Table 2: Quantitative PCR primers sequences.

From: Busulfan and cyclosphamide induce liver inflammation through NLRP3 activation in mice after hematopoietic stem cell transplantation

Target genesPrimers sequence (5′-3′)
ForwardReverse
IL-1βCCTGAACTCAACTGTGAAATGCGATGTGCTGCTGCGAGATT
IL-18ATGGAGACCTGGAATCAGACTGTCAACGAAGAGAACTTGG
Caspase-1ATCTTTCTCCGAGGGTTGGAAGTCTTGTGCTCTGGGCAG
NLRP3AAGAAGAGAGGAGAGGAGGTCGCGGTTGGTGCTTAGACTTGA
β-actinCTGAGAGGGAAATCGTGCGTAACCGCTCGTTGCCAATAGT