Table 1: Mouse-specific primer sequences used for real-time PCR.

From: Vitamin D treatment attenuates 2,4,6-trinitrobenzene sulphonic acid (TNBS)-induced colitis but not oxazolone-induced colitis

Primer nameForward (5′ - 3′)Reverse (3′ - 5′)
mouse TNF-αATGAGCACAGAAAGCATGAAGTAGACAGAAGAGCGTGGT
mouse IFN-γTTCTTCAGCAACAGCAAGGCTCAGCAGCGACTCCTTTTCC
mouse IL-2TTGTGCTCCTTGTCAACAGCCTGGGGAGTTTCAGGTTCCT
mouse IL-4AACGAGGTCACAGGAGAAGGTCTGCAGCTCCATGAGAACA
mouse IL-5ACCGAGCTCTGTTGACAAGTCCTCGCCACACTTCTCTTT
mouse IL-6CCTCTGGTCTTCTGGAGTACCACTCCTTCTGTGACTCCAGC
mouse IL-10ATAACTGCACCCACTTCCCAGGGCATCACTTCTACCAGGT
mouse IL-12GATGACATGGTGAAGACGGCAGGCACAGGGTCATCATCAA
mouse IL-13GCAGCATGGTATGGAGTGTGTGGCGAAACAGTTGCTTTGT
mouse IL-17TCTCCACCGCAATGAAGACCCACACCCACCAGCATCTTCT
mouse IL-23GCTGTGCCTAGGAGTAGCAGTGGCTGTTGTCCTTGAGTCC
mouse MCP-1GCTCAGCCAGATGCAGTTAATCTTGAGCTTGGTGACAAAAACT
mouse TGF-β1CCTGCAAGACCATCGACATGTGTTGTACAAAGCGAGCACC
mouse Claudin-2TATGTTGGTGCCAGCATTGTTCATGCCCACCACAGAGATA
mouse OccludinCCTCCAATGGCAAAGTGAATCTCCCCACCTGTCGTGTAGT
mouse ZO-1CCACCTCTGTCCAGCTCTTCCACCGGAGTGATGGTTTTCT
mouse B2MCGGCCTGTATGCTATCCAGAGGGTGAATTCAGTGTGAGCC