This page has been archived and is no longer updated
MicroRNAs: small RNAs with a big role in gene regulation
Author: Lin He
Keywords
Keywords for this Article
Add keywords to your Content
Save
|
Cancel
Share
|
Cancel
Revoke
|
Cancel
Rate & Certify
Rate Me...
Rate Me
!
Comment
Save
|
Cancel
Flag Inappropriate
The Content is
Objectionable
Explicit
Offensive
Inaccurate
Comment
Flag Content
|
Cancel
Delete Content
Reason
Delete
|
Cancel
Close
Full Screen
"522 | JULY 2004 | VOLUME 5 www.nature.com/reviews/genetics REVIEWS The discovery of miRNAs The founding member of the miRNA family, lin-4,was identified in C. elegans through a genetic screen for defects in the temporal control of post-embryonic dev- elopment 10,11 .In C. elegans,cell lineages have distinct characteristics during 4 different larval stages (L1?L4). Mutations in lin-4 disrupt the temporal regulation of larval development, causing L1 (the first larval stage)- specific cell-division patterns to reiterate at later devel- opmental stages 10 .Opposite developmental phenotypes ? omission of the L1 cell fates and premature develop- ment into the L2 stage ? are observed in worms that are deficient for lin-14 (REF. 12).Even before the molecular identification of lin-4 and lin-14,these loci were placed in the same regulatory pathway on the basis of their opposing phenotypes and antagonistic genetic interac- tions 11 .Most genes identified from mutagenesis screens are protein-coding, but lin-4 encodes a 22-nucleotide non-coding RNA that is partially complementary to 7 conserved sites located in the 3?-untranslated region (UTR) of the lin-14 gene (FIG. 1b) 13,14 . lin-14 encodes a nuclear protein, downregulation of which at the end of the first larval stage initiates the developmental progres- sion into the second larval stage 13,15 .The negative regula- tion of LIN-14 protein expression requires an intact 3? UTR of its mRNA 14 , as well as a functional lin-4 gene 13 .These genetic interactions inspired a series of molecular and biochemical studies demonstrating that Non-coding RNAs participate in a surprisingly diverse collection of regulatory events, ranging from copy- number control in bacteria 1 to X-chromosome inactiva- tion in mammals 2 .MicroRNAs (miRNAs) are a family of 21?25-nucleotide small RNAs that, at least for those few that have characterized targets, negatively regulate gene expression at the post-transcriptional level 3?5 . Members of the miRNA family were initially discovered as small temporal RNAs (stRNAs) that regulate devel- opmental transitions in Caenorhabditis elegans 6 .Over the past few years, it has become clear that stRNAs were the prototypes of a large family of small RNAs, miRNAs, that now claim hundreds of members in worms, flies, plants and mammals. The functions of miRNAs are not limited to the regulation of develop- mentally timed events. Instead, they have diverse expres- sion patterns and probably regulate many aspects of development and physiology 3,4,7?9 .Although the mecha- nisms through which miRNAs regulate their target genes are largely unknown, the finding that at least some miRNAs feed into the RNA INTERFERENCE (RNAi) pathway has provided a starting point in our journey to understand the biological roles of miRNAs. In this review, we revisit the history of miRNAs and summarize recent findings in miRNA biogenesis, trans- lational repression and biological function. We conclude by highlighting the continuing genome-wide efforts to identify novel miRNAs and to predict their targets. MicroRNAs: SMALL RNAs WITH A BIG ROLE IN GENE REGULATION Lin He and Gregory J. Hannon MicroRNAs are a family of small, non-coding RNAs that regulate gene expression in a sequence-specific manner. The two founding members of the microRNA family were originally identified in Caenorhabditis elegans as genes that were required for the timed regulation of developmental events. Since then, hundreds of microRNAs have been identified in almost all metazoan genomes, including worms, flies, plants and mammals. MicroRNAs have diverse expression patterns and might regulate various developmental and physiological processes. Their discovery adds a new dimension to our understanding of complex gene regulatory networks. Cold Spring Harbor Laboratory, Watson School of Biological Sciences, 1 Bungtown Road, Cold Spring Harbor, New York 11724, USA. Correspondence to G.J.H. e-mail: hannon@cshl.edu doi:10.1038/nrg1379 RNA INTERFERENCE (RNAi). A form of post- transcriptional gene silencing, in which dsRNA induces degradation of the homologous mRNA, mimicking the effect of the reduction, or loss, of gene activity. NATURE REVIEWS | GENETICS VOLUME 5 | JULY 2004 | 523 REVIEWS conservation strongly indicated a more general role of small RNAs in developmental regulation, as supported by the recent characterization of miRNA functions in many metazoan organisms. miRNAs and siRNAs ? what?s the difference Hundreds of miRNAs have now been identified in vari- ous organisms, and the RNA structure and regulatory mechanisms that have been characterized in lin-4 and let-7 still provide unique molecular signatures as to what defines miRNAs. miRNAs are generally 21?25nucleotide, non-coding RNAs that are derived from larger precur- sors that form imperfect stem-loop structures (FIG. 1a) 4,5 . The mature miRNA is most often derived from one arm of the precursor hairpin, and is released from the pri- mary transcript through stepwise processing by two ribonuclease-III (RNase III) enzymes 28,29 .At least in ani- mals, most miRNAs bind to the target-3? UTR with imperfect complementarity and function as translational repressors (see below for a discussion of plant miRNAs) 4 . Almost coincident with the discovery of the second miRNA, let-7, small RNAs were also characterized as components of a seemingly separate biological process, RNA interference (RNAi). RNAi is an evolutionarily conserved, sequence-specific gene-silencing mechanism that is induced by exposure to dsRNA 30 .In many sys- tems, including worms, plants and flies, the stimulus that was used to initiate RNAi was the introduction of a dsRNA (the trigger) of ~500 bp. The trigger is ultimately processed in vivo into small dsRNAs of ~21?25 bp in length, designated as small interfering RNAs (siRNAs) 31,32 . It is now clear that one strand of the siRNA duplex is selectively incorporated into an effector complex (the RNA-induced silencing complex; RISC). The RISC directs the cleavage of complementary mRNA targets, a process that is also known as post-transcriptional gene silencing (PTGS) (FIG. 2) 33 .The evolutionarily conserved RNAi response to exogenous dsRNA might reflect an endogenous defense mechanism against virus infection or parasitic nucleic acids 30 .Indeed,mutations of the RNAi components greatly compromise virus resistance in plants, indicating that PTGS might normally mediate the destruction of the viral RNAs 34 .In addition, siRNAs can also regulate the expression of target transcripts at the transcriptional level, at least in some organisms. Not only can siRNAs induce sequence-specific promoter methylation in plants 35,36 ,but they are also crucial for heterochromatin formation in fission yeast 37,38 , and transposon silencing in worms 39,40 . Fundamentally, siRNAs and miRNAs are similar in terms of their molecular characteristics, biogenesis and effector functions (see below for details). So, the current distinctions between these two species might be arbi- trary, and might simply reflect the different paths through which they were originally discovered. miRNAs and siRNAs share a common RNase-III processing enzyme, Dicer, and closely related effector complexes, RISCs, for post-transcriptional repression (FIG. 2).In fact, much of our current knowledge of the biochemistry of miRNAs stems from what we know about siRNAs and the RNAi pathway. the direct, but imprecise, base pairing between lin-4 and the lin-14 3? UTR was essential for the ability of lin-4 to control LIN-14 expression through the regulation of protein synthesis 16?18 .Through an analogous mecha- nism, lin-4 also negatively regulates the translation of lin-28, a cold-shock-domain protein that initiates the developmental transition between the L2 and L3 stages 19 .Compared with lin-14, lin-28 has fewer lin-4 binding sites, which might lead to its translational repression being delayed following lin-4 expression owing to less efficient lin-4 binding 6,19 . The discovery of lin-4 and its target-specific transla- tional inhibition hinted at a new mechanism of gene reg- ulation during development. In 2000, almost 7 years after the initial identification of lin-4,the second miRNA, let-7, was discovered, also using forward genetics in worms. let-7 encodes a temporally regulated 21-nucleotide small RNA that controls the developmental transition from the L4 stage into the adult stage 20?22 .Similar to lin-4, let-7 performs its function by binding to the 3? UTR of lin-41 and hbl-1 (lin-57), and inhibiting their translation 20?24 . The identification of let-7 not only provided another vivid example of developmental regulation by small RNAs, but also raised the possibility that such RNAs might be present in species other than nematodes. Unlike lin-4, the orthologues of which in flies and mam- mals initially escaped bioinformatic searches, and were only recognized recently 25,26 ,both let-7 and lin-41 are evolutionarily conserved throughout metazoans, with homologues that were readily detected in molluscs, sea urchins, flies, mice and humans 27 .This extensive UCCCUGAGACCUCAAGUGUGA CCUG CCC GAGA CUCA GUGUGA GUA GGAC GGG CUCU GGGU CACACUUCGU A CAU C C C AG GUUU C A GU U U A CU lin-4 pre-miRNA lin-4 miRNA CG A A U AC G C U C AUUCAAAACUCAGGA UGAGU GAGUCCU UCAUGCUCUCAGGA CA A UC AGUGUGAGAGUCCU AU A A A C C U CA UC C UCGCAUUU AGUGUGAA CUCAGGGA GAGUCCCU ORF RISC RISC RISC RISC RISC RISC RISC A A A C C CU A C A C A C UCUACCUCAGGGA AGGUGGAGUCCCU CAU C A U C G C UCAUUGAACUCAGGA AGUG GAGUCCU A UGUGA AGUCCU C G A C C G U C UUAUGUUAAAAUCAGGA a b lin-14 Ribosome A A A G C polyA 22nt U U G AGUGU GAGUCCCU UCACAACCAACUCAGGGA Figure 1 | The molecular hallmarks of lin-4, the founding member of the microRNA family. a | The precursor structure and mature microRNA (miRNA) sequence of lin-4. b | Sequence complementarity between lin-4 (red) and the 3?-untranslated region (UTR) of lin-14 mRNA (blue). lin-4 is partially complementary to 7 sites in the lin-14 3? UTR; its binding to these sites of complementarity brings about repression of LIN-14 protein synthesis 13,18 . RISC, RNA-induced silencing complex. 524 | JULY 2004 | VOLUME 5 www.nature.com/reviews/genetics REVIEWS The artificial nature of current distinctions between siRNA and miRNA is highlighted by numerous recent findings. The extent of complementarity between the siRNA/miRNA and its target can determine the mecha- nism of silencing. For example, with the exception of miR-172,which acts as a translational repressor, all char- acterized plant miRNAs anneal to their targets with nearly complete complementarity at a single site, either in the coding region or in the UTRs, therefore condemning their target mRNAs to destruction by cleavage and degra- dation 41? 43 .A similar situation has also been described for one mammalian miRNA, miR-196: the nearly perfect base pairing between miR-196 and Hoxb8 directs cleavage of Hoxb8 mRNA both in mouse embryos and in cell cul- ture 44 .Conversely, when siRNAs pair with their targets imperfectly, siRNAs can trigger translational repression rather than mRNA cleavage in mammalian tissue cul- ture 45 .So, we are left with the question of whether miRNAs are truly different from siRNAs or whether our current understanding fails to functionally distinguish these two species under physiological conditions. Both miRNAs and siRNAs depend on Dicer for their maturation 46,47 , and both have been shown to be part of similar RISCs (FIG. 2) 48,49 .However, the effector com- plexes have only been studied for a few miRNAs, and in no case has there been biochemical data to confirm that most miRNA-containing complexes have been accounted for 50,51 .So, as we get beyond the superficial similarities of the structure and functions of these small RNAs, we must now begin to focus on the details that distinguish the modes of action of siRNAs and miRNAs in vivo to understand their true biological functions. Biogenesis of miRNAs Two processing events lead to mature miRNA formation in animals. In the first, the nascent miRNA transcripts (pri-miRNA) are processed into ~70-nucleotide precur- sors (pre-miRNA); in the second event that follows, this precursor is cleaved to generate ~21?25-nucleotide mature miRNAs 29 . Little is known about the transcrip- tional regulation of pri-miRNAs, except that certain pri- miRNAs are located within introns of host genes, including both protein-coding genes and non-coding genes, and might therefore be transcriptionally regu- lated through their host-gene promoters 52 .In addition, certain miRNAs are clustered in polycistronic tran- scripts, indicating that these miRNAs are coordinately regulated during development 52 . The sequential cleavages of miRNA maturation are catalysed by two RNase-III enzymes, Drosha and Dicer (FIG. 2) 28,47 .Both are dsRNA-specific endonucleases that generate 2-nucleotide-long 3? overhangs at the cleavage site. Drosha is predominantly localized in the nucleus and contains two tandem RNase-III domains, a dsRNA binding domain and an amino-terminal segment of unknown function 28 .Regardless of the diverse primary sequences and structures of pri-miRNAs, Drosha cleaves these into ~70-bp pre-miRNAs that consist of an imperfect stem-loop structure (FIG. 2) 28 .Although the precise mechanisms that Drosha uses to discriminate miRNA precursors remain unknown, several studies On the other hand, miRNAs differ from siRNAs in their molecular origins and, in many of the cases that have been characterized so far, in their mode of target recognition. miRNAs are produced as a distinct species from a specific precursor that is encoded in the genome. The structure of the primary miRNA transcript and the recognition of this precursor by a nuclear process- ing machinery probably determines the sequence and structure of mature miRNAs 4 .By contrast, siRNAs are sampled more randomly from long dsRNAs that can be introduced exogenously or produced from bi-direction- ally transcribed endogenous RNAs that anneal to form dsRNA 30 .In many cases, miRNAs bind to the target 3? UTRs through imperfect complementarity at multi- ple sites, and therefore negatively regulate target expres- sion at the translational level. By contrast, siRNAs often form a perfect duplex with their targets at only one site, and therefore direct the cleavage of the target mRNAs at the site of complementarity (FIG. 2). Some miRNA ORF RISC RISC RISC Ribosome Cytoplasm Nucleus dsRNA Unwind miRNA: miRNA* duplex siRNA duplex Asymmetric RISC assembly Translational repression mRNA cleavage Target mRNA Pre-miRNA Pri-miRNA miRNA Gene Exportin 5 Dicer Drosha RISC RISC Figure 2 | The current model for the biogenesis and post-transcriptional suppression of microRNAs and small interfering RNAs. The nascent pri-microRNA (pri-miRNA) transcripts are first processed into ~70-nucleotide pre-miRNAs by Drosha inside the nucleus. Pre-miRNAs are transported to the cytoplasm by Exportin 5 and are processed into miRNA:miRNA* duplexes by Dicer. Dicer also processes long dsRNA molecules into small interfering RNA (siRNA) duplexes. Only one strand of the miRNA:miRNA* duplex or the siRNA duplex is preferentially assembled into the RNA-induced silencing complex (RISC) , which subsequently acts on its target by translational repression or mRNA cleavage, depending, at least in part, on the level of complementarity between the small RNA and its target. ORF, open reading frame. NATURE REVIEWS | GENETICS VOLUME 5 | JULY 2004 | 525 REVIEWS miRNA*) that contains both the mature miRNA strand and its complementary strand (miRNA*) 47,55,56 .Dicer contains a putative helicase domain, a DUF283 domain, a PAZ (Piwi?Argonaute?Zwille) domain, two tandem RNase-III domains and a dsRNA-binding domain (dsRBD) (FIG. 3a) 46 .Recent structural analysis of the PAZ domain revealed a variant of the OB fold, a module that allows a low-affinity interaction with the 3? end of ssRNAs 57?59 .This association also allows the PAZ domain to interact with dsRNAs that present 2-nucleo- tide 3? overhangs, such as those that result from Drosha cleavage 51,57,58 .In addition, efficient Dicer cleavage also requires the presence of the overhang and a minimal stem length (D. Siolas and G.J.H., unpublished observa- tions), indicating a model in which the Dicer PAZ domain might recognize the end of the Drosha cleavage product, and therefore position the site of the second RNase-III cleavage on the stem of the miRNA precur- sors 60 .Dicer cleavage generates mature miRNAs that range from 21 to 25 nucleotides, and such differences in size possibly result from the presence of bulges and mis- matches on the pre-miRNA stem. During Dicer processing, efficient cleavage of dsRNA requires dimerized RNase-III domains, because, on the basis of known RNAse-III structures, functional cat- alytic sites can only be formed at the interface of the RNase-III dimer 61 .As Dicer might only catalyse one cleavage event during miRNA processing, it is probable that Dicer functions as a monomer with its two RNase-III domains forming an intramolecular dimer and that it generates an active catalytic site for dsRNA cleavage 60 . Similar to Dicer, Drosha also contains two tandem RNase-III domains and carries out a single cleavage event to generate pre-miRNA. Given our lack of knowl- edge about the precise structural elements that guide Dicer and Drosha cleavage, it is difficult to speculate about their exact biochemical mechanisms. However, it is probable that Drosha and Dicer share closely related mechanisms for the processing of miRNAs. Although plant miRNAs seem to be produced from long, primary transcripts, the maturation of miRNAs in plants must, by necessity, occur differently from miRNA maturation in animals, as no plant Drosha homologue has yet been found. However, the Dicer family in Arabidopsis thaliana has a level of complexity that has not been observed in other organisms studied so far (FIG. 3b).There are four Dicer homologues in A. thaliana ? DCL1, DCL2, DCL3 and DCL4 ? two of which (DCL1 and DCL4) contain nuclear localization signals (FIG. 3a).Therefore, it seems possible that Drosha func- tion might be carried out by one or more specialized Dicer enzymes in plants. The Dicer homologue DCL1 contains two nuclear localization signals, and predomi- nates the nuclei when expressed as a GFP-fusion protein in transient-transfection studies 62 .In plants that are deficient for DCL1, the production of mature miRNAs is reduced for all miRNAs examined, yet no accumula- tion is detected for the corresponding pre-miRNAs 62,63 . These findings imply that DCL1 might catalyse both the Drosha- and Dicer-like cleavages for the maturation of some, if not most, miRNAs inside the nucleus. have addressed the features of pri-miRNAs that con- tribute to Drosha cleavage both in vitro and in vivo 28,53 . The efficiency of Drosha processing depends on the ter- minal loop size, the stem structure and the flanking sequence of the Drosha cleavage site, because shortening of the terminal loop, disruption of complementarity within the stem and removal or mutation of sequences that flank the Drosha cleavage site significantly decrease, if not abolish, the Drosha processing of pri-miRNAs 28,53 . After the initial cleavage by Drosha, pre-miRNAs are exported from the nucleus into the cytoplasm by Exp- ortin 5 (Exp5), a Ran-GTP dependent nucleo/cyto- plasmic cargo transporter (FIG. 2) 54 . Once inside the cytoplasm, these hairpin precursors are cleaved by Dicer into a small, imperfect dsRNA duplex (miRNA: BOOTSTRAP SAMPLING As applied to molecular phylogenies, nucleotide or amino-acid sites are sampled randomly, with replacement, and a new tree is constructed. This is repeated many times and the frequency of appearance of a particular node among the bootstrap trees is viewed as a support (confidence) value for deciding on the significance of that node. NLS DUF283 Helicase RIIIa, RIIIb PAZ dsRBD C. elegans dcr-1 a b D. melanogaster Dicer-1 D. melanogaster Dicer-2 Mammal DCR-1 A. thaliana DCL-1 A. thaliana DCL-2 A. thaliana DCL-3 A. thaliana DCL-4 C. elegans dcr-1 D. melanogaster Dicer-1 D. melanogaster Dicer-2 S. pombe Dicer M. Musculus DCR-1 H. Sapiens DCR-1 A. thaliana DCL-1 A. thaliana DCL-2 A. thaliana DCL-3 A. thaliana DCL-4 88 93 96 Figure 3 | The structure and function of the Dicer family. a | The domain structure of Dicer homologues in worms, flies, mammals and plants. The Dicer homologues that function in the microRNA (miRNA) maturation pathway have the PAZ (Piwi?Argonaute?Zwille) domain. b | The phylogenetic tree of the Dicer protein family. Multiple sequence alignment was done using ClustalW (version 1.80). PHYLIP95 (see online links box) was used to do BOOTSTRAP SAMPLING, protein-distance calculation (using Dayhoff PAM distance) and tree construction. Bootstrap percentages are indicated at each fork when the percentage is below 100. A. thaliana, Arabidopsis thaliana; C. elegans, Caenorhabditis elegans; D. melanogaster, Drosophila melanogaster; H. sapiens, Homo sapiens; M. musculus, Mus musculus; RBD, RNA binding domain; S. pombe, Schizosaccharomyces pombe. 526 | JULY 2004 | VOLUME 5 www.nature.com/reviews/genetics REVIEWS strand with the less stable 5? end compared with the miRNA* strand 71,72 .These findings indicate that the rel- ative instability at the 5? end of the mature miRNA might facilitate its preferential incorporation into the RISC. The selective assembly of the mature miRNA into the RISC probably reflects the relative ease of unwind- ing from one end of the miRNA: miRNA* duplex (FIG. 2) 71,72 .Therefore, the thermodynamic properties of the miRNA precursor determine the asymmetrical RISC assembly, and therefore, the target specificity for post- transcriptional inhibition. However, in rare cases in which miRNA and miRNA* have similar 5?-end stabil- ity, each arm of the miRNA precursor is predicted to be assembled into the RISC at similar frequencies. This prediction has been confirmed by similar recovery rates for such miRNAs and miRNA*s from endogenous tis- sues 71 .This thermodynamic model also applies to the asymmetrical assembly of the siRNA duplex, in which the strand of siRNA with the less stable 5? end is prefer- entially assembled into the RISC complex to target mRNA cleavage 71,72 .Altogether, there seems to be a common thermodynamic mechanism that regulates the asymmetric assembly of siRNA or miRNA from the dsRNA duplexes, which safeguards specificity towards corresponding targets. Post-transcriptional repression by miRNAs The precise molecular mechanisms that underlie post- transcriptional repression by miRNAs still remain largely unknown. One of the best-studied examples is lin-4,which negatively regulates its target, lin-14, by repressing its translation 16 .Base pairing between lin-4 and lin-14 has proved to be crucial for their interaction in vivo, as mutations that affect their complementarity compromise or abolish this negative regulation 13 . Interestingly, lin-4 only inhibits the synthesis of the LIN-14 protein but fails to affect the synthesis, poly- adenylation state or abundance of lin-14 mRNA 16 .Fur- thermore, the initiation of lin-14 translation seems to occur normally in the presence of lin-4, because lin-14 mRNAs are efficiently incorporated into polyribosomes regardless of lin-4 expression 16 .Therefore, it is reasonable to speculate that the translational repression by lin-4 occurs after translational initiation, probably during translational elongation and/or the subsequent release of the LIN-14 protein 16 . Translational repression of target genes is not specific to lin-4; in fact, it turns out to be the predominant mechanism by which miRNAs negatively regulate their targets throughout the animal kingdom. let-7 and Bantam (which encodes an anti-apoptotic miRNA) bind to the 3? UTRs of their targets and negatively regulate their translation in worms and flies, respectively 20,73 .In addition, miR-30,a mammalian miRNA, inhibits protein synthesis of a reporter gene that bears an artificial 3? UTR with miR-30 complementary sites 53 . Although most animal miRNAs repress target trans- lation, one miRNA, mir-196, was found recently to direct mRNA cleavage of its target, Hoxb8 (REF. 44).In plants, however, most miRNAs that have been studied so far mediate the destruction of their target mRNAs 74 .These Consistent with this model, mature miRNAs seem to be produced within the nucleus in plants, because nuclear expression of P19, a viral protein that represses the accu- mulationof siRNAs and miRNAs, results in a significant reduction in mature miRNAs, whereas the cytoplasmic expression of P19 has no such effects 62 .It is not clear whether other Dicer homologues in plants are also involved in miRNA maturation. However, it has been speculated that the presence of multiple plant Dicer enzymes might explain the complexity of siRNA species in plants. Unlike siRNAs in animals, which are usually 21?22 nucleotides long, plants generate two classes of siRNA: 21?22- and ~25-bp-long siRNAs 64 .Given the different classes of small dsRNAs found in plants, it is possible that each Dicer homologue regulates separate cleavage events to generate specific species of dsRNA duplexes 65 . The functional specificity of different Dicer enzymes in organisms with multiple Dicer homologues has recently been indicated by a series of genetic and bio- chemical studies in Drosophila melanogaster 66,67 .Two Dicer homologues have been identified in flies: Dicer1 and Dicer2 (FIG. 3a) 67 .Deficiency in Dicer1 disrupts the processing of pre-miRNAs, whereas loss of Dicer2 affects the production of siRNAs, but not miRNA matu- ration 67 .These findings are consistent with the fact that the PAZ domain is only present in Dicer1, but absent in Dicer2 (FIG. 3a),given a model in which the PAZ domain recognizes the staggered ends of pre-miRNAs 67 and mediates their cleavage. Both Dicer1 and Dicer2 seem to function downstream of miRNA and siRNA production to facilitate the RISC-mediated gene silencing. Originally indicated by physical interactions between Dicer and RISC in D. melanogaster 68 , this model has recently gained concrete biochemical support. Dicer2 forms a complex with R2D2, a dsRNA-binding protein, and the formation of the Dicer2/R2D2 complex with siRNAs enhances sequence-specific mRNAdegradation that is mediated by the RISC complex 69,70 .In addition, Dicer1 deficiency affects siRNA-mediated gene silencing without disrupt- ing siRNA production, indicating a possible role of Dicer1 in enhancing RNAi effector activity 67 .Therefore, the functions of Dicer might be broader than previously suspected, involving both the initiationand the effector steps of miRNA/siRNA-mediated gene silencing. The effector complex for miRNAs shares core com- ponents with that of siRNAs, so much so that both are collectively referred to as the RNA-induced silencing complex (RISC). The target specificity, and probably also the functional efficiency, of a miRNA requires that the mature miRNA strand from the miRNA:miRNA* duplex be selectively incorporated into the RISC for tar- get recognition 71,72 .The miRNA* strand, on the other hand, is probably degraded rapidly on its exclusion from the RISC, as the recovery rate of miRNA*s from endoge- nous tissues is ~100-fold lower than that of miRNAs 71 . As Dicer processes the pre-miRNA into the miRNA: miRNA* duplex, the stability of the 5? ends of the two arms of the miRNA:miRNA* duplex is usually different. Although mature miRNAs can reside on either strand of the hairpin stem, it is almost always derived from the NATURE REVIEWS | GENETICS VOLUME 5 | JULY 2004 | 527 REVIEWS and/or RNAi phenotypes 75 .As a core component of the RISC, the AGO family has multiple homologues in each metazoan species (24 for C. elegans,5 for D. melanogaster and 8 for mammals) 75 .Given the diverse mutant phenotypes and expression patterns of AGO homologues, RISCs might come in different flavours and act in a tissue-specific or a developmentally regulated manner. In addition to AGO homologues, several other pro- teins have also been co-purified with the RISC. It is not clear, however, whether these RISC-associated proteins are core RISC components or whether they act as accessory proteins that provide functional specificity for the RISCs under different developmental and/or physiological contexts. The RNA-binding proteins VIG and Fragile X-related protein 49,68 , and the nuclease Tudor-SN, have been co-purified with RISC activity from D. melanogaster S2 CELL extracts 76 .Such compo- nents also associate with siRNAs and miRNAs in mam- malian cells and C. elegans 76 .Alternative RISCs must also exist, as the helicases Gemin3 and Gemin4 have been co-purified with miRNAs and the human Argo- naute homologue eIF2C2 (AGO2) 50 from mam- malian cells. These observations are consistent with the model according to which RISCs exist in different subtypes, perhaps specialized to mediate different post-transcriptional repression events in vivo. plant miRNAs differ from animal miRNAs in that their base pairing with the corresponding targets is nearly per- fect, and that their complementary sites are located throughout the transcribed regions of the target gene, instead of being limited to the 3? UTRs. So far, only one plant miRNA, miR-172, has been shown to act as a trans- lational repressor during A. thaliana flower develop- ment. Unlike most characterized animal miRNAs, the site of miR-172 complementarity (which is high) within the target gene APETALA 2 (AP2) was located in the coding region instead of the 3? UTR 41 .An important caveat to these observations is that those plant miRNAs that act through RNA cleavage might be overrepre- sented in the current studies owing to the ease of their target identification through computational analysis (see below). Despite progress in identifying protein and RNA components of the RISC, the biochemical mechanism by which this complex functions still remains unknown. Genetic screens combined with biochemical purifica- tion have pinpointed several important components. Argonaute (AGO) proteins belong to an evolutionarily conserved family that is defined by the presence of a PAZ domain and a Piwi domain 75 .AGO-family proteins have been consistently co-purified with RISC activity in many organisms 48 , and mutations in AGO homo- logues have been associated with distinct developmental Table 1 | Expression studies on mammalian microRNAs Expression pattern microRNA References Tissue-specific expression patterns of mammalian microRNAs ES-cell specific miR-296 86 Expressed in ES cells, but miR-21 and miR-22 86 upreguated on differentiation Expressed in both ES cells miR-15a, miR-16, miR-19,b, miR-92, miR-93, 86 and various adult tissues miR-96, miR-130 and miR-130b Enriched during mouse miR-128, miR-19b, miR-9, miR-125b, miR-131, 26,90 brain development miR-178, miR-124a, miR-266 and miR-103 Enriched in adult brain miR-9*, miR-125a, miR-125b, miR-128, miR-132, miR-137, 26 miR-139, miR-7, miR-9, miR-124a, miR-124b, miR-135, miR-153, miR-149, miR-183, miR-190 and miR-219 Enriched in lung miR-18, miR-19a, miR-24, miR-32, miR-130, miR-213, 26 miR-20, miR -141, miR-193 and miR-200b Enriched in spleen miR-99a, miR-127, miR-142-a, miR-142-s, miR-151, 26 miR-189 and miR-212 Haemetopoietic tissues miR-181, miR-223 and miR-142 26 Enriched in liver miR-122a, miR-152, miR-194, miR-199 and miR-215 26 Enriched in heart miR-1b, miR-1d, miR-133, miR-206, miR-208 and miR-143 26 Enriched in kidney miR-30b, miR-30c, miR-18, miR-20, miR-24, miR-32, 26 miR-141, miR-193 and miR-200b Ubiquitously expressed miR-16, miR-26a, miR-27a, miR143a, miR-21, let-7a, 26 miR-7b, miR-30b and miR-30c Abnormal microRNA expression during tumorigenesis Downregulated in chronic miR-15 and miR-16 102 lymphocytic leukaemias Downregulated in lung cancer cell lines miR-26a and miR-99a 89 Downregulated in colon cancers miR143/miR-145 cluster 103 Upregulated in Burkitt lymphoma miR-155 88 ES cells, embryonic stem cells. 528 | JULY 2004 | VOLUME 5 www.nature.com/reviews/genetics REVIEWS developmental stages. In addition to experimental app- roaches, bioinformatic predictions have helped to iden- tify novel miRNAs in various organisms, mostly on the basis of pre-miRNA hairpin structures and sequence conservation throughout evolution 82?84 .With the grow- ing number of experimentally confirmed miRNAs, refined bioinformatic approaches will undoubtedly increase in power for identifying miRNAs that have escaped experimental searches. A comprehensive miRNA registry The global efforts for miRNA cloning and characteriza- tion have led to the establishment of an important col- lection of miRNA data. The miRNA Registry (see online links box) contains up-to-date annotation for all pub- lished miRNAs 81 .Most database entries require experi- mental validation of mature miRNA expression and computational prediction of the corresponding hairpin precursor. In cases in which homologous miRNAs can be easily identified from closely related species, such as mouse and human, computationally predicted entries are also included in the registry to provide a more compre- hensive list 81 .At the time of writing, the database contains 116 C. elegans miRNAs, 50 miRNAs from C. briggsae,78 D. melanogaster miRNAs, 43 A. thaliana miRNAs, 28 miRNA from rice, 207 mouse miRNAs, 185 miRNAs from rat and 191 human miRNAs. Genome-wide efforts for miRNA identification The extension of miRNA-mediated regulation from being a curiosity in C. elegans to a potentially general mechanism for gene regulation began with the work of the Tuschl, Bartel and Ambros groups, who collectively identified more than 100 novel miRNAs by cloning and sequencing endogenous small RNAs of 21?25 bp long from worms, flies and mammals 77?79 . miRNAs that were isolated in these studies show the characteristics of Dicer cleavage, temporally and spatially regulated expres- sion and, in many cases, evolutionary conservation, either throughout metazoans or within closely related species 77?79 .Similar to lin-4 and let-7, these miRNAs mostly map to one arm of their predicted stem-loop precursors. The existence of miRNA precursors with stem-loop structure is also indicated by northern-blot detection of ~70-nucleotide precursors, and by cloning of the rare reverse-strand miRNA 77?79 .In addition to the continued cloning efforts, novel miRNAs have been iso- lated through their association with POLYSOMES 80 and ribonucleoprotein complexes 50,51 .So far, several hun- dred miRNAs have been identified in mammals, fish, flies, worms and plants, corresponding to ~1% of the protein-coding genes in each organism 81 .As the cur- rent miRNA cloning technology clearly favours highly expressed miRNAs, more exhaustive cloning efforts are needed that must include more tissue types and S2 CELL A cell line that is isolated from dissociated Drosophila melanogaster embryos. The cell line is phagocytic, which might contribute to its susceptibility to RNAi. POLYSOME A functional unit of protein synthesis that consists of several ribosomes that are attached along the length of a single molecule of mRNA. Table 2 | microRNAs and their targets: examples of microRNAs with experimentally validated functions/targets microRNA Target gene(s) Function Mode of repression References Caenorhabditis elegans lin-4 lin-14, lin-28 Regulation of developmental transition Translational repression 13,18,19 between the first two larval stages, L1 and L2 let-7 lin-41, hbl-1 Regulation of developmental transition between Translational repression 20?23 the last larval stage (L4) and the adult stage lsy-6 cog-1 Determination of left/right asymmetry of Unknown 9 neuronal development Drosophila melanogaster Bantam hid Promotion of cell proliferation and suppression Translational repression 73 of apoptosis miR-14 Unknown Suppression of apoptosis and regulation of Unknown 97 fat metabolism Mus musculus miR-181 Unknown Promotion of haematopoietic differentiation Unknown 99 towards the B-cell lineage miR-196 Hoxb8 Unknown PTGS 44 Arabidopsis thaliana miR-165, PHB, PHV and REV Regulation of leaf morphogenesis PTGS 104,105 miR-166 miR-172 AP2 Regulation of flowering time and floral-organ identity Translational repression 41 miR-JAW TCP Regulation of leaf development and embryogenesis PTGS 98 transcription factors miR-39 SCL family proteins Unknown PTGS 42 miR-159 MYB33 family Regulation of leaf morphogenesis PTGS 43,63,98 transcription factors Zea mays miR-166 rld1 Regulation of leaf morphogenesis PTGS 106 AP2, APETALA 2; Hid, head involution defective; Hoxb8, homeobox B8; PHB, PHABULOSA; PHV, PHAVOLUTA; PTGS, post-transcriptional gene silencing; REV, REVOLUTA; rld1, rolled leaf1; SCL, SCARECROW-LIKE; TCP, teosinte branched 1-cycloidea-PCF. NATURE REVIEWS | GENETICS VOLUME 5 | JULY 2004 | 529 REVIEWS developmental phenotypes, such as premature MERISTEM differentiation in A. thaliana zwille mutants 94 ,defective embryogenesis and larval development in C. elegans alg-1 and alg-2 mutants 55 and decreased stem-cell self-renewal during oogenesis in Drosophila piwi mutants 95 . Because Dicer and AGO are essential components in miRNA and siRNA biogenesis and function, these defects might reflect the collective functions of multi- ple miRNAs and/or siRNAs that are expressed during early development. So far, functional studies have only touched on a handful of miRNAs. Following the classic studies on the role of lin-4 and let-7 in worm developmental timing, functional characterization of miRNAs continues to ben- efit from the loss-of-function mutations of miRNA genes. The fly miRNA, Bantam, was originally character- ized from a fly P-ELEMENT screen for genes that promote cell proliferation and suppress apoptosis during tissue growth 96 .Its sequence complementarity with the 3? UTR and its functional antagonism of the pro-apoptotic hid (head involution defective) gene were the first clues for the translational repression of hid by Bantam 73,96 .In addition, fly miR-14 was identified through a P-element screen for inhibitors of apoptotic cell death. Deficiency in miR-14 enhances cell death that is induced by the cell- death activator, Reaper, and results in defective stress responses and fat metabolism 97 .Loss of miR-14 also leads to an elevated level of Drice, an apoptotic effector caspase, indicating a direct or indirect repression of Drice by miR-14. Perhaps one of the most interesting miRNAs identified so far is lsy-6,a miRNA that is asymmetrically expressed in worm taste-receptor neurons to promote specific cell fate in left?right patterning. ASE left (ASEL) and ASE right (ASER) are two taste-receptor neurons, each with specific Following the identification of hundreds of miRNAs in various organisms, large-scale studies on miRNA- expression profiles were carried out in many model organisms using northern-blot analysis, microarrays and miRNA cloning 25,85?87 .miRNAs show dynamic tem- poral and spatial expression patterns, disruption of which is associated with developmental/physiological abnormalities (TABLE 1).For example, the miR-155 pre- cursor is enriched in Burkitt lymphoma tissues; the location of miR-155 correlates with a specific chromo- somal translocation 88 . miR-26a and miR-99a expression is reduced in human lung cancer cell lines, which corre- lates with their location in regions of loss of heterozygos- ity in lung tumours/cell lines 89 . miR-9 and miR-131 levels are reduced in Presenilin-1-deficient mice that show lethal developmental defects 90 .These findings indicate that miRNAs might have a general role in regulating gene expression in diverse developmental and physio- logical processes, and provide substantial hints that mis- regulation of miRNA function might contribute to human disease. Functional characterization of miRNAs Although the studies of lin-4 and let-7 shaped our understanding of miRNA molecular structures and functional mechanisms, their roles in temporal regula- tion of development only revealed one of many possi- ble aspects of miRNA function. Mutations in Dicer homologues disrupt the biogenesis of miRNAs, and cause diverse developmental defects, including germ- line defects in C. elegans 91 ,abnormal embryogenesis in A. thaliana 63 ,developmental arrest in zebrafish 92 and depletion of stem cells in mice 93 .Mutations in AGO family proteins are also associated with pleiotropic MERISTEM The undifferentiated tissue at the tips of stems and roots in which new cell division is concentrated. P-ELEMENTS A family of transposable elements that are widely used as the basis of tools for mutating and manipulating the Drosophila genome. WING DISC A sac-like structure of a mature third instar fly larva, which will give rise to the adult wing. Box1 | Bioinformatic predictions of microRNA targets The functional characterization of microRNAs (miRNAs) heavily relies on the identification of miRNA target genes. In plants, because certain miRNAs are nearly perfectly complementary to their targets, bioinformatic predictions of miRNA targets have proved to be relatively straightforward, and in fact, powerful 43 .Interestingly, many predicted miRNA targets are transcription factors, highlighting possible miRNA functions in regulating diverse developmental processes in plants 43 .However, the computational prediction of animal miRNA targets is more difficult, both because the miRNAs are only ~21?25 nucleotides long and because the miRNA-target pairings are not entirely complementary 100 .As a result, bioinformatic prediction has to rely on rules that are built on a few known miRNA-target interactions, which are generalized for genome-wide searches. Starting from 3 animal miRNAs, lin-4, let-7 and Bantam,the targets of which have been experimentally validated, the Cohen group screened the fly genome for miRNA targets on the basis of the following 3 criteria: perfect complementarity or G?U pairing between the target 3?-untranslated region (UTR) and the first 8 nucleotides of miRNA; favourable structural and thermodynamic heteroduplex formation between miRNA and its putative targets; and evolutionary conservation of miRNA target sites between Drosophila melanogaster and D. pseudoobscura 101 .To experimentally validate potential targets, they fused a GFP reporter gene upstream of the predicted target 3? UTR and examined GFP expression in WING DISC with and without overexpression of the corresponding miRNA 101 .Using this approach, they gained experimental support for the informatically predicted targets of three miRNAs, including Notch genes for miR-7,pro-apoptotic genes for miR-2 and genes that encode metabolic enzymes for miR-277 (REF. 101). The Burge group developed the TargetScan algorithm for predicting vertebrate miRNA targets on the basis of miRNA- target complementarity (particularly at the 5? region of the miRNA) and evolutionary conservation among vertebrates. In their first study, they experimentally validated 11 predicted targets out of 15 tested, using a HeLa cell reporter system that contains a luciferase reporter gene fused to the predicted target 3?-UTR fragments 100 .Among their predicted targets, 29% have unknown functions, whereas 71% have diverse functions, such as DNA binding, transcriptional regulation, signal- transducer and kinase activity 100 .Although the prediction success rate is difficult to determine on a genome-wide scale, these studies are an important step towards our understanding of miRNA function in animals. 530 | JULY 2004 | VOLUME 5 www.nature.com/reviews/genetics REVIEWS (TABLE 2).But, only a handful of miRNAs have been carefully studied so far, and the diverse expression pat- terns of miRNAs and altered miRNA expression under certain physiological conditions, such as tumor- igenesis, indicate a range of unknown functions that might extend beyond developmental regulation. In addition, bioinformatic predictions of miRNA targets (BOX 1) have revealed a diversity of regulatory pathways that might be subject to miRNA-mediated regulation. Overall, no specific indication has emerged that miRNA-mediated regulation is restricted to one bio- logical process. Instead, the emerging picture is that miRNAs have the potential to regulate almost all aspects of cellular physiology. Conclusions Since the discovery of miRNAs as stRNAs in C. ele- gans 13,18 ,remarkable advances in the characterization of this gene family have not only demonstrated that these small, non-coding RNAs are a prevalent class of regula- tory RNAs, but they have also indicated the outlines of a biochemical mechanism for their functions in gene regu- lation. However, with relatively few exceptions, we know little about the precise roles of the vast majority of miRNAs in regulating gene expression. Furthermore, the precise mechanisms by which miRNA- and siRNA- mediated repression might differ remain to be explained. For example, miRNAs and siRNAs mature in a similar way and join structurally related, if not identical, effector complexes. However, subtle differences between these classes of small RNA are beginning 4 , and will no doubt continue, to emerge as we understand more of the precise relationships between miRNAs, siRNAs and the protein components of the RNAi machinery. expression patterns of chemoreceptor genes. The specific lsy-6 expression in the ASEL neuron suppresses the expression of an Nkx-type homeobox gene, cog-1, thereby promoting the ASEL cell fate by specifying ASEL-specific expression of chemoreceptors. The functional characterization of plant miRNAs has also benefited from genetic mutations in miRNA genes. The miR-JAW gene was originally identified as a gain-of-function mutation causing the uneven leaf cur- vature and shape 98 .The identification of miR-JAW tar- gets ? the TCP genes ? was first indicated by their opposing biological functions during leaf morphogenesis and their sequence complementarity 98 . For most of the miRNAs for which genetic muta- tions are unavailable, functional characterization might have to begin with expression studies and/or bioinfor- matic predictions. For example, miR-181 is enriched in B-lymphoid cells of mouse bone marrow; this unique expression pattern led to the discovery of its function in promoting haematopoietic differentiation towards the B-cell lineage 99 . miR-39,which accumulatespredomi- nantly in the INFLORESCENCE TISSUE of A. thaliana 42 is another example. Using the sequence complementarity and overlapping expression pattern as the target search criteria, Llave et al. predicted the miR-39 targets as Scarecrow-like (SCL) family proteins and further con- firmed their hypothesis through biochemical studies (TABLE 2) 42 . Most of the miRNAs that have been characterized so far seem to regulate aspects of development, includ- ing larval developmental transitions and neuronal development in C. elegans,growth control and apopto- sis in D. melanogaster,haematopoietic differentiation in mammals and leaf development in A. thaliana INFLORESCENCE TISSUE The reproductive backbone that displays the flowers. 1. del Solar, G. & Espinosa, M. Plasmid copy number control: an ever-growing story. Mol. Microbiol. 37, 492?500 (2000). 2. Mlynarczyk, S. K. & Panning, B. X inactivation: Tsix and Xist as yin and yang. Curr. Biol. 10, R899?R903 (2000). 3. Ambros, V. MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing. Cell 113, 673?676 (2003). 4. Bartel, D .P. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281?297 (2004). 5. Lai, E. C. microRNAs: runts of the genome assert themselves. Curr. Biol. 13, R925?R936 (2003). 6. Pasquinelli, A. E. & Ruvkun, G. Control of developmental timing by micrornas and their targets. Annu. Rev. Cell Dev. Biol. 18, 495?513 (2002). 7. McManus, M. T. MicroRNAs and cancer. Semin. Cancer Biol. 13, 253?258 (2003). 8. Carrington, J. C. & Ambros, V. Role of microRNAs in plant and animal development. Science 301, 336?338 (2003). 9. Johnston, R. J. & Hobert, O. A microRNA controlling left/right neuronal asymmetry in Caenorhabditis elegans. Nature 426, 845?849 (2003). 10. Chalfie, M., Horvitz, H. R. & Sulston, J. E. Mutations that lead to reiterations in the cell lineages of C. elegans. Cell 24, 59?69 (1981). 11. Ambros, V. A hierarchy of regulatory genes controls a larva- to-adult developmental switch in C. elegans. Cell 57, 49?57 (1989). 12. Ambros, V. & Horvitz, H. R. Heterochronic mutants of the nematode Caenorhabditis elegans. Science 226, 409?416 (1984). 13. Lee, R. C., Feinbaum, R. L. & Ambros, V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, 843?854 (1993). Described the identification of the first microRNA, lin-4, and reported the sequence complementarity between lin-4 and the 3? UTR of the lin-14 mRNA. 14. Wightman, B., Burglin, T. R., Gatto, J., Arasu, P. & Ruvkun, G. Negative regulatory sequences in the lin-14 3?-untranslated region are necessary to generate a temporal switch during Caenorhabditis elegans development. Genes Dev. 5, 1813?1824 (1991). 15. Ruvkun, G. & Giusto, J. The Caenorhabditis elegans heterochronic gene lin-14 encodes a nuclear protein that forms a temporal developmental switch. Nature 338, 313?319 (1989). 16. Olsen, P. H. & Ambros, V. The lin-4 regulatory RNA controls developmental timing in Caenorhabditis elegans by blocking LIN-14 protein synthesis after the initiation of translation. Dev. Biol. 216, 671?680 (1999). 17. Ha, I., Wightman, B. & Ruvkun, G. A bulged lin-4/lin-14 RNA duplex is sufficient for Caenorhabditis elegans lin-14 temporal gradient formation. Genes Dev. 10, 3041?3050 (1996). 18. Wightman, B., Ha, I. & Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell 75, 855?862 (1993). Described the translational repression of LIN-14 by lin-4 during temporal regulation of larval development. This was the first functional characterization of a microRNA. 19. Moss, E. G., Lee, R. C. & Ambros, V. The cold shock domain protein LIN-28 controls developmental timing in C. elegans and is regulated by the lin-4 RNA. Cell 88, 637?646 (1997). 20. Reinhart, B.J. et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403, 901?906 (2000). 21. Lin, S. Y. et al. The C. elegans hunchback homolog, hbl-1, controls temporal patterning and is a probable microRNA target. Dev. Cell 4, 639?650 (2003). 22. Abrahante, J. E. et al. The Caenorhabditis elegans hunchback-like gene lin-57/hbl-1 controls developmental time and is regulated by microRNAs. Dev. Cell 4, 625?637 (2003). 23. Slack, F. J. et al. The lin-41 RBCC gene acts in the C. elegans heterochronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor. Mol. Cell 5, 659?669 (2000). 24. Vella, M. C., Choi, E. Y., Lin, S. Y., Reinert, K. & Slack, F. J. The C. elegans microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41 3? UTR. Genes Dev. 18, 132?137 (2004). 25. Lagos-Quintana, M. et al. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 12, 735?739 (2002). 26. Sempere, L. F. et al. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 5, R13 (2004). 27. Pasquinelli, A. E. et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature 408, 86?89 (2000). 28. Lee, Y. et al. The nuclear RNase III Drosha initiates microRNA processing. Nature 425, 415?419 (2003). Described the identification of Drosha and characterizes its function in processing pri-miRNA into pre-miRNA. 29. Lee, Y., Jeon, K., Lee, J. T., Kim, S. & Kim, V. N. MicroRNA maturation: stepwise processing and subcellular localization. EMBO J. 21, 4663?4670 (2002). 30. Hannon, G. J. RNA interference. Nature 418, 244?251 (2002). 31. Elbashir, S. M. et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411, 494?498 (2001). 32. Elbashir, S. M., Lendeckel, W. & Tuschl, T. RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev. 15, 188?200 (2001). 33. Zamore, P. D., Tuschl, T., Sharp, P. A. & Bartel, D. P. RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101, 25?33 (2000). NATURE REVIEWS | GENETICS VOLUME 5 | JULY 2004 | 531 REVIEWS 34. Baulcombe, D. Viruses and gene silencing in plants. Arch. Virol. 15 (Suppl.), 189?201 (1999). 35. Aufsatz, W., Mette, M. F., van der Winden, J., Matzke, A. J. & Matzke, M. RNA-directed DNA methylation in Arabidopsis. Proc. Natl Acad. Sci. USA 99 (Suppl 4), 16499?16506 (2002). 36. Mette, M. F., Aufsatz, W., van der Winden, J., Matzke, M. A. & Matzke, A. J. Transcriptional silencing and promoter methylation triggered by double-stranded RNA. EMBO J. 19, 5194?5201 (2000). 37. Grewal, S. I. & Moazed, D. Heterochromatin and epigenetic control of gene expression. Science 301, 798?802 (2003). 38. Volpe, T. A. et al. Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science 297, 1833?1837 (2002). 39. Ketting, R. F., Haverkamp, T. H., van Luenen, H. G. & Plasterk, R. H. Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. Cell 99, 133?141 (1999). 40. Tabara, H. et al. The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99, 123?132 (1999). 41. Chen, X. A MicroRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 303, 2022?2025 (2004). 42. Llave, C., Xie, Z., Kasschau, K. D. & Carrington, J. C. Cleavage of Scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science 297, 2053?2056 (2002). 43. Rhoades, M. W. et al. Prediction of plant microRNA targets. Cell 110, 513?520 (2002). The first bioinfomatic effort to predict microRNA targets on the basis of sequence complementarity between plant miRNAs and their putative targets. It has guided functional studies of several miRNAs. 44. Yekta, S., Shih, I. H. & Bartel, D. P. MicroRNA-directed cleavage of HOXB8 mRNA. Science 304, 594?596 (2004). 45. Doench, J. G., Petersen, C. P. & Sharp, P. A. siRNAs can function as miRNAs. Genes Dev. 17, 438?442 (2003). 46. Bernstein, E., Caudy, A. A., Hammond, S. M. & Hannon, G. J. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409, 363?366 (2001). Described the identification of Dicer and characterized its function in processing long dsRNAs into small interfering RNAs. 47. Hutvagner, G. et al. A cellular function for the RNA- interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293, 834?838 (2001). 48. Hammond, S. M., Boettcher, S., Caudy, A. A., Kobayashi, R. & Hannon, G. J. Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293, 1146?1150 (2001). Described the purification of the RISC, and the identification of Argonaute 2 as a key component. 49. Caudy, A. A., Myers, M., Hannon, G. J. & Hammond, S. M. Fragile X-related protein and VIG associate with the RNA interference machinery. Genes Dev. 16, 2491?2496 (2002). 50. Mourelatos, Z. et al. miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev. 16, 720?728 (2002). 51. Dostie, J., Mourelatos, Z., Yang, M., Sharma, A. & Dreyfuss, G. Numerous microRNPs in neuronal cells containing novel microRNAs. RNA 9, 180?186 (2003). 52. Lagos-Quintana, M., Rauhut, R., Meyer, J., Borkhardt, A. & Tuschl, T. New microRNAs from mouse and human. RNA 9, 175?179 (2003). 53. Zeng, Y. & Cullen, B. R. Sequence requirements for micro RNA processing and function in human cells. RNA 9, 112?123 (2003). 54. Lund, E., Guttinger, S., Calado, A., Dahlberg, J. E. & Kutay, U. Nuclear export of microRNA precursors. Science 303, 95?98 (2004). 55. Grishok, A. et al. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106, 23?34 (2001). 56. Ketting, R. F. et al. Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev. 15, 2654?2659 (2001). 57. Lingel, A., Simon, B., Izaurralde, E. & Sattler, M. Structure and nucleic-acid binding of the Drosophila Argonaute 2 PAZ domain. Nature 426, 465?469 (2003). 58. Song, J. J. et al. The crystal structure of the Argonaute2 PAZ domain reveals an RNA binding motif in RNAi effector complexes. Nature Struct. Biol. 10, 1026?1032 (2003). 59. Yan, K. S. et al. Structure and conserved RNA binding of the PAZ domain. Nature 426, 468?474 (2003). 60. Carmell, M. A. & Hannon, G. J. RNase III enzymes and the initiation of gene silencing. Nature Struct. Mol. Biol. 11, 214?218 (2004). 61. Blaszczyk, J. et al. Crystallographic and modeling studies of RNase III suggest a mechanism for double-stranded RNA cleavage. Structure (Camb) 9, 1225?1236 (2001). 62. Papp, I. et al. Evidence for nuclear processing of plant micro RNA and short interfering RNA precursors. Plant Physiol. 132, 1382?1390 (2003). 63. Park, W., Li, J., Song, R., Messing, J. & Chen, X. CARPEL FACTORY, a Dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Curr. Biol. 12, 1484?1495 (2002). 64. Timmons, L. The long and short of siRNAs. Mol. Cell 10, 435?437 (2002). 65. Schauer, S. E., Jacobsen, S. E., Meinke, D. W. & Ray, A. DICER-LIKE1: blind men and elephants in Arabidopsis development. Trends Plant Sci. 7, 487?491 (2002). 66. Pham, J. W., Pellino, J. L., Lee, Y. S., Carthew, R. W. & Sontheimer, E. J. A Dicer-2-dependent 80S complex cleaves targeted mRNAs during RNAi in Drosophila. Cell 117, 83?94 (2004). 67. Lee, Y. S. et al. Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell 117, 69?81 (2004). 68. Jin, P. et al. Biochemical and genetic interaction between the fragile X mental retardation protein and the microRNA pathway. Nature Neurosci. 7, 113?117 (2004). 69. Liu, Q. et al. R2D2, a bridge between the initiation and effector steps of the Drosophila RNAi pathway. Science 301, 1921?1925 (2003). 70. Pellino, J. L. & Sontheimer, E. J. R2D2 leads the silencing trigger to mRNA?s death star. Cell 115, 132?133 (2003). 71. Schwarz, D. S. et al. Asymmetry in the assembly of the RNAi enzyme complex. Cell 115, 199?208 (2003). 72. Khvorova, A., Reynolds, A. & Jayasena, S. D. Functional siRNAs and miRNAs exhibit strand bias. Cell 115, 209?216 (2003). This paper, together with reference 71, characterized the regulatory mechanism of the asymmetric assembly of siRNA/miRNA into the RISC complex. 73. Brennecke, J., Hipfner, D. R., Stark, A., Russell, R. B. & Cohen, S. M. Bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 113, 25?36 (2003). 74. Hake, S. MicroRNAs: a role in plant development. Curr. Biol. 13, R851?R852 (2003). 75. Carmell, M. A., Xuan, Z., Zhang, M. Q. & Hannon, G. J. The Argonaute family: tentacles that reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis. Genes Dev. 16, 2733?2742 (2002). 76. Caudy, A. A. et al. A micrococcal nuclease homologue in RNAi effector complexes. Nature 425, 411?414 (2003). 77. Lau, N. C., Lim, L. P., Weinstein, E. G. & Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294, 858?862 (2001). 78. Lagos-Quintana, M., Rauhut, R., Lendeckel, W. & Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science 294, 853?858 (2001). 79. Lee, R. C. & Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science 294, 862?864 (2001). This paper, together with references 77 and 78, was among the first cloning efforts to identify large numbers of miRNAs from worm, fly and mammals. 80. Kim, J. et al. Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. Proc. Natl Acad. Sci. USA 101, 360?365 (2004). 81. Griffiths-Jones, S. The microRNA Registry. Nucleic Acids Res. 32 (Database issue), D109?D111 (2004). 82. Reinhart, B. J., Weinstein, E. G., Rhoades, M. W., Bartel, B. & Bartel, D. P. MicroRNAs in plants. Genes Dev. 16, 1616?1626 (2002). 83. Lim, L. P., Glasner, M. E., Yekta, S., Burge, C. B. & Bartel, D. P. Vertebrate microRNA genes. Science 299, 1540 (2003). 84. Lim, L. P. et al. The microRNAs of Caenorhabditis elegans. Genes Dev. 17, 991?1008 (2003). 85. Sempere, L. F., Sokol, N. S., Dubrovsky, E. B., Berger, E. M. & Ambros, V. Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-complex gene activity. Dev. Biol. 259, 9?18 (2003). 86. Houbaviy, H. B., Murray, M. F. & Sharp, P. A. Embryonic stem cell-specific microRNAs. Dev. Cell 5, 351?358 (2003). 87. Aravin, A. A. et al. The small RNA profile during Drosophila melanogaster development. Dev. Cell 5, 337?350 (2003). 88. Metzler, M., Wilda, M., Busch, K., Viehmann, S. & Borkhardt, A. High expression of precursor microRNA- 155/BIC RNA in children with Burkitt lymphoma. Genes Chromosomes Cancer 39, 167?169 (2004). 89. Calin, G. A. et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc. Natl Acad. Sci. USA 101, 2999?3004 (2004). 90. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K. & Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA 9, 1274?1281 (2003). 91. Knight, S. W. & Bass, B. L. A role for the RNase III enzyme DCR-1 in RNA interference and germ line development in Caenorhabditis elegans. Science 293, 2269?2271 (2001). 92. Wienholds, E., Koudijs, M. J., van Eeden, F. J., Cuppen, E. & Plasterk, R. H. The microRNA-producing enzyme Dicer1 is essential for zebrafish development. Nature Genet. 35, 217?218 (2003). 93. Bernstein, E. et al. Dicer is essential for mouse development. Nature Genet. 35, 215?217 (2003). 94. Moussian, B., Schoof, H., Haecker, A., Jurgens, G. & Laux, T. Role of the ZWILLE gene in the regulation of central shoot meristem cell fate during Arabidopsis embryogenesis. EMBO J. 17, 1799?1809 (1998). 95. Cox, D. N. et al. A novel class of evolutionarily conserved genes defined by piwi are essential for stem cell self-renewal. Genes Dev. 12, 3715?3727 (1998). 96. Hipfner, D. R., Weigmann, K. & Cohen, S. M. The Bantam gene regulates Drosophila growth. Genetics 161, 1527?1537 (2002). 97. Xu, P., Vernooy, S. Y., Guo, M. & Hay, B. A. The Drosophila microRNA mir-14 suppresses cell death and is required for normal fat metabolism. Curr. Biol. 13, 790?795 (2003). 98. Palatnik, J. F. et al. Control of leaf morphogenesis by microRNAs. Nature 425, 257?263 (2003). 99. Chen, C. Z., Li, L., Lodish, H. F. & Bartel, D. P. MicroRNAs modulate hematopoietic lineage differentiation. Science 303, 83?86 (2004). 100. Lewis, B. P., Shih, I. H., Jones-Rhoades, M. W., Bartel, D. P. & Burge, C. B. Prediction of mammalian microRNA targets. Cell 115, 787?798 (2003). 101. Stark, A., Brennecke, J., Russell, R. B. & Cohen, S. M. Identification of Drosophila microRNA targets. PLoS Biol. 1, E60 (2003). 102. Calin, G. A. et al. Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc. Natl Acad. Sci. USA 99, 15524?15529 (2002). 103. Michael, M. Z., O?Connor, S. M., van Holst Pellekaan, N. G., Young, G. P. & James, R. J. Reduced accumulation of specific microRNAs in colorectal neoplasia. Mol. Cancer Res. 1, 882?891 (2003). 104. Tang, G., Reinhart, B. J., Bartel, D. P. & Zamore, P. D. A biochemical framework for RNA silencing in plants. Genes Dev. 17, 49?63 (2003). 105. Emery, J. F. et al. Radial patterning of Arabidopsis shoots by class III HD-ZIP and KANADI genes. Curr. Biol. 13, 1768?1774 (2003). 106. Juarez, M. T., Kui, J. S., Thomas, J., Heller, B. A. & Timmermans, M. C. microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity. Nature 428, 84?88 (2004). Acknowledgements We thank J. M. Silva, A. M. Denli, L. E. Palmer, J. Liu, P. J. Paddison and E. P. Murchson for stimulating discussions and helpful input. We also thank J. C. Duffy for help with the figures. We are particu- larly grateful to M. A. Carmell and Z. Xuan, who provided valuable comments and suggestions in the preparation of this manuscript. G.J.H. is supported by an Innovator Award from the US Army Breast Cancer Research Program and by grants from the National Institutes of Health. L.H. is a Helen Hay Whitney Fellow. Competing interests statement The authors declare that they have no competing financial interests. Online links DATABASES The following terms in this article are linked online to: Entrez: http://www.ncbi.nih.gov/Entrez AP2 | cog-1 | hbl-1 (lin-57) | Hoxb8 | let-7 | lin-4 | lin-14 | lin-28 | lin-41 | lys-6 | miR-9 | miR-99a | miR-155 | miR-181 | miR-196 TAIR: http: //www.arabidopsis.org DCL1 | DCL2 | DCL3 FURTHER INFORMATION miRNA Registry: http://www.sanger.ac.uk/Software/Rfam/mirna/ PHYLIP programs: http://evolution.genetics.washington.edu/phylip.html Access to this links box is available online. REVIEWS NATURE REVIEWS | GENETICS CORRECTION MicroRNAs: SMALL RNAs WITH A BIG ROLE IN GENE REGULATION Lin He and Gregory J. Hannon Nature Reviews Genetics 5, 522?531 (2004); doi: 10.1038/nrg1379 In figure 2, the orientation of some RNA structures was incorrect. The corrected version is shown below. This correction has been made to the online enhanced text and PDF version of this review. Some miRNA ORF RISC RISC RISC Ribosome Cytoplasm Nucleus dsRNA Unwind miRNA: miRNA* duplex siRNA duplex Asymmetric RISC assembly Translational repression mRNA cleavage Target mRNA Pre-miRNA Pri-miRNA miRNA Gene Exportin 5 Dicer Drosha RISC RISC "
Add Content to Group
|
Bookmark
|
Keywords
|
Flag Inappropriate
share
Close
Digg
Facebook
MySpace
Google+
Comments
Close
Please Post Your Comment
*
The Comment you have entered exceeds the maximum length.
Submit
|
Cancel
*
Required
Comments
Please Post Your Comment
No comments yet.
Save Note
Note
View
Public
Private
Friends & Groups
Friends
Groups
Save
|
Cancel
|
Delete
Please provide your notes.
Next
|
Prev
|
Close
|
Edit
|
Delete
Genetics
Gene Inheritance and Transmission
Gene Expression and Regulation
Nucleic Acid Structure and Function
Chromosomes and Cytogenetics
Evolutionary Genetics
Population and Quantitative Genetics
Genomics
Genes and Disease
Genetics and Society
Cell Biology
Cell Origins and Metabolism
Proteins and Gene Expression
Subcellular Compartments
Cell Communication
Cell Cycle and Cell Division
Scientific Communication
Career Planning
Loading ...
Scitable Chat
Register
|
Sign In
Visual Browse
Close
Comments
CloseComments
Please Post Your Comment