Table 1 List of RT-PCR primers.

From: Human Induced Pluripotent Stem Cell Derived Neuronal Cells Cultured on Chemically-Defined Hydrogels for Sensitive In Vitro Detection of Botulinum Neurotoxin

Gene Forward Primer (5′-3′) Reverse Primer (5′-3′)
vGluT1 TACACGGCTCCTTTTTCTGG CTGAGGGGATCAGCATGTTT
SLC18A3 CATCGCCGACATCTCCTATT AGCAAGACGGGAGCATAGAG
SLC32A1 CACGACAAGCCCAAAATCAC AGAAACAACCCCAGGTAGCC
ChAT AAAAGGTCCCCCGTAAGATG TGCTCCTCAGACACCAAGTG
DBH TCTCGGCACCACATTATCAA TCGGGTTTCATCTTGGAGTC
GAD67 CCTGGAACTGGCTGAATACC CCCTGAGGCTTTGTGGAATA
vGluT2 ATTCCATCAGCAGCCAGAGT AGGAGGTGGTTGCCAGTCTA
GFAP GGTTGAGAGGGACAATCTGG CAGCCTCAGGTTGGTTTCAT
RBFOX3 CCGAGTGATGACCAACAAGA GAATTCAGGCCCGTAGACTG
TuB3 GGCCTTTGGACATCTCTTCA CCTCCGTGTAGTGACCCTTG