Skip to main content

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

  • Letter
  • Published:

MIMIVIRE is a defence system in mimivirus that confers resistance to virophage

Nature volume 531, pages 249–252 (2016)Cite this article

Subjects

Abstract

Since their discovery, giant viruses have revealed several unique features that challenge the conventional definition of a virus, such as their large and complex genomes, their infection by virophages and their presence of transferable short element transpovirons1,2,3,4,5. Here we investigate the sensitivity of mimivirus to virophage infection in a collection of 59 viral strains and demonstrate lineage specificity in the resistance of mimivirus to Zamilon6, a unique virophage that can infect lineages B and C of mimivirus but not lineage A. We hypothesized that mimiviruses harbour a defence mechanism resembling the clustered regularly interspaced short palindromic repeat (CRISPR)-Cas system that is widely present in bacteria and archaea7,8,9,10. We performed de novo sequencing of 45 new mimivirus strains and searched for sequences specific to Zamilon in a total of 60 mimivirus genomes. We found that lineage A strains are resistant to Zamilon and contain the insertion of a repeated Zamilon sequence within an operon, here named the ‘mimivirus virophage resistance element’ (MIMIVIRE). Further analyses of the surrounding sequences showed that this locus is reminiscent of a defence mechanism related to the CRISPR–Cas system. Silencing the repeated sequence and the MIMIVIRE genes restores mimivirus susceptibility to Zamilon. The MIMIVIRE proteins possess the typical functions (nuclease and helicase) involved in the degradation of foreign nucleic acids. The viral defence system, MIMIVIRE, represents a nucleic-acid-based immunity against virophage infection.

This is a preview of subscription content, access via your institution

Access options

Buy this article

  • Purchase on Springer Link
  • Instant access to full article PDF
Buy now

Prices may be subject to local taxes which are calculated during checkout

Figure 1: Chromosomal environment of the MIMIVIRE locus of Mimiviridae and virophage infection.

Similar content being viewed by others

References

  1. La Scola, B. et al. A giant virus in amoebae. Science 299, 2033 (2003)

    Article  CAS  Google Scholar 

  2. Koonin, E. V. & Dolja, V. V. Virus world as an evolutionary network of viruses and capsidless selfish elements. Mol. Biol. Rep. 78, 278–303 (2014)

    CAS  Google Scholar 

  3. Forterre, P. Giant viruses: conflicts in revisiting the virus concept. Intervirology 53, 362–378 (2010)

    Article  Google Scholar 

  4. La Scola, B. et al. The virophage as a unique parasite of the giant mimivirus. Nature 455, 100–104 (2008)

    Article  CAS  ADS  Google Scholar 

  5. Raoult, D. How the virophage compels the need to readdress the classification of microbes. Virology 477, 119–124 (2015)

    Article  CAS  Google Scholar 

  6. Gaia, M. et al. Zamilon, a novel virophage with Mimiviridae host specificity. PLoS ONE 9, e94923 (2014)

    Article  ADS  Google Scholar 

  7. Makarova, K. S. et al. An updated evolutionary classification of CRISPR-Cas systems. Nature Rev. Microbiol. 13, 722–736 (2015)

    CAS  Google Scholar 

  8. Makarova, K. S., Wolf, Y. I. & Koonin, E. V. Comparative genomics of defense systems in archaea and bacteria. Nucleic Acids Res. 41, 4360–4377 (2013)

    Article  CAS  Google Scholar 

  9. Marraffini, L. A. CRISPR-Cas immunity in prokaryotes. Nature 526, 55–61 (2015)

    Article  CAS  ADS  Google Scholar 

  10. Barrangou, R. & Marraffini, L. A. CRISPR-Cas systems: prokaryotes upgrade to adaptive immunity. Mol. Cell 54, 234–244 (2014)

    Article  CAS  Google Scholar 

  11. Bickle, T. A. & Kruger, D. H. Biology of DNA restriction. Microbiol. Rev. 57, 434–450 (1993)

    CAS  PubMed  PubMed Central  Google Scholar 

  12. Pourcel, C. & Drevet, C. in CRISPR-Cas Systems 33–59 (Springer, 2012)

  13. Seed, K. D., Lazinski, D. W., Calderwood, S. B. & Camilli, A. A bacteriophage encodes its own CRISPR/Cas adaptive response to evade host innate immunity. Nature 494, 489–491 (2013)

    Article  CAS  ADS  Google Scholar 

  14. Raoult, D. TRUC or the need for a new microbial classification. Intervirology 56, 349–353 (2013)

    Article  Google Scholar 

  15. Filée, J. & Chandler, M. Gene exchange and the origin of giant viruses. Intervirology 53, 354–361 (2010)

    Article  Google Scholar 

  16. Boyer, M. et al. Mimivirus shows dramatic genome reduction after intraamoebal culture. Proc. Natl Acad. Sci. USA 108, 10296–10301 (2011)

    Article  CAS  ADS  Google Scholar 

  17. Raoult, D. & Boyer, M. Amoebae as genitors and reservoirs of giant viruses. Intervirology 53, 321–329 (2010)

    Article  Google Scholar 

  18. Zhang, J., Kasciukovic, T. & White, M. F. The CRISPR associated protein Cas4 is a 5′ to 3′ DNA exonuclease with an iron-sulfur cluster. PLoS ONE 7, e47232 (2012)

    Article  CAS  ADS  Google Scholar 

  19. Sobhy, H., La Scola, B., Pagnier, I., Raoult, D. & Colson, P. Identification of giant Mimivirus protein functions using RNA interference. Front. Microbiol. 6, 345 (2015)

    PubMed  Google Scholar 

  20. Slimani, M., Pagnier, I., Raoult, D. & La Scola, B. Amoebae as battlefields for bacteria, giant viruses, and virophages. J. Virol. 87, 4783–4785 (2013)

    Article  CAS  Google Scholar 

  21. Makarova, K. S., Grishin, N. V., Shabalina, S. A., Wolf, Y. I. & Koonin, E. V. A putative RNA-interference-based immune system in prokaryotes: computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biol. Direct 1, 7 (2006)

    Article  Google Scholar 

  22. Yutin, N., Raoult, D. & Koonin, E. V. Virophages, polintons, and transpovirons: a complex evolutionary network of diverse selfish genetic elements with different reproduction strategies. Virol. J. 10, 158 (2013)

    Article  CAS  Google Scholar 

  23. Besemer, J. Lomsadz, A. & Borodovsky, M. GeneMarkS: a self-training method for prediction of gene starts in microbial genomes. Implications for finding sequence motifs in regulatory regions. Nucleic Acids Res. 29, 2607–2618 (2001)

    Article  CAS  Google Scholar 

  24. Altschul, S. F. et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389–3402 (1997)

    Article  CAS  Google Scholar 

  25. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797 (2004)

    Article  CAS  Google Scholar 

  26. La Scola, B., Mezi, L., Weiller, P. J. & Raoult, D. Isolation of Legionella anisa using an amoebic coculture procedure. J. Clin. Microbiol. 39, 365–366 (2001)

    Article  CAS  Google Scholar 

  27. Mba Medie, F., Ben Salah, I., Henrissat, B., Raoult, R. & Drancourt, M. Mycobacterium tuberculosis complex mycobacteria as amoeba-resistant organisms. PLoS ONE 6, e20499 (2011)

    Article  CAS  ADS  Google Scholar 

Download references

Acknowledgements

We thank S. Benamar, A. Caputo and C. Robert for technical support, and L. Pinault for her assistance on protein production.

Author information

Author notes

  1. Anthony Levasseur and Meriem Bekliz: These authors contributed equally to this work.

Authors and Affiliations

  1. Aix-Marseille Université, Unité de Recherche sur les Maladies Infectieuses et Tropicales Emergentes (URMITE), UM63, CNRS 7278, IRD 198, INSERM, Marseille, U1095, France

    Anthony Levasseur, Meriem Bekliz, Eric Chabrière, Bernard La Scola & Didier Raoult

  2. IHU Méditerranée Infection, Pôle des Maladies Infectieuses, Assistance Publique-Hôpitaux de Marseille, Faculté de Médecine, 27 Boulevard Jean Moulin, Marseille, 13005, France

    Anthony Levasseur, Meriem Bekliz, Eric Chabrière, Bernard La Scola & Didier Raoult

  3. Aix-Marseille Université, CNRS, Centrale Marseille, I2M, UMR7373, FR 4213 - FR Eccorev 3098, équipe EBM, Marseille, 13331, France

    Pierre Pontarotti

Authors
  1. Anthony Levasseur
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Meriem Bekliz
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Eric Chabrière
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Pierre Pontarotti
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Bernard La Scola
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Didier Raoult
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

A.L., B.L. and D.R. conceived the project and designed the study and experiments; A.L., M.B., P.P., B.L. and D.R. analysed the results; A.L. and D.R. wrote the manuscript. All authors read and approved the final manuscript.

Corresponding authors

Correspondence to Bernard La Scola or Didier Raoult.

Ethics declarations

Competing interests

The authors declare no competing financial interests.

Extended data figures and tables

Extended Data Figure 1 Histogram depicting the replication of Zamilon and Sputnik 3 DNA in Mimiviridae after its phylogenetic classification into lineages A, B and C.

The replication of each virophage was measured after 24 h using qPCR. The term Δ CT corresponds to the difference between the CT value specific to virophage at H0 and H24.

Extended Data Figure 2 The MIMIVIRE defence system.

a, A comparative model between prokaryotic CRISPR–Cas system and the viral MIMIVIRE system in APMV-A. b, The chromosomal environment of Mimiviridae lineage A is illustrated using mimivirus as an example. This organization is conserved across all APMV-A genomes. The 28-nucleotide-long Zamilon insert sequence is AATCTGATAATGAATCTGATAATGAATC, and the derived 15-nucleotide repeated unit is TGATAATGAATCTGA. The four repeats units are separated by 9, 48 and 63 nucleotides, respectively.

Extended Data Figure 3 Agarose gel electrophoresis of different DNA products treated with and without nuclease and/or helicase enzymes.

C, control; N, nuclease treatment for 2 h; H, helicase treatment for 2 h; H+N, helicase and nuclease treatment for 2 h; H*, helicase treatment for 2 h followed by heating at 94 °C for 10 min; H+N*, helicase and nuclease treatment for 2 h followed by heating at 94 °C for 10 min.

Extended Data Figure 4 Phylogenetic trees based on the sequences of the two Cas proteins.

a, R350. b, R354.

Extended Data Table 1 Identification of the Zamilon sequences that were found inserted into the 60 genomes of Mimiviridae
Full size table
Extended Data Table 2 Functional inferences of the open reading frames in the vicinity of the MIMIVIRE locus in mimivirus
Full size table

Supplementary information

Supplementary Information

This file contains Supplementary Tables 1-3. (PDF 156 kb)

PowerPoint slides

Rights and permissions

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Levasseur, A., Bekliz, M., Chabrière, E. et al. MIMIVIRE is a defence system in mimivirus that confers resistance to virophage. Nature 531, 249–252 (2016). https://doi.org/10.1038/nature17146

Download citation

  • Received:

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1038/nature17146

This article is cited by

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Search

Advanced search

Quick links

Nature Briefing Microbiology

Sign up for the Nature Briefing: Microbiology newsletter — what matters in microbiology research, free to your inbox weekly.

Get the most important science stories of the day, free in your inbox. Sign up for Nature Briefing: Microbiology