This page has been archived and is no longer updated
PROVIDED BY
AND
EXPLORE
Related Subjects
Genetics
Gene Inheritance and Transmission
Gene Expression and Regulation
Nucleic Acid Structure and Function
Chromosomes and Cytogenetics
Evolutionary Genetics
Population and Quantitative Genetics
Genomics
Genes and Disease
Genetics and Society
Cell Biology
Cell Origins and Metabolism
Proteins and Gene Expression
Subcellular Compartments
Cell Communication
Cell Cycle and Cell Division
Molecular Biology
Biochemistry
Immunology
Working in Science
UPDATES
Loading ...
CONNECT
GO
In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state
Author: -100
YOUR KEYWORDS
Keywords for this Article
You may personalize your own list of keywords for this Nature Education article. After entering and saving them in the box below, they will be only visible to you when you are logged into WLoS.
Cancel
Save
Share
|
Cancel
Revoke
|
Cancel
Rate & Certify
Rate Me...
Rate Me
!
Comment
Save
|
Cancel
Flag Inappropriate
The Content is
Objectionable
Explicit
Offensive
Inaccurate
Comment
Cancel
Flag Content
Delete Content
Reason
Delete
|
Cancel
Full Screen
"ARTICLES Invitroreprogrammingoffibroblastsintoa pluripotent ES-cell-like state Marius Wernig 1 *, Alexander Meissner 1 *, Ruth Foreman 1,2 *, Tobias Brambrink 1 *, Manching Ku 3 *, Konrad Hochedlinger 1 {, Bradley E. Bernstein 3,4,5 & Rudolf Jaenisch 1,2 Nuclear transplantation can reprogramme a somatic genome back into an embryonic epigenetic state, and the reprogrammed nucleus can create a cloned animal or produce pluripotent embryonic stem cells. One potential use of the nuclear cloning approach is the derivation of ?customized? embryonic stem (ES) cells for patient-specific cell treatment, but technicalandethicalconsiderationsimpedethe therapeutic applicationof thistechnology. Reprogramming offibroblaststo apluripotentstatecanbeinducedin vitrothroughectopicexpressionofthefourtranscriptionfactorsOct4(alsocalledOct3/ 4 or Pou5f1), Sox2, c-Myc and Klf4. Here we show that DNA methylation, gene expression and chromatin state of such induced reprogrammed stem cells are similar to those of ES cells. Notably, the cells?derived from mouse fibroblasts?can formviablechimaeras,cancontributetothegermlineandcangeneratelivelate-termembryoswheninjectedintotetraploid blastocysts.Ourresultsshowthatthebiologicalpotencyandepigeneticstateof in-vitro-reprogrammedinducedpluripotent stem cells are indistinguishable from those of ES cells. Epigenetic reprogramming of somatic cells into ES cells has attracted much attention because of the potential for customized transplanta- tion therapy, as cellular derivatives of reprogrammed cells will not be rejected by the donor 1,2 . Thus far, somatic cell nuclear transfer and fusion of fibroblasts with ES cells have been shown to promote the epigenetic reprogramming of the donor genome to an embryonic state 3?5 . However, the therapeutic application of either approach has been hindered by technical complications as well as ethical objec- tions 6 . Recently, a major breakthrough was reported whereby expres- sion of the transcription factors Oct4, Sox2, c-Myc and Klf4 was shown to induce fibroblasts to become pluripotent stem cells (desig- nated as induced pluripotent stem (iPS) cells), although with a low efficiency 7 . The iPS cells were isolated by selection for activation of Fbx15 (also called Fbxo15), which is a downstream gene of Oct4. This important study left a number of questions unresolved: (1) although iPS cells were pluripotent they were not identical to ES cells (for example, iPS cells injected into blastocysts generated abnormal chi- maeric embryos that did not survive to term); (2) gene expression profilingrevealedmajordifferencesbetweeniPScellsandEScells;(3) because the four transcription factors were transduced by constitu- tivelyexpressedretroviralvectorsitwasunclearwhythecellscouldbe induced to differentiate and whether continuous vector expression was required for the maintenance of the pluripotent state; and (4) the epigenetic state of the endogenous pluripotency genes Oct4 and Nanog was incompletely reprogrammed, raising questions about the stability of the pluripotent state. HereweusedactivationoftheendogenousOct4orNanoggenesas amorestringentselectionstrategyfortheisolationofreprogrammed cells. We infected fibroblasts with retroviral vectors transducing the fourfactors,andselectedfortheactivationoftheendogenousOct4or Nanog genes. Positive colonies resembled ES cells and assumed an epigenetic state characteristic of ES cells. When injected into blasto- cysts the reprogrammed cells generated viable chimaeras and contributed to the germ line. Our results establish that somatic cells can be reprogrammed to a pluripotent state that is similar, if not identical, to that of normal ES cells. Selection of fibroblasts for Oct4 or Nanog activation Using homologous recombination in ES cells we generated mouse embryonic fibroblasts (MEFs) and tail-tip fibroblasts (TTFs) that carried a neomycin-resistance marker inserted into either the endo- genousOct4(Oct4-neo)orNanoglocus(Nanog-neo)(Fig.1a).These cultures were sensitive to G418, indicating that the Oct4 and Nanog loci were, as expected, silenced in somatic cells. These MEFs or TTFs were infected with Oct4-, Sox2-, c-Myc- and Klf4-expressing retro- viral vectors and G418 was added to the cultures 3, 6 or 9 days later. The number of drug-resistant colonies increased substantially when analysed at day 20 (Fig. 1i). Most colonies had a flat morphology (Fig. 1h, right) and between 11% and 25% of the colonies were ?ES- like? (Fig. 1h, left) when selection was applied early (Fig. 1k), a per- centage that increasedat later time points. At day20,ES-like colonies were picked, dissociated and propagated in G418-containing media. They gave rise to ES-like cell lines (designated as Oct4 iPS or Nanog iPS cells, respectively) that could be propagated without drug selec- tion,displayedhomogenous Nanog,SSEA1 and alkaline phosphatase expression (Fig. 1b?g and Supplementary Figs 1 and 5), and formed undifferentiated colonies when seeded at clonal density on gelatin- coateddishes(seeinsetinFig.1b).Fouroutoffiveanalysedlineshada normal karyotype (Supplementary Table 1). Although the timing and appearance of colonies were similar between the Oct4 and Nanog selection, we noticed pronounced quantitative differences between the two selection strategies: whereas Oct4-selected MEF cultures had 3- to 10-fold fewer colonies, the fraction of ES-like colonies was 2- to 3-fold higher than in Nanog- selected cultures. Accordingly, approximately four times more Oct4- selected ES-like colonies gave rise to stable and homogenous iPS cell *These authors contributed equally to this work. 1 WhiteheadInstituteforBiomedicalResearchand 2 DepartmentofBiology,MassachusettsInstituteofTechnology,Cambridge,Massachusetts02142,USA. 3 MolecularPathologyUnit andCenterforCancerResearch,MassachusettsGeneralHospital,Charlestown,Massachusetts02129,USA. 4 BroadInstituteofHarvardandMIT,Cambridge,Massachusetts02142, USA. 5 DepartmentofPathology,HarvardMedicalSchool,Boston,Massachusetts02115,USA.{Presentaddress:CenterforRegenerativeMedicineandCancerCenter,Massachusetts General Hospital, Harvard Medical School and Harvard Stem Cell Institute, Boston, Massachusetts 02414, USA. Vol 448|19 July 2007|doi:10.1038/nature05944 318 Nature �2007 Publishing Group lines compared with Nanog-selected ES-like colonies (Fig. 1k). This suggeststhat althoughtheNanoglocuswaseasiertoactivate,a higher fractionofthedrug-resistantcoloniesinOct4-neocultureswasrepro- grammed to a pluripotent state. Therefore, the overall estimated effi- ciency of 0.05?0.1% to establish iPS cell lines from MEFs was similar between Oct4 selection and Nanog selection, despite the larger num- ber of total Nanog-neo resistant colonies (Fig. 1k). Next we investi- gated the time course of reprogramming by studying the fraction of alkaline-phosphatase-, SSEA1- and Nanog-positive cells in Oct4- selected MEF cultures. Fourteen days after infection some cells had already initiated alkaline phosphatase activity and SSEA1 expression, but lacked detectable amounts of Nanog protein (Fig. 1j), whereas by day20,alkalinephosphataseandSSEA1expressionhadincreasedand ,8% of the cells were Nanog-positive. Thus, the reprogramming induced by the four transcription factors (Oct4, Sox2, c-Myc and Klf4) is a gradual and slow process. Expression and DNA methylation To characterize the reprogrammed cells on a molecular level we used quantitative polymerase chain reaction with reverse transcription (qRT?PCR) to measure the expression of ES-cell- and fibroblast- specific genes. Figure 2a shows that in Oct4 iPS cells the total level of Nanog and Oct4 was similar to that in ES cells but decreased on differentiationtoembryoidbodies.MEFsdidnotexpresseithergene. Using specific primers for endogenous or total Sox2 transcripts showed that most Sox2 transcripts originated from the endogenous locus rather than the viral vector (Fig. 2b). In contrast, Hoxa9 and Zfpm2 were highly expressed in MEFs but were expressed at very low levels in iPS or ES cells (Fig. 2c). Western blot analysis showed that multiple iPS clones expressed Nanog and Oct4 proteins at similar levels compared to ES cells (Fig. 2d). Finally, we used microarray technology to compare gene expression patterns on a global level. Figure2fshowsthattheiPScellsclusteredwithEScellsincontrastto wild-type or donor MEFs. To investigate the DNA methylation level of the Oct4 and Nanog promotersweperformedbisulphitesequencingandcombinedbisul- phite restriction analysis (COBRA) with DNA isolated from ES cells, iPScells and MEFs. Asshown inFig. 2g,bothloci weredemethylated in ES and iPS cells and fully methylated in MEFs. To assess whether the maintenance of genomic imprinting was compromised we NanogDAPI de fg DAPI SSEA1 a j 0 20 40 60 80 Day 0 Total col./ 100,000 cells ES-like col./ total col. (%) iPS line/ ES-like col. (%) Estimated efficiency (%) Oct4 Nanog 156 � 31 24.0 � 7 22 5 0.050 0.080 11.5 � 4947 � 187 Day 14 Day 20 AP SSEA1 Nanog i h k ES-like colony Flat colony 0 100 200 300 400 500 Day 3 Day 6 Day 9 Oct4-neo Nanog-neo Bcll Ncol IRES GFP neo 1 kb Ncol Ncol Ncol Ncol 5?probe T otal colony number Per centage of total selected cells bc Figure 1 | Generation of Oct4- and Nanog-selected iPS cells. a, Targeting strategy to generate an Oct4-IRES-GFPneo allele. The resulting GFPneo fusion protein has sufficient neomycin-resistance activity in ES cells; GFP fluorescence, however, is not visible. b, Phase-contrast micrograph of Oct4 iPS cells (clone 18) grown on irradiated MEFs. Inset: an ES-cell-like colony 5days after seeding in clonal density without feeder cells. iPS clone 18 cells exhibited strong alkaline phosphatase activity (c) and were homogenously labelled with antibodies against SSEA1 (d, e) and Nanog (f, g). h, One example of an ES-like colony 16 days after infection (left). Most G418- resistantcolonies,however,consistedofflatnon-ES-likecells(right):b,103; c?g,203; h,43. i, Gradual activation of the Nanog and Oct4-neo alleles. Shown are the total colony numbers of one experiment at day 20 after infection starting neomycin selection at day 3, 6 and 9. j, Fraction of total selected cells expressing alkaline phosphatase, SSEA1 and Nanog 0, 14, and 20 days after infection (counted were more than ten visual fields containing n.1,000 total cells for every time point; error bars indicate s.d.). k, Estimated reprogramming efficiency of Oct4 selection and Nanog selection (n53 different experiments; s.e.m. is shown). Indicated are the total number of drug-resistant colonies per 100,000 plated MEFs 20days after infection; the fraction of ES-like colonies per total number of colonies; the fraction of iPS cell lines that could be established from picked ES-like coloniesasdefinedbyhomogenousalkalinephosphatase,SSEA1andNanog expression. After determining the fraction of Sox2- (83.4%), Oct4- (53.2%) and c-myc- (46.3%) infected MEFs 2days after infection by immunofluorescence and assuming 50% were infected by Klf4 viruses, we estimated the overall reprogramming efficiency as the ratio of quadruple- infectedcellsandtheextrapolatedtotalnumberofiPScelllinesthatcouldbe established with G418 selection starting at day 6 after infection. NATURE|Vol 448|19 July 2007 ARTICLES 319 Nature �2007 Publishing Group assessedthemethylationstatusofthefourimprintedgenesH19,Peg1 (also called Mest), Peg3 and Snrpn. As shown in Fig. 2e, bands cor- responding to an unmethylated and methylated allele were detected for each gene in MEFs, iPS cells and TTFs. In contrast, embryonic germ cells, which have erased all imprints 8 , were unmethylated. Our results indicate that the epigenetic state of the Oct4 and Nanog genes was reprogrammed from a transcriptionally repressed (somatic) to an active (embryonic) state and that the pattern of somatic imprint- ing was maintained in iPS cells. Furthermore, the presence of imprints suggests a non-embryonic-germ-cell origin of iPS cells. Chromatin modifications Recently, downstream target genes of Oct4, Nanog and Sox2 have been defined in ES cells by genome-wide location analyses 9,10 . These targets include many important developmental regulators, a proportion ofwhichisalsobound andrepressedbyPcG(Polycomb- Group)complexes 11,12 .Notably,thechromatinatmanyofthesenon- expressed target genes adopts a bivalent conformation in ES cells, carrying both the ?active? histone H3 lysine 4 (H3K4) methylation mark and the ?repressive? histone H3 lysine 27 (H3K27) methylation mark 13,14 . In differentiated cells, those genes tend instead to carry either H3K4 or H3K27 methylation depending on their expression state. We used chromatin immunoprecipitation (ChIP) and real- time PCR to quantify H3K4 and H3K27 methylation for a set of 0 0.2 0.4 0.6 0.8 1.0 1.2 1.4 1.6 Nanog Oct4 O18 O18 .1 O18 EB s ES cell s M EF s 18 8 ES O N WT MEFs f ES cells MEFs O18 iPS a Nanog Oct4 Actin MEF18 18.110 ES1696 0.2 0.4 0.6 0.8 1.0 Total Sox2 Endog. Sox2 0 0.2 0.4 0.6 0.8 1.0 1.2 Hoxa9 Zfpm2 bc O18 ES cells MEFs H19 Peg1 Peg3 Snrpn U M U M U M U M M M O18EG cellsTTFs MEF s O18 O18.1 O18 EB s ES cel ls M EF s g Nanog Oct4 ed Figure 2 | Expression and promoter methylation analysis of iPS cells. a?c, qRT?PCR analysis (n53 independent PCR reactions; error bars indicate s.d.) of Oct4 iPS clone 18, subclone 18.1, 2-week-old embryoid bodies(EBs)derivedfromclone18,V6.5EScellsandOct4-neoMEFsshows similar Nanog (red bars) and total Oct4 (blue bars) levels as in ES cells (a);slightlylowertotalSox2levels(filledredbars),mostlyduetoexpression of endogenous Sox2 transcripts (open red bars, b); and strong downregulation of Hoxa9 (red) and Zfpm2 (blue) transcripts in iPS cells (c).TranscriptlevelswerenormalizedtoGapdhexpression,withexpression levelsinEScells(a,b)andMEFs(c)setas1.d,WesternblotanalysisforOct4 and Nanog expression of different Oct4 iPS clones (6, 9, 10, 16, 18) and a GFP-labelled subclone of clone 18 (18.1). e, COBRA methylation analysis 32 ofimprintedgenesH19(maternallyexpressed),Peg1(paternallyexpressed), Peg3 (paternally expressed) and Snrpn (paternally expressed). Upper band, unmethylated (U); lower band, methylated (M). f, Unsupervised hierarchical clustering of averaged global transcriptional profiles obtained from Oct4-neoiPS clone 18, Nanog-neoiPS clone8, geneticallymatched ES cells (V6.5;129SvJae/C57Bl/6), Oct4-neo MEFs (O), Nanog-neo MEFs (N) andwild-type129/B6F1MEFs(WT).g,Analysisof themethylation stateof the Oct4 and Nanog promoters using bisulphite sequencing. Open circles indicate unmethylated and filled circles methylated CpG dinucleotides. ShownareeightrepresentativesequencedclonesfromEScells(V6.5),Oct4- neo MEFs and Oct4-neo iPS clone 18. f c Cre MspI HpaII O18 dem/1O18 dem/3O18 re m/3.1 HpaII ES cells Dnmt1 KO MEFsO18 O18 Demethylated (GFP + ) Remethylated (GFP ? ) 1 23456 78 O18 Peg3 Snrpn U M U M M Intergenic U M M After Cre 2 lox 1 lox d e a O1 8 De m/3 Re m/3.1 Dem /3 Rem /3 .1 Phase contrast EGFP 0 2 4 6 Zfp m 2 H o x a9 So x 2 1 Lb x 1 Pax 5 Zfp m 2 Ho x a 9 S o x 2 1 Lb x 1 Pax 5 Zfp m 2 Ho x a 9 S ox 21 Lb x 1 P ax 5 K4me3 K27 m e 3 MEFs iPS O18 ES cells ChlP enrichment (log 2 ) Nkx2.2Nkx2.2 Nkx2.2 b shRNA Figure 3 | Reprogrammed MEFs acquire an ES-cell-like epigenetic state. a, Real-time PCR after chromatin immunoprecipitation using antibodies against tri-methylated histone H3K4 and H3K27. Shown are the log 2 enrichments for several previously reported ?bivalent? loci in ES cells (n53 experiments; errorbars indicate s.d.). Zfpm2 and Hoxa9 showenrichmentfor the active (H3K4) mark in MEFs and are expressed (Fig. 1c and microarray data), whereas the other tested genes remain silent (microarray data). All loci tested in iPS clone O18 show enrichment for both H3K4 and H3K27 tri- methylation (?bivalent?), as seen in ES cells (V6.5). (See Supplementary Fig. 2 for H3K4 and H3K27 tri-methylation analysis of a subclone (clone O18.1) and Nanog-neo iPS clone N8.) b, Experimental design to de- and remethylate genomic DNA. Clone O18 was infected with the Dnmt1-hairpin-containing lentiviral vector pSicoR-GFP. The shRNA and GFP marker in the pSicoR vectorare flanked byloxPsites 18 . Green colonies were expanded and passaged four times. Tat-Cre protein transduction was used to remove the shRNA 33 . c, Southern blot analysis of the minor satellite repeats using a methylation- sensitive restriction enzyme (HpaII) and its methyl-insensitive isoschizomer (MspI)asacontrol.Lossofmethylationintwodifferentclones(lanes6and7) is comparable to Dnmt1 knockout ES cells (lane 2). After Cre-mediated recombination, complete remethylation (lane 8) of the repeats is observed within four passages. d, e, Successful loop out after Tat-Cre treatment was identifiedbydisappearanceofEGFPfluorescence(arrow)andverifiedbyPCR analysis (e). f, COBRA assay of the imprinted genes Peg3 and Snrpn and a random intergenic region close to the Otx2 locus (Intergenic), demonstrating the expected resistance to de novo methylation of imprinted genes in contrast to non-imprinted intergenic sequences. U, unmethylated band; M, methylated band. ARTICLES NATURE|Vol 448|19 July 2007 320 Nature �2007 Publishing Group genes reported to be bivalent in pluripotent ES cells 13 . Figure 3a shows that the fibroblast-specific genes Zfpm2 and Hoxa9 carried stronger H3K4 methylation than H3K27 methylation in the donor MEFs, whereas the silent genes Nkx2.2, Sox1, Lbx1 and Pax5 prim- arilycarriedH3K27methylation.Incontrast,intheOct4iPScells,all ofthesegenesshowedcomparableenrichmentforbothhistonemod- ifications, similar to normal ES cells (Fig. 3a). Identical results were obtained in Nanog iPS clones selected from Nanog-neo MEFs (Supplementary Fig. 2). These data suggest that the chromatin con- figuration of somatic cells is re-set to one that is characteristic of ES cells. iPS cells tolerate genomic demethylation Tolerance of genomic demethylation is a unique property of ES cells incontrasttosomaticcells,whichundergorapidapoptosisonlossof the DNA methyltransferase Dnmt1 (refs 15?17). We investigated whether iPS cells would be resistant to global demethylation after Dnmt1 inhibition and would be able to re-establish global methyla- tionpatternsafterrestorationofDnmt1activity.Tothisend,weused a conditional lentiviral vector harbouring a Dnmt1-targeting short hairpin (sh)RNA and a green fluorescence protein (GFP) reporter gene(Fig.3bandref.18).InfectediPScellswereplatedatlowdensity and GFP-positive colonies were picked and expanded. Southern blot analysis using HpaII-digested genomic DNA showed that global demethylation of infected iPS cells (Fig. 3c, lanes 6, 7) was similar to Dnmt1 2/2 ES cells (lane 2). In contrast, uninfected iPS cells or MEFs (lanes 4, 5) displayed normal methylation levels. Morph- ologically,theGFP-positivecellswereindistinguishablefromthepar- entallineorfromuninfectedsistersubclones,indicatingthat iPScells tolerate global DNA demethylation. In a second step, the Dnmt1 shRNA was excised through Cre-mediated recombination and GFP- negativecloneswerepicked(Fig.3d).ThecellshadexcisedtheshRNA vector (Fig. 3e) and normal DNA methylation levels were restored (Fig. 3c, lane 8) and were able to generate chimaeras (see below, Table1),ashasbeenreportedpreviouslyforEScells 19 .Theseobserva- tionsimply that thede novo methyltransferasesDnmt3aandDnmt3b were reactivated in iPS cells 20 , leading to restoration of global methy- lation levels. As expected 19 , the imprinted genes Snrpn and Peg3 were unmethylated and resistant to remethylation (Fig. 3f). Maintenance of the pluripotent state Southern blot analysis indicated that Oct4-neo iPS clone 18 carried four to six copies of the Oct4,c-myc and Klf4 retroviral vectors and only one copy of the Sox2 retroviral vector (Fig. 4a). Because these four factors were under the control of the constitutively expressed retrovirallongterminalrepeat,itwasunclearinapreviousstudywhy iPS cells could be induced to differentiate 7 . To address this question, wedesigned primersspecificfor thefourviral-encoded transcription factor transcripts and compared expression levels by qRT?PCR in MEFs 2days after infection in iPS cells, in embryoid bodies derived from iPS cells, and in demethylated and remethylated iPS cells (Fig. 4b). Although the MEFs represented a heterogeneous popu- lation composed of uninfected and infected cells, virally encoded RNA levels of Oct4, Sox2 and Klf4 RNA were 5-fold higher and of c-myc more than 10-fold higher than in iPS cells. This suggests silen- cing of the viral long terminal repeat by de novo methylation during the reprogramming process. Accordingly, the total Sox2 and Oct4 RNA levels in iPS cells were similar to those in wild-type ES cells, and the Sox2 transcripts in iPS cells were mostly, if not exclusively, transcribed from the endogenous gene (compare Fig. 2b). On differ- entiation to embryoid bodies, both viral and endogenous transcripts were downregulated. All viral Sox2, Oct4 and Klf4 transcripts were upregulated by approximately twofold in Dnmt1 knockdown iPS cells, and again downregulated on restoration of Dnmt1 activity. This is consistent with previous data that Moloney virus is efficiently de novo methylated and silenced in embryonic but not in somatic cells 21,22 . Transcript levels of c-myc were about 20-fold lower in iPS cells than in infected MEFs, and did not change on differentiation or demethylation. Tofollowthekineticsofvectorinactivationduringthereprogram- ming process, we isolated RNA from drug-resistant cell populations atdifferenttimesafterinfection.Figure4cshowsthattheviral-vector- encoded transcripts were gradually silenced during the transition from MEFs to iPS cells with a time course that corresponded to the gradual appearance of pluripotency markers (compare Fig. 1j). Finally, to visualize directly Oct4 and Nanog expression during dif- ferentiation, we injected Oct4 iPS cells into SCID mice to induce teratoma formation (Fig. 4d). Immunostaining revealed that Oct4 and Nanog were expressed in the centrally located undifferentiated cells but were silenced in the differentiated parts of the teratoma (Fig. 4e, f). Our results suggest that the retroviral vectors are subject to gradual silencing by de novo methylation during the reprogram- mingprocess.Themaintenanceofthepluripotentstateandinduction ofdifferentiationstrictlydependsontheexpressionandnormalregu- lation of the endogenous Oct4 and Nanog genes. Developmental potency We determined the developmental potential of iPS cells by teratoma and chimaera formation. Histological and immunohistochemical analysis of Oct4- or Nanog-iPS-cell-induced teratomas revealed that the cells had differentiated into cell types representing all three embryonicgermlayers(SupplementaryFigs3and4).Toassessmore stringently their developmental potential, various iPS cell lines were injected into diploid (2N) or tetraploid (4N) blastocysts. After injec- tion into 2N blastocysts both Nanog iPS and Oct4 iPS clones derived from MEFs (Fig. 5a) or from TTFs (Fig. 5b,c), as well as iPS cells that had been subjected to a consecutive cycle of demethylation and remethylation (compare Fig. 3b, c), efficiently generated viable Table 1 | Summary of blastocyst infections 2N injections 4N injections Cell line Injected blastocysts Live chimaeras Chimaerism (%) Germ line Injected blastocysts Dead embryos (arrested) Live embryos (analysed) O6 ND ND ND ND 13 0 2 (E12.5) O930530?70 Yes 90 3 (E11?13.5) 12 (E10?12.5) O16 15 3 10?30 Yes ND ND ND O18 95 8 5?50 No 134 7 (E9?11.5) 4*(E10?12.5) O3-2 ND ND ND ND 25 2 (E8,11.5) 0 O4-16 ND ND ND ND 35 4 (E11?13.5) 3 (E14.5) N730130ND ND ND ND N8945?50 No 118 9 (E9?11.5) 1*(E12.5) N14 30 5 5?20 ND 46 2 (E8,11.5) 1 (E12.5) TT-O25 50 2 30{ ND 39 3 (E9.5) 0 O18 rem/3.125130ND ND ND ND The extent of chimaerism was estimated on the basis of coat colour or EGFP expression. ND, not determined. 4N injected blastocysts were analysed between embryonic day E10.5 and E14.5. ?Analysed? indicates the day of embryonic development analysed; ?arrested? indicates the estimated stage of development of dead embryos. *Developmentally retarded or abnormal. O18 rem/3.1 is a de- and remethylated iPS clone (Fig. 3c). {On the basis of GFP fluorescence. NATURE|Vol 448|19 July 2007 ARTICLES 321 Nature �2007 Publishing Group high-contribution chimaeras (summarized in Table 1). To test for germline transmission, chimaeras derived from two different iPS lines (Oct4 iPS O9 and O16) were mated with normal females, and blastocysts were isolated and genotyped by three different PCR reac- tions for the presence of the multiple viral Oct4 and c-myc genes and for the single-copy GFPneo sequences inserted into the Oct4 locus of thedonorcell(Fig.1a).Figure5fshowsthat9outof16embryosfrom two chimaeras were positive for the viral copies. As expected, only half ofthe viral-positive blastocysts contained theGFPneo sequences (5 out of 9 embryos, Fig. 5f, left panel). When embryonic day (E)10 embryos derived from an Oct4 iPS line O16 chimaera were geno- typed,threeoutofeighttestedembryosweretransgenic(Fig.5f,right panel). Finally, we injected iPS cells into 4N blastocysts as this repre- sents the most rigorous test for developmental potency, because the resulting embryos are composed only of the injected donor cells (?all ES embryo?). Figure 5d, e shows that both Oct4 and Nanog iPS cells could generate mid- and late-gestation ?all iPS embryos? (summar- izedinTable1).ThesefindingsindicatethatiPScellscanestablishall lineages of theembryo and thus have asimilar developmental poten- tial as ES cells. Discussion The results presented here demonstrate that the four transcription factorsOct4,Sox2,c-mycandKlf4caninduceepigeneticreprogram- ming of a somatic genome to an embryonic pluripotent state. In contrast to selection for Fbx15 activation 7 , fibroblasts that had reac- tivated the endogenous Oct4 (Oct4-neo) or Nanog (Nanog-neo) loci grew independently of feeder cells, expressed normal Oct4, Nanog and Sox2 RNA and protein levels, were epigenetically identical to ES cells by a number of criteria, and were able to generate viable chi- maeras,contributetothegermlineandgenerateviablelate-gestation embryos after injection into tetraploid blastocysts. Transduction of thefourfactorsgeneratedsignificantlymoredrug-resistantcellsfrom Nanog-neo than from Oct4-neo fibroblasts but a higher fraction of Oct4-selected cells had all the characteristics of pluripotent ES cells, suggesting that Nanog activation is a less stringent criterion for plur- ipotency than Oct4 activation. Our data suggest that the pluripotent state of Oct4 iPS and Nanog iPS cells is induced by the virally transduced factors but is largely maintained by the activity of the endogenous pluripotency factors including Oct4, Nanog and Sox2, because the viral-controlled transcripts, although expressed highly in MEFs, become mostly silenced in iPS cells. The total levels of Oct4, Nanog and Sox2 were similar in iPS and wild-type ES cells. Consistent with the conclusion that the pluripotent state is maintained by the endogenous pluripo- tency genes is the finding that the Oct4 and the Nanog genes became hypomethylated in iPS cells as in ES cells, and that the bivalent his- tone modifications of developmental regulators were re-established. Furthermore, iPS cells were resistant to global demethylation induced by inactivation of Dnmt1, similar to ES cells but in contrast to somatic cells. Re-expression of Dnmt1 in the hypomethylated ES cellsresultedinglobalremethylation,indicatingthattheiPScellshad alsoreactivatedthedenovomethyltransferasesDnmt3aandDnmt3b. All these observations are consistent with the conclusion that the iPS cells have gained an epigenetic state that is similar to that of normal ES cells. This conclusion is further supported by the recent obser- vation that female iPS cells, similar to ES cells, reactivate the soma- tically silenced X chromosome 23 . Expression of the four transcription factors proved to be a robust method to induce reprogramming of somatic cells to a pluripotent state. However, the use of retrovirus-transduced oncogenes repre- sents a serious barrier to the eventual use of reprogrammed cells for therapeutic application. Much work is needed to understand the molecular pathways of reprogramming and to eventually find small 0 20 40 60 80 100 120 140 a Oct4 c-Myc Klf4 Sox2 * * * * * * O18 dem/1O18 dem/3 EBs 2 day infect ed- M EF s MEFs O 18.1O18 Relative expr ession 1.0 0.8 0.6 0.4 0.2 b c Expr ession per centage of Gapdh d4 d9 d18 d28 d32 O1.3 O9 Oct4 Sox2 Klf4 c-myc d H&E Nanog Oct4 ef O 18 re m / 3 .1 Figure 4 | Efficientsilencingofretroviraltranscriptsininducedpluripotent cells. a,SouthernblotanalysisofproviralintegrationsiniPScloneO18(left lanes) for the four retroviral vectors. Uninfected ES cells (right lanes) show onlyoneortwobandscorrespondingtotheendogenousgene(markedbyan asterisk). b, Quantitative RT?PCR using primers specifically detecting the four viral transcripts. Shown are Oct4-neo iPS clone 18 and a GFP-labelled subclone, Oct4-neo MEFs, 2-week-old embryoid bodies generated from clone18,twodemethylatedclones(18dem/1and18dem/3),aremethylated clone (18 rem/3.1), and Oct4-neo MEFs 2 days after infection with all four viruses but not selected with G418 (n53 independent experiments; error bars indicate s.d.). c, Viral transcript levels at various time points in cell populations after infection and Oct4 selection and in the two Oct4 iPS cell linesO1.3andO9(n53independentexperiments;errorbarsindicates.d.). d?f, Paraffin sections of a teratoma 26 days after subcutaneous injection of Oct4 iPS clone 18 cells into SCID mice. H&E, haematoxylin and eosin. Nanog (e) and Oct4 (f) expression was confined to undifferentiated cell types as indicated an immunohistochemical analysis. ARTICLES NATURE|Vol 448|19 July 2007 322 Nature �2007 Publishing Group molecules that could achieve reprogramming without gene transfer of potentially harmful genes. METHODS SUMMARY Cellculture,genetargetingandviralinfections.ESandiPScellswerecultivated on irradiated MEFs. Using homologous recombination we generated ES cells carrying an IRES-GFPneo fusion cassette downstream of Oct4 exon 5 (Fig. 1a). The Nanog gene was targeted as described 24 . Transgenic MEFs were isolated and selected from E13.5 chimaeric embryos after blastocyst injection of Oct4-IRES- GFPneo-orNanog-neo-targetedEScells.MEFswereinfectedovernightwiththe Moloney-based retroviral vector pLIB (Clontech) containing the murine com- plementary DNAs of Oct4, Sox2, Klf4 and c-myc. Southern blot, methylation and chromatin analyses. To assess the levels of DNA methylation, genomic DNA was digested with HpaII and hybridized to a probe for the minor satellite repeats 25 or with an IAP probe 26 . Bisulphite treat- ment was performed with the Qiagen EpiTect Kit. For the methylation status of Oct4 and Nanog promoters, bisulphite sequencing analysis was performed as described previously 27 . For imprinted genes, a COBRA assay was performed. PCR primers and conditions were as described previously 28 . The status of biva- lent domains was determined by chromatin immunoprecipitation followed by quantitative PCR analysis, as described previously 12 Expression analysis. Total RNA was reverse-transcribed and quantified using the QuantTtect SYBR green RT?PCR Kit (Qiagen) on a 7000 ABI detection system. Western blot and immunofluorescence analysis was performed as described 29,30 . Microarray targets from 2mg total RNA were synthesized and labelled using the Low RNA Input Linear Amp Kit (Agilent), hybridized to Agilent whole-mouse genome oligonucleotide arrays (G4122F) and analysed as previously described 31 . Full Methods and any associated references are available in the online version of the paper at www.nature.com/nature. Received 27 February; accepted 22 May 2007. Published online 6 June 2007. 1. Hochedlinger, K. & Jaenisch, R. Nuclear transplantation, embryonic stem cells, and the potential for cell therapy. N. Engl. J. Med. 349, 275?286 (2003). 2. Yang, X. et al. Nuclear reprogramming of cloned embryos and its implications for therapeutic cloning. Nature Genet. 39, 295?302 (2007). 3. Hochedlinger, K. & Jaenisch, R. Nuclear reprogramming and pluripotency. Nature 441, 1061?1067 (2006). 4. Tada,M.,Takahama,Y.,Abe,K.,Nakatsuji,N.&Tada,T.Nuclearreprogramming of somatic cells by in vitro hybridization with ES cells. Curr. Biol. 11, 1553?1558 (2001). 5. Cowan, C. A., Atienza, J., Melton, D. A. & Eggan, K. Nuclear reprogramming of somatic cells after fusion with human embryonic stem cells. Science 309, 1369?1373 (2005). 6. Jaenisch,R.Humancloning?thescienceandethicsofnucleartransplantation. N. Engl. J. Med. 351, 2787?2791 (2004). 7. Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663?676 (2006). 8. Labosky,P.A.,Barlow,D.P.&Hogan,B.L.Mouseembryonicgerm(EG)celllines: transmission through the germline and differences in the methylation imprint of insulin-like growth factor 2 receptor (Igf2r) gene compared with embryonic stem (ES) cell lines. Development 120, 3197?3204 (1994). 9. Boyer, L. A. et al. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122, 947?956 (2005). 10. Loh,Y.H.etal.TheOct4andNanogtranscriptionnetworkregulatespluripotency in mouse embryonic stem cells. Nature Genet. 38, 431?440 (2006). 11. Lee, T. I. et al. Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125, 301?313 (2006). 12. Boyer, L. A. et al. Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441, 349?353 (2006). 13. Bernstein, B. E. et al. A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315?326 (2006). 14. Azuara, V. et al. Chromatin signatures of pluripotent cell lines. Nature Cell Biol. 8, 532?538 (2006). 15. Jackson-Grusby, L. et al. Loss of genomic methylation causes p53-dependent apoptosis and epigenetic deregulation. Nature Genet. 27, 31?39 (2001). 16. Li,E.,Bestor,T.H.&Jaenisch,R.TargetedmutationoftheDNAmethyltransferase gene results in embryonic lethality. Cell 69, 915?926 (1992). 17. Meissner, A. et al. Reduced representation bisulfite sequencing for comparative high-resolution DNA methylation analysis. Nucleic Acids Res. 33, 5868?5877 (2005). 18. Ventura, A. et al. Cre-lox-regulated conditional RNA interference from transgenes. Proc. Natl Acad. Sci. USA 101, 10380?10385 (2004). 19. Holm, T. M. et al. Global loss of imprinting leads to widespread tumorigenesis in adult mice. Cancer Cell 8, 275?285 (2005). 20. Okano, M.,Bell,D. W.,Haber, D. A.& Li,E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 99, 247?257 (1999). 21. Stewart, C. L., Stuhlmann, H., Ja�hner, D. & Jaenisch, R. De novo methylation, expression, and infectivity of retroviral genomes introduced into embryonal carcinoma cells. Proc. Natl Acad. Sci. USA 79, 4098?4102 (1982). 22. Ja�hner, D. et al. De novo methylation and expression of retroviral genomes during mouse embryogenesis. Nature 298, 623?628 (1982). 23. Maherali, N. et al. Global epigenetic remodeling in directly reprogrammed fibroblasts. Cell Stem Cells (in the press).. a b c d e O16 O9-1 O9-2 +? Oct4 virus c-myc virus Oct4-GFPneo allele f Blastocysts E10 embryos O16 Figure 5 | Developmental pluripotency of reprogrammed fibroblasts. a,A 6-week-old chimaeric mouse. Agouti-coloured hairs originated from Oct4 iPS cell line O18.1. b, c, Two live pups after 2N blastocyst injection, one of which shows a high contribution (c) of the TTF-derived Oct4 iPS cell line TT-O25, which had been GFP-labelled with a lentiviral ubiquitin-EGFP vector. d, ?All iPS cell embryos? were generated by injection of iPS cells into 4Nblastocysts 34 . LiveE12.5embryosgeneratedfromOct4iPS lineO6(left), fromNanogiPSlineN14(middle)andfromV.6.5EScells(right)areshown. e, A normally developed E14.5 embryo was derived from Oct4 iPS cell line O4-16aftertetraploidcomplementationandwasisolatedbyscreeningMEFs for activation of GFP inserted into the Oct4 locus. f, Germline contribution of Oct4 iPS clones O9 and O16. Genotyping of blastocysts from females mated with three chimaeric males demonstrated the presence of Oct4 and c-myc virus integrations and the Oct4-IRES-GFPneo allele (left panel). Because of the multiple integrations (Fig. 4a) all embryos with iPS cell contribution are expectedto be positive for proviral sequences in this assay. In contrast, thesingle-copyOct4-IRES-GFPneo allele segregatedinto only 5 of the9 virus-positive embryos. All six blastocysts from O9 chimaera1 were iPS-cell-derived, suggesting that this chimaera was a pseudo-male. Additionalgenotypingidentified13outof72testedblastocystsderivedfrom iPS line O9 and 4 out of 13 blastocysts derived from iPS line O16 chimaeras carryingtheviraltransgenes.Therightpanelshowsthat3outof8testedE.10 mid-gestationembryosweresiredbyachimaeraderivedfromthedonoriPS line O16. 1, positive control; 2, negative control. NATURE|Vol 448|19 July 2007 ARTICLES 323 Nature �2007 Publishing Group 24. Mitsui, K. et al. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113, 631?642 (2003). 25. Chapman,V.,Forrester,L.,Sanford,J.,Hastie,N.&Rossant,J.Celllineagespecific undermethylation of mouse repetitive DNA. Nature 307, 284?286 (1984). 26. Walsh, C. P., Chaillet, J. R. & Bestor, T. H. Transcription of IAP endogenous retrovirusesisconstrainedbycytosinemethylation.NatureGenet.20,116?117(1998). 27. Blelloch,R.etal.Reprogrammingefficiencyfollowingsomaticcellnucleartransfer is influenced by the differentiation and methylation state of the donor nucleus. Stem Cells 24, 2007?2013 (2006). 28. Lucifero, D., Mertineit, C., Clarke, H. J., Bestor, T. H. & Trasler, J. M. Methylation dynamicsofimprintedgenesinmousegermcells.Genomics79,530?538(2002). 29. Hochedlinger,K.,Yamada,Y.,Beard,C.&Jaenisch,R.EctopicexpressionofOct-4 blocks progenitor-cell differentiation and causes dysplasia in epithelial tissues. Cell 121, 465?477 (2005). 30. Wernig,M.etal.Functionalintegrationofembryonicstemcell-derivedneuronsin vivo. J. Neurosci. 24, 5258?5268 (2004). 31. Brambrink,T.,Hochedlinger,K.,Bell,G.&Jaenisch,R.EScellsderivedfromcloned and fertilized blastocysts are transcriptionally and functionally indistinguishable. Proc. Natl Acad. Sci. USA 103, 933?938 (2006). 32. Eads, C. A. & Laird, P. W. Combined bisulfite restriction analysis (COBRA). Methods Mol. Biol. 200, 71?85 (2002). 33. Peitz, M., Pfannkuche, K., Rajewsky, K. & Edenhofer, F. Ability of the hydrophobic FGF and basic TAT peptides to promote cellular uptake of recombinant Cre recombinase: a tool for efficient genetic engineering of mammalian genomes. Proc. Natl Acad. Sci. USA 99, 4489?4494 (2002). 34. Eggan, K. et al. Hybrid vigor, fetal overgrowth, and viability of mice derived by nuclearcloningandtetraploidembryocomplementation.Proc.NatlAcad.Sci.USA 98, 6209?6214 (2001). Supplementary Information is linked to the online version of the paper at www.nature.com/nature. Acknowledgements We thank H. Suh, D. Fu and J. Dausman for technical assistance;J.Loveforhelpwiththemicroarrayanalysis;S.Markoulakiforhelpwith blastocyst injections; F. Edenhofer for a gift of Tat-Cre; and S. Yamanaka for the Nanog-neo construct. We acknowledge L. Zagachin in the MGH Nucleic Acid Quantitation core for assistance with real-time PCR. We also thank C. Lengner, C. Beard and M. Creyghton for constructive criticism. M.W. was supported in part by fellowships from the Human Frontiers Science Organization Program and the EllisonFoundation;B.B.bygrantsfromtheBurroughsWellcomeFund,theHarvard Stem Cell Institute and the NIH; and R.J. by grants from the NIH. Author Contributions M.W., A.M. and R.J. conceived and designed the experiments and wrote the manuscript; M.W. derived all iPS lines; M.W. and A.M. performedtheinvitroandinvivocharacterizationoftheiPSlines(teratoma,2Nand 4N injections and IHC) and the conditional Dnmt1 experiment; A.M. investigated the promoter and imprinting methylation; M.K. and B.B. performed and analysed the real-time PCRs and ChIP experiments; R.F. and K.H. generated the selectable MEFsandTTFs;R.F.performedwesternblotandPCRanalyses;andT.B.performed the microarray analysis and the proviral integration Southern blots. Author Information All microarray data from this study are available from Array Express at the EBI (http://www.ebi.ac.uk/arrayexpress) under the accession number E-MEXP-1037. Reprints and permissions information is available at www.nature.com/reprints. The authors declare no competing financial interests. Correspondence and requests for materials should be addressed to R.J. (jaenisch@wi.mit.edu). ARTICLES NATURE|Vol 448|19 July 2007 324 Nature �2007 Publishing Group METHODS Cell culture, MEF isolation, gene targeting and viral infections. ES and iPS cellswerecultivatedonirradiatedMEFsinDMEcontaining15%fetalcalfserum, leukaemia inhibiting factor (LIF), penicillin/streptomycin, L-glutamine, and non-essential aminoacids. Allcellswere depletedof feeder cellsfor twopassages on 0.2% gelatin before RNA, DNA or protein isolation. Transgenic MEFs were isolated and selected in 2mgml 21 puromycin (Sigma) from E13.5 chimaeric embryosafterblastocystinjectionofOct4-inducibleKH2EScells 29 thathadbeen previously targeted with either Oct4-IRES-GFPneo or Nanog-neo constructs (Fig. 1a and ref. 24). Using homologous recombination in ES cells, an IRES- GFPneofusioncassettewasinsertedintotheBclIsitedownstreamofOct4exon5. Correctly targeted ES cell clones were screened by Southern analysis of NcoI- digested DNAusing a 59external probe.The murine cDNAsfor Oct4, Sox2, Klf4 andc-mycwerePCRamplifiedfromEScellcDNA,sequence-verifiedandcloned into the Moloney-based retroviral vector pLIB (Clontech). 2310 5 MEFs or TTFs at passage 2?4 were infected overnight with pooled viral supernatant generated by transfection of 4310 6 HEK293T cells (Fugene, Roche) with 10mg of viral vectors and the packaging plasmid pCL-Eco in a 10-cm dish 35 . Blastocystinjection.Diploidortetraploidblastocysts(94?98hafterHCGinjec- tion)wereplacedinadropofDMEMwith15%FCSundermineraloil.Aflat-tip microinjection pipette with an internal diameter of 12?15mm was used for iPS cell injection (using a Piezo micromanipulator 34 ). A controlled number of cells was injected into the blastocyst cavity. After injection, blastocysts were returned to KSOM media and placed at 37uC until transferred to recipient females. Recipient females and caesarean sections. Ten to fifteen injected blastocysts were transferred to each uterine horn of 2.5 days post coitum pseudo-pregnant B6D2F1females.Torecoverfull-termpups,recipientmotherswerekilledat19.5 days post coitum. Surviving pups were fostered to lactating BALB/c mothers. Southern blot, methylation and chromatin analyses. To assess the levels of DNA methylation, genomic DNA was digested with HpaII, and hybridized to pMR150 as a probe for the minor satellite repeats 25 , or with an IAP-probe 26 . BisulphitetreatmentwasperformedwiththeQiagenEpiTectKit.Forthemethy- lation status of Oct4 and Nanog promoters, bisulphite sequencing analysis was performed as described previously 27 . A total of 10?20 clones of each sample was sequenced in both directions. For imprinted genes, a COBRA assay was per- formed. PCR primers and conditions were as described previously 28 . PCR pro- ducts after bisulphite treatment and gel purification were digested with BstUI (CGCG; H19, Peg3 and Snrpn) or HpyCH4 IV (ACGT; Peg1) and resolved on a 2% agarose gel. Unmethylated CpGs in the recognition sequence will be con- verted to T and not cut. The status of bivalent domains was determined by chromatin immunoprecipitation followed by quantitative PCR analysis, as described previously 12 . Expressionanalysis.FiftynanogramsoftotalRNAisolatedusingTRIzolreagent (Invitrogen)wasreverse-transcribedandquantifiedusingtheQuantTtectSYBR green RT?PCR Kit (Qiagen) on a 7000 ABI detection system. Western blot and immunofluorescence analysis wasperformedas described 29,30 . Primaryantibod- ies included Oct4 (monoclonal mouse, Santa Cruz), Nanog (polyclonal rabbit, Bethyl), actin (monoclonal mouse, Abcam) and SSEA1 (monoclonal mouse, Developmental Studies Hybridoma Bank). Fluorophor-labelled secondary anti- bodies were purchased from Jackson Immunoresearch. Microarray targets from 2mg total RNA were synthesized and labelled using the Low RNA Input Linear Amp Kit (Agilent) and hybridized to Agilent whole-mouse genome oligo arrays (G4122F).ArrayswerescannedonanAgilentG2565Bscannerandsignalintens- itieswerecalculatedinAgilentFEsoftware.DatasetswerenormalizedusinganR script (available at http://www.ebi.ac.uk/arrayexpress) and clustered as prev- iously described 31 . Viralintegrations.GenomicDNAwasdigestedwith SpeI(Oct4,c-myc,klf4)or HindIII(Sox2)overnight,followedbyelectrophoresisandtransfer,andtheblots were hybridized to the respective radioactively labelled cDNAs of the four tran- scription factors. Genotyping. Blastocystswere lysedfor 4h in 10ml 50mMTris, pH8.8, contain- ing 1mM EDTA, 0.5% Tween20 and 200mgml 21 proteinase K. After heat inac- tivationfor15min,PCRwasperformedwiththefollowingconditions:95uC30s (1 cycle); 95uC10s,60uC15s,72uC 15 s (40 cycles); 72uC 5 min. Primer sequences for genotyping. GFP-F, TCCATGGCCAACACTAGTCA; GFP-R, TCCCAGAATGTTGCCATCTT; pLIB-FW1, CCCCCTTGAAC- CTCCTCGTTCGAC; Oct4R, GAGGTTCCCTCTGAGTTGCTTT; MycR, CGAATTTCTTCCAGATATCCTCAC. Primer sequences for viral-specific qRT?PCR. rtKlf4_virusF1, TCTCTA- GGCGCCGGAATTC; rtKlf4_virusR1, CCATGTCAGACTCGCCAGGT; rtMyc_virusF1, CTTCTCTAGGCGCCGGAATT; rtMyc_virusR1, TGGT- GAAGTTCACGTTGAGGG; rtOct4_virusF1, TACACCCTAAGCCTCCGCCT; rtOct4_virusR1, ATTCCGGCGCCTAGAGAAG; rtSox2_virusF1, TACACCC- TAAGCCTCCGCCT; rtSox2_virusR1, ATTCCGGCGCCTAGAGAAG. Dnmt1 hairpin target sequence DZ. GGAAAGAGATGGCTTAACA. 35. Naviaux, R.K.,Costanzi,E.,Haas,M.&Verma,I.M.ThepCLvectorsystem:rapid production of helper-free, high-titer, recombinant retroviruses. J. Virol. 70, 5701?5705 (1996). doi:10.1038/nature05944 Nature �2007 Publishing Group "
Add Content to Group
|
Bookmark
|
Keywords
|
Flag Inappropriate
HOME
LIBRARY
Library
Visual Browse
Close