Table 3: Sequence-characterized amplified region/cleaved amplified polymorphic sequence (SCAR/CAPS) markers linked to the Ty-1, Ty-2 and Ty-3 locus on tomato chromosomes.

From: Tomato yellow leaf curl virus (TYLCV-IL): a seed-transmissible geminivirus in tomatoes

Target locus Sequence (5′ – 3′)Reference
Ty-1 (CAPS)ForwardATGAAGACAAAAACTGCTTCJi, et al.41
ReverseTCAGGGTTTCACTTCTATGAAT
Ty-2 (SCAR)ForwardTGGCTCATCCTGAAGCTGATAGCGCGarcia, et al.39
ReverseAGTGTACATCCTTGCCATTGACT
Ty-3 (SCAR)ForwardGGTAGTGGAAATGATGCTGCTCJi, et al.40
ReverseGCTCTGCCTATTGTCCCATATATAACC