372, 263–266 (1994).

    Article  CAS  PubMed  Google Scholar 

  2. Luskin, M.B., Pearlman, A.L. & Sanes, J.R. Cell lineage in the cerebral cortex of the mouse studied in vivo and in vitro with a recombinant retrovirus. Neuron 1, 635–647 (1988).

    Article  CAS  PubMed  Google Scholar 

  3. Price, J. & Thurlow, L. Cell lineage in the rat cerebral cortex: a study using retroviral-mediated gene transfer. Development 104, 473–482 (1988).

    CAS  PubMed  Google Scholar 

  4. Walsh, C. & Cepko, C.L. Clonally related cortical cells show several migration patterns. Science 241, 1342–1345 (1988).

    Article  CAS  PubMed  Google Scholar 

  5. Burrows, R.C., Wancio, D., Levitt, P. & Lillien, L. Response diversity and the timing of progenitor cell maturation are regulated by developmental changes in EGFR expression in the cortex. Neuron 19, 251–267 (1997).

    Article  CAS  PubMed  Google Scholar 

  6. Gross, R.E. et al. Bone morphogenetic proteins promote astroglial lineage commitment by mammalian subventricular zone progenitor cells. Neuron 17, 595–606 (1996).

    Article  CAS  PubMed  Google Scholar 

  7. Johe, K.K., Hazel, T.G., Muller, T., Dugich-Djordjevic, M.M. & McKay, R.D. Single factors direct the differentiation of stem cells from the fetal and adult central nervous system. Genes Dev. 10, 3129–3140 (1996).

    Article  CAS  PubMed  Google Scholar 

  8. Hughes, S.M. et al. Ciliary neurotrophic factor induces type-2 astrocyte differentiation in culture. Nature 335, 70–73 (1988).

    Article  CAS  PubMed  Google Scholar 

  9. Takizawa, T. et al. DNA methylation is a critical cell-intrinsic determinant of astrocyte differentiation in the fetal brain. Dev. Cell 1, 749–758 (2001).

    Article  CAS  PubMed  Google Scholar 

  10. Molne, M. et al. Early cortical precursors do not undergo LIF-mediated astrocytic differentiation. J. Neurosci. Res. 59, 301–311 (2000).

    Article  CAS  PubMed  Google Scholar 

  11. Viti, J., Feathers, A., Phillips, J. & Lillien, L. Epidermal growth factor receptors control competence to interpret leukemia inhibitory factor as an astrocyte inducer in developing cortex. J. Neurosci. 23, 3385–3393 (2003).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Morrow, T., Song, M.-R. & Ghosh, A. Sequential specification of neurons and glia by developmentally regulated extracellular factors. Development 128, 3585–3594 (2001).

    CAS  PubMed  Google Scholar 

  13. Qian, X., Davis, A.A., Goderie, S.K. & Temple, S. FGF2 concentration regulates the generation of neurons and glia from multipotent cortical stem cells. Neuron 18, 81–93 (1997).

    Article  CAS  PubMed  Google Scholar 

  14. Williams, B.P. & Price, J. Evidence for multiple precursor cell types in the embryonic rat cerebral cortex. Neuron 14, 1181–1188 (1995).

    Article  CAS  PubMed  Google Scholar 

  15. Bonni, A. et al. Regulation of gliogenesis in the central nervous system by the JAK-STAT signaling pathway. Science 278, 477–483 (1997).

    Article  CAS  PubMed  Google Scholar 

  16. Kahn, M.A. et al. Ciliary neurotrophic factor activates JAK/Stat signal transduction cascade and induces transcriptional expression of glial fibrillary acidic protein in glial cells. J. Neurochem. 68, 1413–1423 (1997).

    Article  CAS  PubMed  Google Scholar 

  17. Darnell, J.E. Jr. STATs and gene regulation. Science 277, 1630–1635 (1997).

    Article  CAS  PubMed  Google Scholar 

  18. Bhattacharya, S. et al. Cooperation of Stat2 and p300/CBP in signaling induced by interferon-alpha. Nature 383, 344–347 (1996).

    Article  CAS  PubMed  Google Scholar 

  19. Sun, Y. et al. Neurogenin promotes neurogenesis and inhibits glial differentiation by independent mechanisms. Cell 104, 365–376 (2001).

    Article  CAS  PubMed  Google Scholar 

  20. Jenuwein, T. & Allis, C.D. Translating the histone code. Science 293, 1074–1080 (2001).

    Article  CAS  PubMed  Google Scholar 

  21. Strahl, B.D. & Allis, C.D. The language of covalent histone modifications. Nature 403, 41–45 (2000).

    Article  CAS  PubMed  Google Scholar 

  22. Fischle, W., Wang, Y. & Allis, C.D. Binary switches and modification cassettes in histone biology and beyond. Nature 425, 475–479 (2003).

    Article  CAS  PubMed  Google Scholar 

  23. Noma, K., Allis, C.D. & Grewal, S.I. Transitions in distinct histone H3 methylation patterns at the heterochromatin domain boundaries. Science 293, 1150–1155 (2001).

    Article  CAS  PubMed  Google Scholar 

  24. Wang, H. et al. Purification and functional characterization of a histone H3-lysine 4-specific methyltransferase. Mol. Cell 8, 1207–1217 (2001).

    Article  CAS  PubMed  Google Scholar 

  25. Nishioka et al. Set9, a novel histone H3 methyltransferase that facilitates transcription by precluding histone tail modifications required for heterochromatin formation. Genes Dev. 16, 479–489 (2002).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  26. Mowen, K.A. et al. Arginine methylation of STAT1 modulates IFNalpha/beta-induced transcription. Cell 104, 731–741 (2001).

    Article  CAS  PubMed  Google Scholar 

  27. Zegerman, P., Canas, B., Pappin, D. & Kouzarides, T. Histone H3 lysine 4 methylation disrupts binding of nucleosome remodeling and deacetylase (NuRD) repressor complex. J. Biol. Chem. 277, 11621–11624 (2002).

    Article  CAS  PubMed  Google Scholar 

  28. Li, B., Howe, L., Anderson, S., Yates, J.R. & Workman, J.L. The Set2 histone methyltransferase functions through the phosphorylated carboxyl-terminal domain of RNA polymerase II. J. Biol. Chem. 278, 8897–8903 (2003).

    Article  CAS  PubMed  Google Scholar 

  29. Ng, H.H., Robert, F., Young, R.A. & Struhl, K. Targeted recruitment of Set1 histone methylases by elongating Pol II provides a localized mark and memory of recent transcriptional activity. Mol. Cell 11, 709–719 (2003).

    Article  CAS  PubMed  Google Scholar 

  30. Xiao, T. et al. Phosphorylation of RNA polymerase II CTD regulates H3 methylation in yeast. Genes Dev. 17, 654–663 (2003).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Nielsen, S.J. et al. Rb targets histone H3 methylation and HP1 to promoters. Nature 412, 561–565 (2001).

    Article  CAS  PubMed  Google Scholar 

  32. Capela, A. & Temple, S. LeX/ssea-1 is expressed by adult mouse CNS stem cells, identifying them as nonependymal. Neuron 35, 865–875 (2002).

    Article  PubMed  Google Scholar 

  33. Kinsella, T.M. & Nolan, G.P. Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum. Gene Ther. 7, 1405–1413 (1996).

    Article  CAS  PubMed  Google Scholar 

  34. Shang, Y., Hu, X., DiRenzo, J., Lazar, M.A. & Brown, M. Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103, 843–852 (2000).

    Article  CAS  PubMed  Google Scholar 

  35. Plath, K. et al. Role of histone H3 lysine 27 methylation in X inactivation. Science 300, 131–135 (2003).

    Article  CAS  PubMed  Google Scholar 

  36. Heard, E. et al. Methylation of histone H3 at Lys-9 is an early mark on the X chromosome during X inactivation. Cell 107, 727–738 (2001).

    Article  CAS  PubMed  Google Scholar 

  37. Fischle, W. et al. Molecular basis for the discrimination of repressive methyl-lysine marks in histone H3 by Polycomb and HP1 chromodomains. Genes Dev. 17, 1870–1881 (2003).

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  38. Beisel, C., Imhof, A., Greene, J., Kremmer, E. & Sauer, F. Histone methylation by the Drosophila epigenetic transcriptional regulator Ash1. Nature 419, 857–862 (2002).

    Article  CAS  PubMed  Google Scholar 

  39. Litt, M.D., Simpson, M., Gaszner, M., Allis, C.D. & Felsenfeld, G. Correlation between histone lysine methylation and developmental changes at the chicken beta-globin locus. Science 293, 2453–2455 (2001).

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We thank G. Nolan for the retroviral vectors, S. Temple for advice on cell sorting, K. Chadwick for help with FACS, D. Reinberg and Y. Zhang for SET7/9 constructs, and B. Barres, S. Pfaff, D. Ginty, P. Beachy and M. Greenberg for discussion. This work was supported by National Institutes of Health grant NS36176 (A.G.), the March of Dimes Birth Defects Foundation (A.G.), a Pew Scholar Award (A.G.) and the Johns Hopkins Center for AIDS Research 1P30AI42855 (K.C.).

Author information

Author notes

  1. Anirvan Ghosh

    Present address: Division of Biology, University of California San Diego, 9500 Gilman Drive, La Jolla, California, 92093-0366, USA

Authors and Affiliations

  1. Department of Neuroscience, Johns Hopkins University School of Medicine, 725 N. Wolfe Street, Baltimore, 21205, Maryland, USA

    Mi-Ryoung Song & Anirvan Ghosh

Authors
  1. Mi-Ryoung Song
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Anirvan Ghosh
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Anirvan Ghosh.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Supplementary information

Supplementary Fig. 1

Effect of transient FGF2 exposure on cell proliferation in glial clones. E18 cultures were infected with GFP retrovirus and were exposed to FGF2 for indicated duration on day 1 or continuously for 5 days. The number of cells in glial clones was scored on day 5. Note that brief stimulation of FGF2 did not promote proliferation compared to the control. Asterisks indicate statistically significant differences by paired t test (P<0.01 for **) between the control and the indicated experimental group. (JPG 22 kb)

Supplementary Fig. 2

Effect of FGF2 on DNA methylation at the GFAP promoter. Genomic DNA was prepared from E15 rat cortical cells either acutely or after culture for 5 days with or without FGF2 treatments. DNA methylation level was assessed by bisulfite sequencing method. In brief, 10 ug of genomic DNA was prepared, sonicated, and denatured with 0.3M NaOH at 37°C for 20 min. After incubation with 3.1 M sodium bisulfite and 0.5 mM hydroquinone at 55°C for 16 hours, DNA samples were purified with a desalting column (Qiagen). Eluted samples were denatured by NaOH at 37°C for 20 min, neutralized by ammonium acetate, and recovered by ethanol precipitation. PCR was performed using following primers to amplify STAT binding-site sequence: GFmS(ttaatttttttaggatttttttttttgtgttt) and GfmAS ( aatatctactccaaaacatttactaaataaaa). PCR products were cloned using PCR cloning kit (Invitrogen) and transformed into bacteria. 10 to 15 clones were randomly picked in each group of three independent PCRs and sequenced. (JPG 22 kb)

Supplementary Fig. 3

Effect of FGF2 on overall histone methylation at lysine-4. Cells were treated with FGF2 for 24 hours and whole cell extracts were immunoblotted with anti-dimethyl histone H3 (lysine-4) or histone H3. (JPG 12 kb)

Supplementary Fig. 4

Effect of SET7/9 expression on the proportion of neuronal clones. Cells were retrovirally infected to misexpress SET7/9 and were grown for 5 DIV. Clonal analysis was performed based on GFP and β-tubulin III immunofluorescence. (JPG 29 kb)

Rights and permissions

Reprints and permissions

About this article

Cite this article

Song, MR., Ghosh, A. FGF2-induced chromatin remodeling regulates CNTF-mediated gene expression and astrocyte differentiation. Nat Neurosci 7, 229–235 (2004). https://doi.org/10.1038/nn1192

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/nn1192

This article is cited by

Search

Advanced search

Quick links

Nature Briefing

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing