Table 2: Primer sets used for amplification of TYLCV in this study.

From: Tomato yellow leaf curl virus (TYLCV-IL): a seed-transmissible geminivirus in tomatoes

Primer nameSequence (5′ – 3′)Target size
Detection PCR
 TYLCV-FGATGGCCGCGCCTTTTCCTTTTATGTGG390 bp
 TYLCV-RGCTGCTGTATGGGCTGTCGAAGTTCAG
Real-time PCR
 TYLCV-C1-FGCTCGTAGAGGGTGACGAA164 bp
 TYLCV-C1-RCACAAAGTACGGGAAGCCCA
 GAPDH-FGCCACTCAGAAGACCGTTGA188 bp
 GAPDH-RAGGTCAACCACGGACACATC
Full length sequencing
 TYLCV-FL-FCTTACTTATACCTGGACACCTAATGGC2774 bp
 TYLCV-FL-RACACCGATACACCGATTGCCATAG