Table 1 PCR primer sequences.

From: A novel AhR ligand, 2AI, protects the retina from environmental stress

Gene Forward Sequence Reverse Sequence
TBP cggctgtttaacttcgcttc cacacgccaagaaacagtga
AhR agtggtcccagcctacacc cgactggcgtaggtgatgt
CYP1a1 ggagcactacaaaacctttgaga tcatctgacagctggacattg
CYP1b1 tgagtgccgtgtgtttcgg gtgcctcaagaacttgtccag
CD36 tggaacagaggctgacaactt ttgattttgatagatatgggatg
NRF2 atgacaatgaggtttcttcgg caatgaagactgggctctc
KEAP1 gagaatctacgtccttggagg caggtgtctgtatctgggtc
GCLC aagtggatgtggacaccag ctgtcattagttctccagatgc
GCLM gttgacatggcctgttcag aactccatcttcaataggaggt
NQO1 acatcacaggtaaactgaagg tcagatggccttctttataagc
HMOX1 aactccctggagatgactc ctcaaagagctggatgttgag
SCD1 cctagaagctgaggaactggtg acatcatcagcaagccaggt
  1. Sequences of PCR primers used to measure expression of genes related to the AhR and NRF2 pathways are listed in the table.