Table 1: Characteristics of the 30 analyzed simple sequence repeat (SSR) markers.

From: Interspecific hybridization, polyploidization, and backcross of Brassica oleracea var. alboglabra with B. rapa var. purpurea morphologically recapitulate the evolution of Brassica vegetables

SSRprimer-Fprimer-RBand in A genome (bp)Band in C genome (bp)Locus on A genomeLocus on C genome
C01bGCAACACTTGCTGTTTTGGAGCTGAGGTAGGAAGGGAAGG207233A01_15917060C01_20708918
C01cATCAACGAGGATGTTGGAGATGACCCAATCAGGTCAAGAA189183A01_20992040C01_31003906
C02a2GATCGACCTTCCATCACGTCCCTTGTGCAAGAAGGTGTTG199176A02_4660427C02_6784924
C02b2ATATACACATGGCCGGTGCTTTGGTGGAGTTTCCGAGTTT114100A02_11831311C02_16112719
C02c2TTGGCTTCAACGTGTCTGAGCCACTTAGGCGATGGTGTTT179146A02_15538343C02_24870903
C02d2TGGGTTCGAATAAGTCGGATCTTGGCCCATCATCAAAACT278193A02_21212404C02_37480057
C02dGTCAGGGCCGGTTGGTATCCAAAACCGAACTAAACGGA278266A02_26805121C02_42253466
C03a2GGACTAGGCCCAGAAAGGTCATGAGAATCACACGCGTCAC181141A03_5096072C03_5782559
C03bCCGGACCATAAATTATCGCAGCTCCTCCTCCTCCATCTTC165174A03_9810560C03_11586692
C03cAGCCGTTGAATCATAATGGCAATGACAAACGCCGGTCTAC142100A06_16840545C03_29211252
C04a2AAAGTCAGGCGTCTTTCTGCTTGTTGTTGTATAGACCAGACA269137A05_3393634C04_6311603
C04b2CATCACCACCATCTACACGCATACAAACTGCCGAGACGCT153130A05_7742417C04_17130510
C04cGCAAAGACCTTTTTGCAAGCACCGACCAAAGGTGAACAAC213253A04_9337281C04_28980301
C04dCGAAGAAATGGGCAATGAGTCCATGGTCGGACAATCTCTT12393A04_18399294C04_40018307
C05bCTCGCATTGAAGGAGTGTCAATCTCCAGCCTTTTCCAGGT263255A06_6560520C05_13746011
C05c2AAAAGCAACCAAAGCGCTAATCGTTTCCTTGATTGCTTCC139114A06_8543638C05_21938996
C06bCGTTGTTTGTCGTCTGCATCGCCGAATCAGAACCGTTAGA246238A06_1811353C06_13619390
C06b2TGGAATCACTTCAGCGTTCAACGAGTTTTCTCGGCTTTCA26572A06_14493472C06_17947219
C06c2TCAGTATTCTCATCGCCCAAAGGTCGACCAAAGACGAAAA188146A07_15806647C06_28866205
C06d2GCTTCATTGGATCCCACATCGGGTTCGTGATTGATGGTAAA143117A07_19411829C06_35244684
C07aATCCGACCAGTAACGTCCAGGGGGGATTACCTTCATCTTTT217208A06_24653900C07_463379
C07bCCCGTAGTTAGAACACCCGAGCGCAGACCTAGCCTTATTG248265A07_8821086C07_16930026
C07c2TGATGGGTAAAATGCTCCAACTGCGTCTTTTCTTCCAGTG160125A06_23763438C07_27826196
C07d2CGCGTAGAAGTAGTTCCAGTGTCATCAAACGTGGAGGTCAA167131A03_23672505C07_41422404
C08a2TGTTTTCAGCACCTTTTCAAGACAAGCAGTGCAACCACAAAG241129A08_5763859C08_5598895
C08b2TGCTGCTAAGTCTAGTCCACAACCTCAAGATCCACAATGCCT248178A08_19250863C08_18384496
C08c2ACTCTCAACAATGGCAAGGGGCTGTTTTCCATATTCGGCT215159A09_31431992C08_32596668
C08dCATCGGCCGTAACAAAGAATCAGAAACGGGATTCGATCAT253231A09_38876771C08_41482344
C09c2TAGCCAACTAACATGGCACGGCCCACATCTTTCAAAACAAA177143A10_9735500C09_28720170
C09d2AAGCTACTTGCCTCACTATCCTTGATTTCACATAAGGTCCCCA250159A10_12909906C09_35598537